ID: 1164990929

View in Genome Browser
Species Human (GRCh38)
Location 19:32683226-32683248
Sequence GGTATCAGATCTAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164990926_1164990929 -3 Left 1164990926 19:32683206-32683228 CCTAGCTTGATTTTGTATGTGGT No data
Right 1164990929 19:32683226-32683248 GGTATCAGATCTAAGGTGGATGG No data
1164990924_1164990929 19 Left 1164990924 19:32683184-32683206 CCACTGGGAAACACGAGCACAGC No data
Right 1164990929 19:32683226-32683248 GGTATCAGATCTAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164990929 Original CRISPR GGTATCAGATCTAAGGTGGA TGG Intergenic