ID: 1164990924

View in Genome Browser
Species Human (GRCh38)
Location 19:32683184-32683206
Sequence GCTGTGCTCGTGTTTCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164990924_1164990929 19 Left 1164990924 19:32683184-32683206 CCACTGGGAAACACGAGCACAGC No data
Right 1164990929 19:32683226-32683248 GGTATCAGATCTAAGGTGGATGG No data
1164990924_1164990930 27 Left 1164990924 19:32683184-32683206 CCACTGGGAAACACGAGCACAGC No data
Right 1164990930 19:32683234-32683256 ATCTAAGGTGGATGGAATTCAGG No data
1164990924_1164990928 15 Left 1164990924 19:32683184-32683206 CCACTGGGAAACACGAGCACAGC No data
Right 1164990928 19:32683222-32683244 ATGTGGTATCAGATCTAAGGTGG No data
1164990924_1164990925 -2 Left 1164990924 19:32683184-32683206 CCACTGGGAAACACGAGCACAGC No data
Right 1164990925 19:32683205-32683227 GCCTAGCTTGATTTTGTATGTGG No data
1164990924_1164990927 12 Left 1164990924 19:32683184-32683206 CCACTGGGAAACACGAGCACAGC No data
Right 1164990927 19:32683219-32683241 TGTATGTGGTATCAGATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164990924 Original CRISPR GCTGTGCTCGTGTTTCCCAG TGG (reversed) Intergenic