ID: 1164990927

View in Genome Browser
Species Human (GRCh38)
Location 19:32683219-32683241
Sequence TGTATGTGGTATCAGATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164990926_1164990927 -10 Left 1164990926 19:32683206-32683228 CCTAGCTTGATTTTGTATGTGGT No data
Right 1164990927 19:32683219-32683241 TGTATGTGGTATCAGATCTAAGG No data
1164990924_1164990927 12 Left 1164990924 19:32683184-32683206 CCACTGGGAAACACGAGCACAGC No data
Right 1164990927 19:32683219-32683241 TGTATGTGGTATCAGATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164990927 Original CRISPR TGTATGTGGTATCAGATCTA AGG Intergenic