ID: 1164986097

View in Genome Browser
Species Human (GRCh38)
Location 19:32649858-32649880
Sequence GTCCCCAAAGGCGCTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164986094_1164986097 -3 Left 1164986094 19:32649838-32649860 CCACCTCAGCAGAACAAGGTGTC 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1164986097 19:32649858-32649880 GTCCCCAAAGGCGCTCCAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 109
1164986092_1164986097 4 Left 1164986092 19:32649831-32649853 CCATTTACCACCTCAGCAGAACA 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1164986097 19:32649858-32649880 GTCCCCAAAGGCGCTCCAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 109
1164986095_1164986097 -6 Left 1164986095 19:32649841-32649863 CCTCAGCAGAACAAGGTGTCCCC 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1164986097 19:32649858-32649880 GTCCCCAAAGGCGCTCCAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164986097 Original CRISPR GTCCCCAAAGGCGCTCCAGC TGG Intronic