ID: 1164986104

View in Genome Browser
Species Human (GRCh38)
Location 19:32649879-32649901
Sequence GGACACACAGCGGGACCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 248}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164986094_1164986104 18 Left 1164986094 19:32649838-32649860 CCACCTCAGCAGAACAAGGTGTC 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1164986104 19:32649879-32649901 GGACACACAGCGGGACCTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 248
1164986099_1164986104 -5 Left 1164986099 19:32649861-32649883 CCCAAAGGCGCTCCAGCTGGACA 0: 1
1: 0
2: 0
3: 11
4: 214
Right 1164986104 19:32649879-32649901 GGACACACAGCGGGACCTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 248
1164986098_1164986104 -4 Left 1164986098 19:32649860-32649882 CCCCAAAGGCGCTCCAGCTGGAC 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1164986104 19:32649879-32649901 GGACACACAGCGGGACCTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 248
1164986092_1164986104 25 Left 1164986092 19:32649831-32649853 CCATTTACCACCTCAGCAGAACA 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1164986104 19:32649879-32649901 GGACACACAGCGGGACCTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 248
1164986100_1164986104 -6 Left 1164986100 19:32649862-32649884 CCAAAGGCGCTCCAGCTGGACAC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1164986104 19:32649879-32649901 GGACACACAGCGGGACCTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 248
1164986095_1164986104 15 Left 1164986095 19:32649841-32649863 CCTCAGCAGAACAAGGTGTCCCC 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1164986104 19:32649879-32649901 GGACACACAGCGGGACCTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164986104 Original CRISPR GGACACACAGCGGGACCTGC TGG Intronic