ID: 1164986472

View in Genome Browser
Species Human (GRCh38)
Location 19:32652217-32652239
Sequence GTGGGGACCCAGAAATTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 7, 3: 21, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164986465_1164986472 27 Left 1164986465 19:32652167-32652189 CCAGAGTTACCGGCATAGACGAA 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1164986472 19:32652217-32652239 GTGGGGACCCAGAAATTTCAAGG 0: 1
1: 0
2: 7
3: 21
4: 154
1164986466_1164986472 18 Left 1164986466 19:32652176-32652198 CCGGCATAGACGAAGTTCAGAGT 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1164986472 19:32652217-32652239 GTGGGGACCCAGAAATTTCAAGG 0: 1
1: 0
2: 7
3: 21
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164986472 Original CRISPR GTGGGGACCCAGAAATTTCA AGG Intronic
901665910 1:10826037-10826059 CTGGGGACCCAGCACTTTCTTGG + Intergenic
903364995 1:22800811-22800833 CTGGGGACCAAGATATGTCAGGG + Intronic
905516146 1:38563483-38563505 GTGAGGACCCAGAAATGGCCAGG - Intergenic
908097150 1:60750905-60750927 GTGGGGGCCCAGAACCTTCTGGG - Intergenic
910815028 1:91282962-91282984 GAGGGCTCCCAAAAATTTCAAGG + Intronic
911441666 1:97934657-97934679 GTGAGCAGCCAGAGATTTCAGGG - Intergenic
914357455 1:146899029-146899051 GTGTGGATCCAGAGATCTCATGG - Intergenic
921757010 1:218869431-218869453 GTGGGGAACTAGAAATATGATGG - Intergenic
922469781 1:225868906-225868928 CTGGGGACTCAGAAATTTCCAGG + Intronic
922616866 1:226965809-226965831 GTGGGGACCCAGCAATATCCCGG + Intronic
924036771 1:239945739-239945761 GTGGGGAGGTAGAGATTTCAGGG - Intergenic
1065591089 10:27262567-27262589 GTTGGGAGCCAGCAGTTTCAAGG - Intergenic
1065659944 10:27995546-27995568 GTTGGGAGCCAGCAGTTTCAGGG + Intronic
1067821502 10:49535021-49535043 CTGGGGCCCAAGAAATATCACGG + Intronic
1070471017 10:76779588-76779610 TCAGGGACCCAGAAATCTCAAGG - Intergenic
1076235673 10:128862206-128862228 GTGTGGACCCAGAAATTGCAAGG + Intergenic
1077708730 11:4514725-4514747 GGTAGGACCCAGACATTTCATGG + Intergenic
1078820945 11:14881364-14881386 GTGGAGACTCTGAAATTTTAAGG - Intronic
1079899370 11:26162403-26162425 CTGGGAACTTAGAAATTTCATGG + Intergenic
1080556421 11:33421383-33421405 GTGGGTAGCAAGAAATTGCATGG - Intergenic
1080556775 11:33424666-33424688 GAGGGGACTCAAAAAGTTCATGG - Intergenic
1082968450 11:58993234-58993256 GATGGCACCCAGAAATTACAGGG + Intronic
1083119636 11:60498728-60498750 GTGAGGAGGCAGCAATTTCAAGG + Intronic
1084708043 11:70827190-70827212 GTGGGGAGCCAGAGAAGTCATGG - Intronic
1085711640 11:78834499-78834521 GTGGGGACCCAGGGATTTTGTGG + Intronic
1085830176 11:79891875-79891897 CTGGGGACCCTGGAATATCATGG - Intergenic
1086759473 11:90609558-90609580 GTGGGGGCCTGGAAGTTTCAAGG + Intergenic
1086963913 11:93008223-93008245 GTGGGGACACAGAAAAATTATGG - Intergenic
1087006143 11:93473916-93473938 GTGGAGACAGAGAAATTTCAAGG + Intergenic
1089781640 11:120877208-120877230 GTAGGCAGCCAGAAATTTCGGGG + Intronic
1091415221 12:276906-276928 CTGAGAACCCAGTAATTTCAGGG + Intergenic
1093919925 12:24848497-24848519 CTGGGGACACAGAAATTGCAGGG - Intronic
1095045626 12:37500916-37500938 GTGGGGAAACATGAATTTCATGG - Intergenic
1096235577 12:49923905-49923927 GTGGGTGCCCAGTAATTACAGGG - Intergenic
1096260332 12:50086128-50086150 GAGAGGACCCAGAGATGTCATGG - Intronic
1096289608 12:50330632-50330654 GTGGGTACCCAGATATTCCCAGG - Exonic
1096807974 12:54151808-54151830 CTGGGGACCCTGAACTTACAGGG + Intergenic
1098641850 12:72848530-72848552 GTGAGGAAACAAAAATTTCAAGG - Intergenic
1099059395 12:77887349-77887371 GTGGGAACTTAGAATTTTCAAGG + Intronic
1101700603 12:107170195-107170217 GTGGGGATTCAGTAATTGCAAGG - Intergenic
1102329777 12:112019272-112019294 GTTTGAACCCAGCAATTTCAGGG - Intronic
1103958259 12:124591803-124591825 GTGAGGGCCCAGAAATGTCAGGG - Intergenic
1104237240 12:126950836-126950858 CTGGGAATCCAGGAATTTCAGGG + Intergenic
1110587791 13:77215069-77215091 GTGGGGAGGCAGGAATGTCAAGG + Intronic
1112382894 13:98909793-98909815 GTCAGGACCCAGCAGTTTCACGG - Intronic
1114344526 14:21781113-21781135 GTGTGGACCCAGAAAAAGCACGG - Intergenic
1118075592 14:62295394-62295416 GTAGGGATCCAGAAGTTTCCTGG + Intergenic
1119612137 14:76072414-76072436 GGTGTGACCCAGACATTTCAGGG - Intronic
1121522307 14:94594522-94594544 GTGGGGACCCATACACTCCATGG - Intronic
1123833254 15:24163530-24163552 GTGGGGACCCAAAAGTTTCTGGG + Intergenic
1123839983 15:24238609-24238631 GTGGGGACCCAAATGTTTCTGGG + Intergenic
1123852922 15:24379124-24379146 GTGGGGACCCAAAAATTTCTGGG + Intergenic
1123868887 15:24551693-24551715 GTGGGGAACCAAAAGTTTCTGGG + Intergenic
1127449962 15:59106465-59106487 GTCGGGACCCTGAACTCTCAGGG + Intronic
1131321212 15:91393047-91393069 TTTGGGACCCAGGAAATTCATGG + Intergenic
1132209487 15:100009384-100009406 GTGGGCACCTGGAACTTTCAGGG - Intronic
1133674909 16:8061962-8061984 GTGGGCTCCCCAAAATTTCATGG + Intergenic
1135467683 16:22701353-22701375 TGGGGGACTGAGAAATTTCAGGG + Intergenic
1135936976 16:26789385-26789407 ATGGGGACACAGACATTTCTAGG - Intergenic
1137222459 16:46469821-46469843 GTTGGGACCCAGAAATCTTTTGG + Intergenic
1138497804 16:57418931-57418953 GTGGGGAAAGAGAAATTTCCTGG + Intergenic
1139666498 16:68460584-68460606 GTGGGTAAACAGACATTTCATGG - Intergenic
1139976730 16:70818265-70818287 GTGTGGATCCAGAGATCTCATGG + Intronic
1140517296 16:75552900-75552922 GTGTGGACCCAGAGAATACAGGG - Intronic
1140811531 16:78583571-78583593 TGGGGGACCCTGACATTTCAAGG - Intronic
1141622759 16:85245831-85245853 GTGAGGACCAGGAAAGTTCAGGG - Intergenic
1146647084 17:34582636-34582658 GCGGGGAACCAGAAATCTCTAGG + Intronic
1148326865 17:46788405-46788427 GTGGGGACCCAGCAAAGTCCTGG - Intronic
1149609690 17:57951030-57951052 GTGGGGAGACTGAAATGTCATGG - Intronic
1152507735 17:80762341-80762363 GTGGGGACTCAGCCATCTCAAGG - Intronic
1152921898 17:83070028-83070050 GTGGGGACCCGGAAGGATCAGGG - Intergenic
1157741246 18:50095432-50095454 GTGGAGAAGCAGAAATGTCACGG - Intronic
1157934511 18:51858403-51858425 TTGGGTACCCAGAAATATGAAGG + Intergenic
1158055968 18:53280759-53280781 GTGAGGAAACAGAAACTTCAAGG - Intronic
1161146765 19:2683590-2683612 GTGGGAGCCCGGAAACTTCAAGG + Intronic
1164986472 19:32652217-32652239 GTGGGGACCCAGAAATTTCAAGG + Intronic
1165404206 19:35619926-35619948 CTGGGGGCCCAGGAACTTCAAGG - Intronic
1166956447 19:46468645-46468667 TCAGGGACCCAGAAATTTCTTGG - Intronic
1167371596 19:49085778-49085800 GTGGGTGCCCAGAGATTTCGGGG - Intronic
1167968960 19:53174025-53174047 CTGGGGCCCCGGAAACTTCACGG - Intronic
927265183 2:21138947-21138969 GTGCGTACCCAGAAATTTGATGG - Exonic
928229111 2:29480756-29480778 GTGGGAACTCAGAAAGCTCAGGG + Intronic
932375483 2:71231895-71231917 GGTGGGATCCAGAAATTTCTTGG - Intergenic
933589666 2:84218302-84218324 ATGGGTATCCAGAAATTTGAGGG - Intergenic
935194435 2:100803994-100804016 GTGGGGTTCCAGGACTTTCAGGG + Intergenic
935391489 2:102557981-102558003 GCGAGTACCCAGACATTTCAGGG - Intergenic
937077447 2:119117498-119117520 GTGGGGCCCCATGAATTACATGG - Intergenic
937596072 2:123675126-123675148 GTGGTGTCCCATAAATTTTAGGG - Intergenic
939318628 2:140586222-140586244 CTTGGGACCAAGAAATTCCATGG + Intronic
939846495 2:147252658-147252680 GTGGGGGCCCAGCTAGTTCATGG + Intergenic
941166483 2:162088529-162088551 TTGGAGAACCAGAAATTACAAGG + Intergenic
945208108 2:207353669-207353691 CTGGGGACCCACATTTTTCAGGG + Intergenic
946144461 2:217718514-217718536 GTTGGGACCCAGAACTGTGAAGG - Intronic
1168816759 20:743042-743064 GAGGTGATCCAGAAACTTCAAGG + Intergenic
1169957809 20:11125047-11125069 ATGTGGACCCAGCAATCTCACGG + Intergenic
1171067016 20:22027108-22027130 CTGGGGACCCAGAAATCCCACGG + Intergenic
1171800879 20:29615803-29615825 GTGGGGAAACATGAATTTCATGG + Intergenic
1171823839 20:29877414-29877436 GTGGGGTCCCAGAAACTTCCAGG - Intergenic
1171843219 20:30240889-30240911 GTGGGGAAACATGAATTTCATGG - Intergenic
1171896245 20:30812922-30812944 GTGGGGCCCCGGAAACTTCCAGG + Intergenic
1172807684 20:37624342-37624364 CTGGGGAGCCAGAAGATTCATGG + Intergenic
1172949215 20:38711781-38711803 GTGGCAACCCAGCAATTGCATGG + Intergenic
1173803730 20:45911078-45911100 GCGGGGCCCGAGAAATCTCAGGG - Intronic
1174097132 20:48098317-48098339 GTTGGAACCCAGACATGTCAGGG + Intergenic
1174737367 20:52977567-52977589 GTGTGGACCAAGCGATTTCAAGG - Intronic
1176913738 21:14599700-14599722 AAGGGGACCCAGAGATTCCAAGG - Intronic
1177937697 21:27369492-27369514 CTGGGGACACACAATTTTCAAGG + Intergenic
1178450995 21:32699645-32699667 GTTGGGACCCAGAAATCTTTTGG + Intronic
1180324907 22:11361604-11361626 GTGGGGCCCCAGAAACTTCCAGG - Intergenic
1181310604 22:21942682-21942704 GTGGGGACCCAGACAATGCCTGG + Intronic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1184766606 22:46575820-46575842 CTGGGGACCCAGTGATTTCAGGG - Intergenic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
951995407 3:28722317-28722339 CTGATTACCCAGAAATTTCATGG - Intergenic
953890739 3:46750252-46750274 ATGGGGACCAAGAATTTTCCTGG + Intronic
954869591 3:53757699-53757721 GTGGGGACGAAGAAATAGCAGGG - Intronic
957085261 3:75671374-75671396 GTGGGGACCCAGAAACTTCCAGG + Intergenic
959887421 3:111518791-111518813 GTGGAGGCCCAGCATTTTCATGG + Intronic
961002751 3:123384934-123384956 GTGGGGTCCCAGGGACTTCAAGG - Intronic
961050087 3:123738474-123738496 CTAGGGACCCTGAAAATTCAGGG - Intronic
963429983 3:145188343-145188365 ATGGGGACTCAGAGATTTTAGGG + Intergenic
968983196 4:3861634-3861656 GTGGGGACCCAGAGAGTCCTGGG + Intergenic
969529950 4:7725129-7725151 GTGGGGACCCAAAAAGGCCAGGG - Intronic
969820491 4:9716466-9716488 GTGGGGAACCTAAATTTTCATGG - Intergenic
975179204 4:71324062-71324084 TTGGGGACCCAGCAAATTCTTGG + Intronic
975728576 4:77316301-77316323 GTGTGGACCCAGAAATTCCTTGG + Intronic
977887799 4:102272818-102272840 GTGAGGACCCAGGAAGTGCAAGG + Intronic
979606630 4:122645378-122645400 TTGGGCACCCAGAAATCTCTGGG - Intergenic
983527004 4:168769710-168769732 GTGGTGACTCAGAAATCTCAAGG + Intronic
984561798 4:181279890-181279912 GTGGGGTCCCAGAAAGATTAAGG + Intergenic
985445691 4:190020220-190020242 GTGGGGACCCAGAAACTTCCAGG - Intergenic
990476253 5:56164154-56164176 GTGGAGACCCAGAAAATAGAAGG - Intronic
990666929 5:58083004-58083026 ATGGGGACCCGGAAATCTCTGGG - Intergenic
991998945 5:72417133-72417155 GTGGGGACCCAGCAATGTTCTGG - Intergenic
992393366 5:76349611-76349633 GTGGAGAGCCAAAACTTTCAAGG - Intronic
995687304 5:114784770-114784792 CTGGGGTCCCAGAAATGTTAGGG - Intergenic
997300332 5:132799040-132799062 GTGGGGTGCCAGAAAGTGCATGG + Intronic
1001343146 5:170865487-170865509 GTGGGGTCTTAGAAATGTCATGG - Intronic
1002694126 5:181072780-181072802 GTGGGGCCCCAGCAATGACATGG - Intergenic
1002917181 6:1538768-1538790 CTAGGGACCCTGAAATTACAAGG - Intergenic
1005850081 6:29814511-29814533 GTGGGAACCCAGAAAAAGCACGG + Intergenic
1007139033 6:39553243-39553265 GTAGGGGGCCAGAAAGTTCATGG + Intronic
1007163173 6:39809270-39809292 GTGGGCACTCTGAAATTTCAGGG + Intronic
1007771361 6:44194755-44194777 CTGGGGAGCCAGAAACTTGAGGG + Intergenic
1008001442 6:46364702-46364724 CTGGGGTACCAGAACTTTCAGGG - Intronic
1019339210 7:500622-500644 GAGGGGACTCAGAAGTTTCTCGG - Intronic
1024437190 7:49371987-49372009 CTTGGGAACCAGAAATTTAAGGG - Intergenic
1025291622 7:57730759-57730781 GTGGGGAAACATGAATTTCACGG - Intergenic
1029646056 7:101856848-101856870 GTGGGGACACAGAGAGGTCAAGG - Intronic
1031052555 7:116958693-116958715 CTGGGAAACCAAAAATTTCATGG - Intronic
1033172214 7:139094171-139094193 GTGGGGGCCCAGGAATCTAATGG - Intronic
1034318570 7:150157914-150157936 GTGGGGACACAGAAACTTTAAGG + Intergenic
1034774181 7:153809316-153809338 GTGGGGACACAGAAACTTTAAGG - Intergenic
1037220647 8:16516006-16516028 GTGAGGACCCAGAAATGTCAGGG - Intronic
1039048909 8:33475207-33475229 GTTGTGACCCAGAAATTCCTAGG + Intronic
1042577070 8:70232361-70232383 GAGGGGCCCCAAAGATTTCAGGG + Intronic
1042969830 8:74396246-74396268 GTGGAAACCAATAAATTTCACGG - Intronic
1047153205 8:122287688-122287710 CTGGAGACCCAGCAATTACAAGG - Intergenic
1051099036 9:13500004-13500026 GTGGGGACCCCAAAAGGTCATGG - Intergenic
1051798470 9:20903574-20903596 ACGGGGACCCAGAGAATTCAGGG - Intronic
1052162472 9:25282741-25282763 GTGAGCCCCCAGAAATATCATGG - Intergenic
1052265859 9:26572356-26572378 GTTGGGACCCATGAATTTGAGGG - Intergenic
1053470115 9:38340279-38340301 GTGGGGACCCAGTAACTTATTGG - Intergenic
1054254315 9:62799088-62799110 GTGGGGCCCCAGAAACTTCCAGG + Intergenic
1054336981 9:63816507-63816529 GTGGGGCCCCAGAAACTTCCAGG - Intergenic
1059421414 9:114194789-114194811 GTGGGCATCCAGAAGTTTCTTGG + Intronic
1061563472 9:131421693-131421715 GTGGGCACCTAGAGATTTCATGG - Intronic
1062537278 9:137026575-137026597 GTGGGGACCCAAAAAGGTCCTGG + Intronic
1203372557 Un_KI270442v1:322172-322194 GTGGGGCCCCAGAAACTTCCAGG - Intergenic
1203376911 Un_KI270442v1:383930-383952 GTGGGGTCCCAGAAACTTCCAGG - Intergenic
1185997427 X:4967520-4967542 GAGGGGACACAAATATTTCATGG - Intergenic
1190198176 X:48337474-48337496 GTTGGGACCCAGAGGTTGCAGGG - Intergenic
1190707684 X:53044203-53044225 GTGGGAGCCCAAAAATGTCAGGG - Intergenic
1191233988 X:58119543-58119565 GTGGGACCACAGAAATTTTAAGG + Intergenic
1192361563 X:70444299-70444321 GTGAGGTCACAGTAATTTCAGGG + Intergenic
1194164755 X:90501644-90501666 GTGGGGTCACAGAAATTTCAGGG + Intergenic
1196546654 X:116971318-116971340 GTGGTGAACCAGAGATTTCCTGG + Intergenic
1197119244 X:122870661-122870683 ATAGGGCCCCAGAAATGTCAGGG + Intergenic
1199617696 X:149671119-149671141 CTGGGCAGCCAGTAATTTCAGGG - Intergenic
1199624947 X:149732130-149732152 CTGGGCAGCCAGTAATTTCAGGG + Intergenic
1200511015 Y:4079438-4079460 GTGGGGTCACAGAAATTTCAGGG + Intergenic
1200783327 Y:7236651-7236673 CTGGGGACCCAGAAAGTTAGAGG + Intergenic
1201917968 Y:19203198-19203220 CTGGGGACCCAGAAACTTAGAGG + Intergenic