ID: 1164989966

View in Genome Browser
Species Human (GRCh38)
Location 19:32676068-32676090
Sequence GACGTGCGCCTCTGCGGACG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164989966_1164989975 -7 Left 1164989966 19:32676068-32676090 CCCCGTCCGCAGAGGCGCACGTC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1164989975 19:32676084-32676106 GCACGTCGAGGGTCCCGGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1164989966_1164989979 8 Left 1164989966 19:32676068-32676090 CCCCGTCCGCAGAGGCGCACGTC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1164989979 19:32676099-32676121 CGGGCGGGCTCCGTGGACGTTGG 0: 1
1: 0
2: 0
3: 6
4: 72
1164989966_1164989980 11 Left 1164989966 19:32676068-32676090 CCCCGTCCGCAGAGGCGCACGTC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1164989980 19:32676102-32676124 GCGGGCTCCGTGGACGTTGGCGG 0: 1
1: 0
2: 1
3: 4
4: 73
1164989966_1164989976 1 Left 1164989966 19:32676068-32676090 CCCCGTCCGCAGAGGCGCACGTC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1164989976 19:32676092-32676114 AGGGTCCCGGGCGGGCTCCGTGG 0: 1
1: 0
2: 2
3: 27
4: 232
1164989966_1164989974 -8 Left 1164989966 19:32676068-32676090 CCCCGTCCGCAGAGGCGCACGTC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1164989974 19:32676083-32676105 CGCACGTCGAGGGTCCCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164989966 Original CRISPR GACGTGCGCCTCTGCGGACG GGG (reversed) Exonic
917661572 1:177181884-177181906 CGCCTGCGCCTCTGCGGCCGGGG - Intronic
1073380160 10:103072313-103072335 GTCGTGCGCCTGTGTGGATGGGG - Intronic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1104021185 12:124993615-124993637 GCCGTGCGCCTTTGCGCGCGGGG + Intergenic
1104759827 12:131290121-131290143 GACCTGGGCCTCTGCCGCCGAGG + Intergenic
1105256393 13:18746194-18746216 GACAAGCGCCTCTGCTGACTAGG + Intergenic
1106735671 13:32586291-32586313 GACGTGCGCGCGCGCGGACGGGG + Intergenic
1114398440 14:22387898-22387920 GACGTGGGCCTCTGGGCTCGTGG + Intergenic
1122842741 14:104474340-104474362 GACTGGCGCCTCTGAGGACAGGG + Intergenic
1123493896 15:20803942-20803964 GACGTGCGGCTCTTTGGAGGCGG + Intergenic
1202958737 15_KI270727v1_random:100278-100300 GACGTGCGGCTCTTTGGAGGCGG + Intergenic
1133058515 16:3159291-3159313 CGCGTCTGCCTCTGCGGACGTGG + Intergenic
1152396543 17:80036540-80036562 GGCGCGCGCCTCTGCGTGCGTGG + Intergenic
1161593201 19:5137915-5137937 CAGGTGCGCCTCTGAGGACCTGG - Intronic
1162007516 19:7789568-7789590 GCCCTGCGCCTCTGCCCACGTGG - Intergenic
1163286209 19:16349720-16349742 GACGTGCGCTTCAGGGCACGTGG + Intergenic
1164989966 19:32676068-32676090 GACGTGCGCCTCTGCGGACGGGG - Exonic
925021094 2:568541-568563 GACGTGTGCCTCTGCCAAAGCGG + Intergenic
936279008 2:111122080-111122102 GACGTGCGCGTCCGCGGCCAGGG + Intronic
1171883143 20:30632461-30632483 GACAAGCGCCTCTGCTGACTAGG + Intergenic
1176842386 21:13851219-13851241 GACAAGCGCCTCTGCTGACTAGG + Intergenic
973366805 4:49214777-49214799 GACAAGCGCCTCTGCTGACTAGG + Intergenic
980075423 4:128288308-128288330 CACGTGCGCCTTGGCGGCCGCGG + Exonic
987621905 5:20345850-20345872 GAAGTCCTCCACTGCGGACGGGG + Intronic
992001566 5:72441438-72441460 GACTTGCCCCTCTGAGGACTTGG + Intergenic
996965875 5:129306660-129306682 GACCTGAGCCTCTGGGGAAGGGG - Intergenic
1003575834 6:7293545-7293567 GACGTGCGCCTAGGCTGAGGTGG - Intronic
1014137510 6:117907068-117907090 ACCGTGGGCCTCTGCGGACGGGG + Intergenic
1022531989 7:31072706-31072728 GACGTGGGCCTCTCAGGCCGGGG - Intronic
1030300069 7:107965820-107965842 GACGTGAGCCACTGCGCACCCGG - Intronic
1030820313 7:114085486-114085508 GGTGTGCGCCTCTGCGGCCTGGG - Intergenic
1034158929 7:148978267-148978289 GACGTGCGCTTCCGCGGGAGGGG + Intergenic
1035026720 7:155831180-155831202 GAGGTGAGGCTCTGCGGACCGGG + Intergenic
1062235761 9:135506824-135506846 GATGTGGGCCTCTGCTGATGTGG + Intergenic