ID: 1164990926

View in Genome Browser
Species Human (GRCh38)
Location 19:32683206-32683228
Sequence ACCACATACAAAATCAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164990926_1164990930 5 Left 1164990926 19:32683206-32683228 CCTAGCTTGATTTTGTATGTGGT No data
Right 1164990930 19:32683234-32683256 ATCTAAGGTGGATGGAATTCAGG No data
1164990926_1164990929 -3 Left 1164990926 19:32683206-32683228 CCTAGCTTGATTTTGTATGTGGT No data
Right 1164990929 19:32683226-32683248 GGTATCAGATCTAAGGTGGATGG No data
1164990926_1164990927 -10 Left 1164990926 19:32683206-32683228 CCTAGCTTGATTTTGTATGTGGT No data
Right 1164990927 19:32683219-32683241 TGTATGTGGTATCAGATCTAAGG No data
1164990926_1164990928 -7 Left 1164990926 19:32683206-32683228 CCTAGCTTGATTTTGTATGTGGT No data
Right 1164990928 19:32683222-32683244 ATGTGGTATCAGATCTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164990926 Original CRISPR ACCACATACAAAATCAAGCT AGG (reversed) Intergenic