ID: 1164986101

View in Genome Browser
Species Human (GRCh38)
Location 19:32649869-32649891
Sequence CGCTCCAGCTGGACACACAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164986094_1164986101 8 Left 1164986094 19:32649838-32649860 CCACCTCAGCAGAACAAGGTGTC 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1164986101 19:32649869-32649891 CGCTCCAGCTGGACACACAGCGG 0: 1
1: 0
2: 2
3: 12
4: 134
1164986095_1164986101 5 Left 1164986095 19:32649841-32649863 CCTCAGCAGAACAAGGTGTCCCC 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1164986101 19:32649869-32649891 CGCTCCAGCTGGACACACAGCGG 0: 1
1: 0
2: 2
3: 12
4: 134
1164986092_1164986101 15 Left 1164986092 19:32649831-32649853 CCATTTACCACCTCAGCAGAACA 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1164986101 19:32649869-32649891 CGCTCCAGCTGGACACACAGCGG 0: 1
1: 0
2: 2
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164986101 Original CRISPR CGCTCCAGCTGGACACACAG CGG Intronic