ID: 1164992007

View in Genome Browser
Species Human (GRCh38)
Location 19:32691691-32691713
Sequence TGTGAATGACAAACGGTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164992005_1164992007 -10 Left 1164992005 19:32691678-32691700 CCTTTCAGGCAGCTGTGAATGAC 0: 1
1: 0
2: 2
3: 66
4: 631
Right 1164992007 19:32691691-32691713 TGTGAATGACAAACGGTCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 57
1164992004_1164992007 -7 Left 1164992004 19:32691675-32691697 CCTCCTTTCAGGCAGCTGTGAAT 0: 1
1: 0
2: 1
3: 11
4: 248
Right 1164992007 19:32691691-32691713 TGTGAATGACAAACGGTCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 57
1164992000_1164992007 22 Left 1164992000 19:32691646-32691668 CCAAGCTTCCTGCGTGGGAATAC 0: 1
1: 0
2: 0
3: 7
4: 64
Right 1164992007 19:32691691-32691713 TGTGAATGACAAACGGTCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 57
1164992002_1164992007 14 Left 1164992002 19:32691654-32691676 CCTGCGTGGGAATACTGCGGTCC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1164992007 19:32691691-32691713 TGTGAATGACAAACGGTCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164992007 Original CRISPR TGTGAATGACAAACGGTCGC TGG Intergenic
901240910 1:7692698-7692720 TGTGAATGACAACCTGAGGCTGG - Intronic
906069949 1:43008874-43008896 TTTGAATGACAAAGGTTCCCTGG + Intergenic
912197895 1:107421731-107421753 TGTGAATGACAGATGCTAGCTGG - Intronic
924666574 1:246079603-246079625 TGTGAGTGACAGACAGTCGGGGG - Intronic
1063333105 10:5181801-5181823 TGTGAATGACAAAATGTCCAGGG - Intergenic
1068810049 10:61245043-61245065 TGTGAATGACTAAAGGGCTCAGG + Intergenic
1069936054 10:71917337-71917359 TGTGAATGACAAAAGGTCTTTGG + Intergenic
1071803509 10:89091458-89091480 TGTGAATGACAAAAGGTATCTGG - Intergenic
1073903384 10:108248908-108248930 TGTGAATGACAAAAGGTCCAGGG - Intergenic
1075265157 10:120994451-120994473 TGTGAATGACAAAATGTCCAGGG - Intergenic
1078153577 11:8779218-8779240 TGTAAAGGACAAACAGTAGCTGG + Intronic
1079717634 11:23768411-23768433 TGTGGATGACAAAAGGTCTTAGG + Intergenic
1083382994 11:62282514-62282536 TGTGAATGACAAAAAGTTTCAGG - Intergenic
1086469256 11:87088802-87088824 TGTGAATGACAAAATGTCCAGGG + Intronic
1100112174 12:91259181-91259203 TGTGAATGATAAAGGGTAGATGG + Intergenic
1108195687 13:47992690-47992712 TGTGAGTGACTAAAGGTAGCTGG - Intronic
1109422897 13:62136907-62136929 TGTGAATGACAAAAAGTCTTGGG - Intergenic
1120200715 14:81535059-81535081 TGTGAATGAGAAACAGTGGTTGG - Intergenic
1126215027 15:46145247-46145269 TGTGAATGACAAAATGTCTTAGG - Intergenic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1138184171 16:54963630-54963652 TGTGAGTGACAAGCAGCCGCAGG - Intergenic
1139267489 16:65653904-65653926 TTTGAATGACAAACACTCACTGG - Intergenic
1146942050 17:36850216-36850238 GGTGAATGACAGACAGTAGCAGG - Intergenic
1147725655 17:42564801-42564823 TGTCAATGACAAACGCCCCCAGG - Exonic
1149173400 17:53840789-53840811 TGTGAATGACAAAATGTCCAGGG + Intergenic
1153843204 18:9025717-9025739 TGTGGATGACAAATGGTTCCAGG - Intergenic
1159431693 18:68360918-68360940 TGTGAATGACAAAATGTCCAGGG - Intergenic
1163786283 19:19276604-19276626 TCTGAATGACCAACCGTCCCTGG - Exonic
1164992007 19:32691691-32691713 TGTGAATGACAAACGGTCGCTGG + Intergenic
933899235 2:86837373-86837395 TGTGAATCTCAAACCGACGCAGG + Intronic
935781320 2:106511855-106511877 TGTGAATCTCAAACCGACGCAGG - Intergenic
935947077 2:108296364-108296386 TGAGAATAACAAACAGTCTCAGG + Intronic
941728715 2:168892038-168892060 TGTGAATGATAATGGGTCGGGGG - Intronic
1176914558 21:14609536-14609558 TGTGAATGACAAAATCTGGCAGG - Exonic
1180019786 21:45115242-45115264 TGTGACTCACAGACGGTCACTGG - Intronic
1181026009 22:20128120-20128142 TGTTCATGACAAACGGTGACAGG - Intergenic
956817982 3:72925822-72925844 TTTGAATGACAAATGGGTGCTGG + Intronic
957639170 3:82828287-82828309 TTTGAAGGACAAACGGTATCAGG - Intergenic
963251513 3:143108187-143108209 TGTGAATGACAAAATGTCTTTGG - Intergenic
966462447 3:180191899-180191921 TGAAAATGACAGACGGTAGCTGG - Intergenic
972087635 4:35240348-35240370 TGTGAAAGACAAACAGTCAGAGG - Intergenic
977500033 4:97826910-97826932 TGTGAATGACAAAATGTCTTAGG - Intronic
980668590 4:135973001-135973023 TGTGAATGACAAAGTGAGGCTGG + Intergenic
982602858 4:157473564-157473586 TGTGAATGACAAAATGTCCAGGG - Intergenic
986417920 5:7546930-7546952 GGTGAATGCCAAACGGGCTCAGG - Intronic
987709982 5:21493614-21493636 TGGAAATGACAAATGGTGGCAGG - Intergenic
988749630 5:34180549-34180571 TGGAAATGACAAATGGTGGCAGG + Intergenic
992752838 5:79876795-79876817 TGTGAATGACACACAGTCTGTGG + Intergenic
997103873 5:130996186-130996208 TCTGAATGACCAACCGTCCCTGG + Intergenic
999657320 5:153823548-153823570 TGAGAATGACAGACAGTTGCTGG + Intergenic
999888183 5:155947048-155947070 TGTGAATGACAGAAGTTTGCTGG - Intronic
1000741065 5:164970695-164970717 TGTGAATGACAAAATGTCCAGGG + Intergenic
1007442711 6:41877238-41877260 TGTGAAATACAAAGGGTAGCAGG + Intronic
1013546499 6:111163052-111163074 TGTGAATGACAAAATGTCTTTGG + Intronic
1019600912 7:1883361-1883383 TGTGACTCACAAACGGCCCCGGG + Intronic
1020656036 7:10929201-10929223 TGTGAATGACAAACAGCATCTGG - Intergenic
1022787989 7:33658398-33658420 TGTGAATGACAAACTGTTTAAGG - Intergenic
1023951520 7:44849574-44849596 TGTGGAAGAAAAACGATCGCTGG - Intergenic
1026079775 7:67207468-67207490 GGTGAATGAGAAAAGGTCACTGG - Intronic
1049448557 8:142644247-142644269 TGTGAATGACAAAAGGTTTTAGG + Intergenic
1057942354 9:99296385-99296407 TGTGCATGTCAAACAGTCGGTGG - Intergenic
1058658423 9:107246861-107246883 TGTGAATGACAAGGGGTCAGGGG - Intergenic