ID: 1164986097 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:32649858-32649880 |
Sequence | GTCCCCAAAGGCGCTCCAGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 121 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 11, 4: 109} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1164986092_1164986097 | 4 | Left | 1164986092 | 19:32649831-32649853 | CCATTTACCACCTCAGCAGAACA | 0: 1 1: 0 2: 1 3: 12 4: 156 |
||
Right | 1164986097 | 19:32649858-32649880 | GTCCCCAAAGGCGCTCCAGCTGG | 0: 1 1: 0 2: 0 3: 11 4: 109 |
||||
1164986095_1164986097 | -6 | Left | 1164986095 | 19:32649841-32649863 | CCTCAGCAGAACAAGGTGTCCCC | 0: 1 1: 0 2: 1 3: 6 4: 124 |
||
Right | 1164986097 | 19:32649858-32649880 | GTCCCCAAAGGCGCTCCAGCTGG | 0: 1 1: 0 2: 0 3: 11 4: 109 |
||||
1164986094_1164986097 | -3 | Left | 1164986094 | 19:32649838-32649860 | CCACCTCAGCAGAACAAGGTGTC | 0: 1 1: 0 2: 1 3: 7 4: 124 |
||
Right | 1164986097 | 19:32649858-32649880 | GTCCCCAAAGGCGCTCCAGCTGG | 0: 1 1: 0 2: 0 3: 11 4: 109 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1164986097 | Original CRISPR | GTCCCCAAAGGCGCTCCAGC TGG | Intronic | ||