ID: 1164990269

View in Genome Browser
Species Human (GRCh38)
Location 19:32677570-32677592
Sequence TAGCTGCTCTTGGGGACGAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164990269_1164990273 -9 Left 1164990269 19:32677570-32677592 CCATTCGTCCCCAAGAGCAGCTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1164990273 19:32677584-32677606 GAGCAGCTAGAAGAGATTTGAGG 0: 1
1: 0
2: 2
3: 30
4: 408
1164990269_1164990276 18 Left 1164990269 19:32677570-32677592 CCATTCGTCCCCAAGAGCAGCTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1164990276 19:32677611-32677633 GACCTCCCACTGCCGCTCAGGGG 0: 1
1: 0
2: 0
3: 10
4: 144
1164990269_1164990275 17 Left 1164990269 19:32677570-32677592 CCATTCGTCCCCAAGAGCAGCTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1164990275 19:32677610-32677632 TGACCTCCCACTGCCGCTCAGGG 0: 1
1: 0
2: 0
3: 20
4: 131
1164990269_1164990274 16 Left 1164990269 19:32677570-32677592 CCATTCGTCCCCAAGAGCAGCTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1164990274 19:32677609-32677631 ATGACCTCCCACTGCCGCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164990269 Original CRISPR TAGCTGCTCTTGGGGACGAA TGG (reversed) Exonic
902624042 1:17666639-17666661 CAGCTGTTCTTGGGGGAGAAAGG - Intronic
907341123 1:53737181-53737203 CAGCTTCACTGGGGGACGAAGGG + Intergenic
907998828 1:59660009-59660031 TATTTTCTCTTGGGGAGGAAGGG + Intronic
909784341 1:79592285-79592307 TATCTGGCCTTGGGGATGAAGGG + Intergenic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
1076726129 10:132414175-132414197 CTGCTGCTGTTCGGGACGAAGGG + Intronic
1078285288 11:9947478-9947500 TAGATGCTGATGGGGAAGAAGGG + Intronic
1079948503 11:26772314-26772336 TTGCTGCTCTTGGTTACTAATGG + Intergenic
1083487644 11:62993520-62993542 TAGATGATATTGGGGATGAAGGG + Exonic
1085462113 11:76700462-76700484 CAGATCCTGTTGGGGACGAAGGG + Intergenic
1091433937 12:459616-459638 TCGTTGCTGTTGGCGACGAAAGG + Intergenic
1097156675 12:57016876-57016898 TAGCTGGTCTTGGGGGAGAATGG - Intronic
1097157286 12:57022251-57022273 TAGCTGGCCTTGGGGGAGAATGG - Intronic
1098051109 12:66454186-66454208 TAGCTGGTCTTGGGCACTTAGGG + Intronic
1101812373 12:108119067-108119089 TAGCTGGTCTTGGGGTGGGAAGG + Intergenic
1102792567 12:115659584-115659606 TAGCTGTTCTCTGGGAGGAAAGG - Intergenic
1105853253 13:24354415-24354437 TTGCTGTTCTTGGGGAGCAATGG - Intergenic
1110467167 13:75815099-75815121 TGGCTGCTGTTGGGTAGGAAGGG + Intronic
1118839833 14:69501854-69501876 TAGCAGCACTTGGGGACCAGGGG + Intronic
1123902974 15:24894567-24894589 TAGCTGCTCCTGGGAGGGAAAGG + Intronic
1126127542 15:45309495-45309517 TAGCAGCTCTTCGGGAAGAGGGG - Intergenic
1129103910 15:73292057-73292079 GTGCTGCTCTTGGGGACCAGAGG - Intronic
1132290196 15:100694768-100694790 TAGCTGCCCTTTGGGACCACTGG + Intergenic
1133180207 16:4048679-4048701 TGGCAGCTCTTGGGAAAGAAGGG - Intronic
1134264249 16:12679796-12679818 TCACTGCTCTTGGGGAGGGAAGG - Intronic
1135919702 16:26638581-26638603 TAGCTGCTTCTGGGGATGAGGGG - Intergenic
1136921634 16:34284869-34284891 TAGCTGCTCTTTGAAAAGAAAGG - Intergenic
1137098671 16:36345532-36345554 TAGCTGCTCTTTGAAAAGAAAGG - Intergenic
1137157715 16:37323246-37323268 TAACTGCTCTTTGAGAAGAAAGG - Intergenic
1137196342 16:37962522-37962544 TAACTGCTCTTGGAAAAGAAAGG - Intergenic
1137681553 16:50350887-50350909 CAGAAGCTCTTGGGGAAGAAGGG + Intronic
1141024360 16:80530644-80530666 TAGCTGGTATTGGTGACCAACGG - Intergenic
1143147922 17:4788851-4788873 TAGCTGCCCTTTGGGGCGAAGGG + Intergenic
1151421552 17:74001383-74001405 TAGCTTCTCTTGGGCATGAAAGG - Intergenic
1152654473 17:81513395-81513417 TGGCTGCGCTTGGGGACGGGCGG - Intronic
1161184504 19:2907428-2907450 TAGCTGGCCTTGGGGATGAGAGG - Intronic
1161648989 19:5472628-5472650 GAGCGGATCTTGGGGAGGAAGGG + Intergenic
1162062564 19:8105734-8105756 TAGTTGCTTTTGTGGAGGAATGG - Intronic
1163168607 19:15515089-15515111 CAGCTGCCTTTGGGGAAGAAGGG - Intronic
1164990269 19:32677570-32677592 TAGCTGCTCTTGGGGACGAATGG - Exonic
1165072894 19:33265677-33265699 TAGCTGCTTTAGGTGACAAACGG - Intergenic
1166781438 19:45345520-45345542 TTGCTGCTCCTGGGGAGCAATGG - Exonic
1168351597 19:55679294-55679316 TTGCTGCTCTTGGGGTCCAGGGG + Intronic
933221903 2:79700474-79700496 TGGCTGATATTGGGGAAGAAGGG - Intronic
933299248 2:80524060-80524082 TAGCTGCTGATGGGGATGACAGG + Intronic
942046502 2:172102216-172102238 TAGCTGCTCTTGGCGGAGTAAGG + Exonic
944341330 2:198604430-198604452 TAGTTGCCCTTGGGGAGGAGTGG + Intergenic
944844343 2:203653919-203653941 TGGCTGCTCTGGGAGACGTATGG + Intergenic
946537677 2:220648843-220648865 GAGCTGCCCTTTGGGATGAAAGG - Intergenic
948374834 2:237514538-237514560 TGGCTGGCCTTGGGGAAGAATGG + Intronic
1169252883 20:4073599-4073621 GAGCTGTTCTTGGGGATGGAGGG + Intronic
1174988489 20:55482525-55482547 TAGCTGCTGGTGAGGAGGAAGGG + Intergenic
1175963838 20:62650300-62650322 CAGCTGGGCTTGGGGAAGAAGGG - Intronic
1185409034 22:50673203-50673225 GAGCTGCTCTTGGGGAGGCTGGG + Intergenic
951829716 3:26912583-26912605 TAGCTGCCCTTGGAGTCAAAGGG + Intergenic
953849507 3:46455184-46455206 AGCCTGCTCTTGGGGACGAGAGG - Intronic
958274094 3:91551117-91551139 TAGCTGCTCTATAGGAAGAAAGG + Intergenic
958277205 3:91601953-91601975 TAACTGCTCTATAGGACGAAAGG - Intergenic
958327541 3:92426827-92426849 TAACTGCTCTATAGGACGAAAGG - Intergenic
959049607 3:101512625-101512647 TAGCTGCTGCTGGGGAGGAAAGG - Intronic
961487084 3:127224179-127224201 TAGCTGTTCTTGTGGGCTAATGG - Intergenic
966752623 3:183336936-183336958 TAGCTGCTGTTAGGGATGAGGGG - Intronic
967422459 3:189288944-189288966 TAAATGCTTTTGGGGAGGAAAGG - Intronic
969888666 4:10239579-10239601 TATCTGCTTTTAGGGACAAAAGG + Intergenic
971356723 4:25901759-25901781 TAACTTCTCTTGGGAAGGAAGGG - Intronic
974726539 4:65806273-65806295 TGGCTACTCTTGGGGTAGAATGG + Intergenic
975992111 4:80267960-80267982 TAACTGTTCTTGGGGACCAAAGG - Intronic
977302457 4:95282943-95282965 TGGCTGGTCTTGGGGAAGAATGG + Intronic
978966661 4:114749519-114749541 GAGCTCTTCTTGGGGAAGAATGG - Intergenic
979984149 4:127294537-127294559 TGGCTGCTGTTGGGGAGGCATGG + Intergenic
980420764 4:132557744-132557766 TAGCTGATTTGGGGGAAGAAGGG + Intergenic
982096081 4:151924724-151924746 TAGCTTTTCTTGGGGACCACTGG - Intergenic
983075642 4:163322990-163323012 TTTCTGCTTTTGGGGACAAATGG - Intergenic
983423694 4:167554427-167554449 GAGCTGCTCTTAGGTATGAAAGG - Intergenic
985849278 5:2376706-2376728 TGGCTGTTCTTGGGCACCAAGGG - Intergenic
986870204 5:12036609-12036631 TCGCTGCTGTTGGGGAGGCACGG + Intergenic
999180132 5:149664317-149664339 TGGCTGCTCTGGGAGAGGAAGGG + Intergenic
1005816767 6:29559426-29559448 TAGCTACTCTTAGGGATAAATGG - Intronic
1006838548 6:37013947-37013969 TCGCTGCTCTTGGGGAGGGATGG - Exonic
1006898330 6:37484569-37484591 TGTCTGCTCTTTGGGATGAAGGG - Intronic
1008011443 6:46471943-46471965 TAGGTGCTCTAGGGGAGGTAGGG - Intronic
1008682910 6:53893140-53893162 TAGCTGCACTTAGGGACAAAGGG + Intronic
1010364216 6:75031060-75031082 TAGCTTCCCTTGGGTAGGAAAGG - Intergenic
1010715750 6:79227876-79227898 TAGGTGCTATGGGGGATGAAAGG + Intronic
1027343299 7:77232754-77232776 CAGCTGCCCATGGGGAAGAAGGG + Intronic
1034696125 7:153055542-153055564 TCCCTGCTCTTGGGGACAAACGG - Intergenic
1037308937 8:17534954-17534976 TAGCTGCTCTAGGGGAAGGGCGG - Intronic
1041184562 8:55285726-55285748 TATCTGGTCTTGGGGATGCATGG + Intronic
1045111963 8:98944851-98944873 TAGCTGCCCTTTGGAAGGAAGGG + Intronic
1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG + Intronic
1061746530 9:132744220-132744242 CAGCTGTGATTGGGGACGAAGGG - Intronic
1062345205 9:136111265-136111287 TGGCTGCTCCTGGGGACGGTGGG - Intergenic
1186336691 X:8597234-8597256 TAGCTCTTCTTGGGGAAGAGAGG + Exonic
1186963042 X:14758001-14758023 TAGGTGCTGTTGGGGAGGCACGG + Intergenic
1196533624 X:116816497-116816519 TAGCTCGTCCTGGGGAGGAAGGG + Intergenic
1199542275 X:148969964-148969986 CAGCTACTCCTAGGGACGAAGGG + Intronic
1201326228 Y:12762117-12762139 TAGCTGCTCTTGATAAAGAAAGG - Intronic