ID: 1164990925

View in Genome Browser
Species Human (GRCh38)
Location 19:32683205-32683227
Sequence GCCTAGCTTGATTTTGTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164990921_1164990925 23 Left 1164990921 19:32683159-32683181 CCTTAGAACTGCATGAGCTGCTT No data
Right 1164990925 19:32683205-32683227 GCCTAGCTTGATTTTGTATGTGG No data
1164990924_1164990925 -2 Left 1164990924 19:32683184-32683206 CCACTGGGAAACACGAGCACAGC No data
Right 1164990925 19:32683205-32683227 GCCTAGCTTGATTTTGTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164990925 Original CRISPR GCCTAGCTTGATTTTGTATG TGG Intergenic