ID: 1164995835

View in Genome Browser
Species Human (GRCh38)
Location 19:32720075-32720097
Sequence GCTCCAGCTCCTGGTGCTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 1, 3: 71, 4: 391}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164995829_1164995835 4 Left 1164995829 19:32720048-32720070 CCATCTGCCCTCGGGCGCCAGGA 0: 1
1: 0
2: 1
3: 11
4: 170
Right 1164995835 19:32720075-32720097 GCTCCAGCTCCTGGTGCTGAAGG 0: 1
1: 0
2: 1
3: 71
4: 391
1164995832_1164995835 -4 Left 1164995832 19:32720056-32720078 CCTCGGGCGCCAGGAGGATGCTC 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1164995835 19:32720075-32720097 GCTCCAGCTCCTGGTGCTGAAGG 0: 1
1: 0
2: 1
3: 71
4: 391
1164995824_1164995835 19 Left 1164995824 19:32720033-32720055 CCAGGGCGAGGGGGCCCATCTGC 0: 1
1: 0
2: 1
3: 18
4: 167
Right 1164995835 19:32720075-32720097 GCTCCAGCTCCTGGTGCTGAAGG 0: 1
1: 0
2: 1
3: 71
4: 391
1164995827_1164995835 5 Left 1164995827 19:32720047-32720069 CCCATCTGCCCTCGGGCGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1164995835 19:32720075-32720097 GCTCCAGCTCCTGGTGCTGAAGG 0: 1
1: 0
2: 1
3: 71
4: 391
1164995831_1164995835 -3 Left 1164995831 19:32720055-32720077 CCCTCGGGCGCCAGGAGGATGCT 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1164995835 19:32720075-32720097 GCTCCAGCTCCTGGTGCTGAAGG 0: 1
1: 0
2: 1
3: 71
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164995835 Original CRISPR GCTCCAGCTCCTGGTGCTGA AGG Exonic
900302460 1:1984894-1984916 GCTGCAGCTCCCGGGGCTGGGGG + Intronic
900379503 1:2376933-2376955 GCTCCTGATCCTCCTGCTGACGG + Intronic
900390658 1:2432503-2432525 GATCCAGCTCCTGGGGCTAACGG + Intronic
900391106 1:2434345-2434367 GCCCCAGCTCCTTGTGCCGTGGG + Intronic
900585159 1:3429087-3429109 TCTCCAGCTCCCGCTGCTGCCGG - Intronic
900600789 1:3501869-3501891 GCTCGAGCTCCTGCTCCTGTGGG - Exonic
900662002 1:3789465-3789487 GCTGCTGCTCCTGGGTCTGAAGG - Intronic
900683269 1:3930863-3930885 TCTCCAGCTCCCGGGGCTGCTGG - Intergenic
900719918 1:4168977-4168999 TCTCCACCTCCTGGGGCTGCTGG + Intergenic
901057302 1:6454607-6454629 GCTCCAGCTCCAGTTGCTCGAGG - Intronic
901199127 1:7456868-7456890 GCTCTAGCGCCTGCTGCTTAGGG - Intronic
901276229 1:7993247-7993269 GTTCCAGCTACTGGGGGTGAAGG - Intergenic
902637348 1:17743327-17743349 GCTCCTGCTCCTGCTCCTGCTGG + Intergenic
902659382 1:17890674-17890696 GCTCCAGCGCCTGGTCGTGAGGG + Intergenic
902720737 1:18302445-18302467 TCTCCACCTCCTGTTACTGAAGG + Intronic
903663536 1:24993234-24993256 GCTCCACCTCCTCCTGCTGTGGG + Intergenic
904488905 1:30846091-30846113 GCTCCACCACCAGGTGCTGTGGG + Intergenic
904618873 1:31763891-31763913 GCCCCCGCTCCTGCTGCTGACGG - Exonic
904972127 1:34427446-34427468 GCTCCAGCTCCTGGGGTGGGGGG - Intergenic
905752647 1:40479213-40479235 CCCCCAGGTCCTGGTGCTGCAGG + Exonic
906581192 1:46936375-46936397 CCTCCAGTCCCTTGTGCTGAAGG + Intronic
906707761 1:47907149-47907171 GCTCCAGCAGCTGGGGCTGCGGG + Intronic
906803632 1:48759029-48759051 GCTCCAGCTCCTGCTGGAGGTGG + Exonic
907402733 1:54234504-54234526 GCTTCAGCATCTGGGGCTGAAGG - Intronic
907525203 1:55049895-55049917 GGTACAGCTCCTGGAGCAGATGG + Intronic
907884057 1:58577090-58577112 GCTGCTGCTGCTGGTGCTGGCGG - Exonic
908455694 1:64302767-64302789 GTTCCAGTTACTGGTGCTGTGGG + Intergenic
909062491 1:70895110-70895132 GCTCTTGCTCCTGGTGCTGGGGG - Intronic
911864399 1:102998317-102998339 GCTGGACTTCCTGGTGCTGATGG - Exonic
912208986 1:107537977-107537999 GCTGCTTCTCCTGGGGCTGAAGG + Intergenic
912469491 1:109896594-109896616 GCTCCAGCTCCAGAAGCTGTTGG + Intergenic
912950737 1:114118618-114118640 GCTCCTGCTGCTGCTGCAGAGGG + Intronic
913965829 1:143376978-143377000 ACTGCATCTTCTGGTGCTGATGG - Intergenic
914060203 1:144202586-144202608 ACTGCATCTTCTGGTGCTGATGG - Intergenic
914118947 1:144763783-144763805 ACTGCATCTTCTGGTGCTGATGG + Intergenic
914706039 1:150170662-150170684 CCTCCAGCTGTTAGTGCTGAGGG + Intergenic
915512565 1:156394371-156394393 GCTGTGGCTCCAGGTGCTGAAGG - Intergenic
915741823 1:158124567-158124589 GCTCCAGCTCCTGCACCTGTAGG - Intergenic
917119766 1:171635180-171635202 CCTCCATCTCCTGGTGCTCTCGG - Intergenic
917711471 1:177689334-177689356 CCTCCAGCCCCTGGTCCTGGTGG + Intergenic
920106288 1:203555885-203555907 TCTCCTGCTCCCGGGGCTGAGGG - Intergenic
920339902 1:205269246-205269268 GCTCCAGCTTCTTGTGCAGCTGG - Exonic
921328777 1:214014873-214014895 CGTCCAGCCCCTGCTGCTGATGG + Intronic
921812511 1:219530782-219530804 GATCCAGCCCCTGGTGTTGGGGG + Intergenic
922079795 1:222284552-222284574 GCTCCAGCTACTGGTGTCTAAGG - Intergenic
923032639 1:230262395-230262417 GGTCCAGCTCGAGGTGCTGGTGG + Intronic
924800801 1:247328800-247328822 GCTCCTGCTCCTGGTCCAGAGGG + Exonic
1063084015 10:2798497-2798519 GCTTTAGCTCCTGCTGCTGCAGG - Intergenic
1066746103 10:38604941-38604963 GCCACAGCCCCTGGTGCTGCAGG + Intergenic
1067279536 10:44860948-44860970 GCTCCAGATCTTGGTCCTGAAGG + Intergenic
1067429832 10:46235815-46235837 CCTCCAGCCACAGGTGCTGAAGG - Intergenic
1067443810 10:46328003-46328025 CCTCCAGCCACAGGTGCTGAAGG + Intronic
1067769135 10:49110938-49110960 CACCCACCTCCTGGTGCTGAAGG - Intronic
1067828574 10:49597029-49597051 CCTCCTGCTCCTGCTGCTGTGGG + Intergenic
1070570863 10:77638455-77638477 GCTGCAGCTGCTGCTGCTGGCGG - Intronic
1070662407 10:78316745-78316767 GCATCAGCTCATGGAGCTGAAGG + Intergenic
1070788954 10:79178476-79178498 GCTCCAGCTCCAACTGGTGAGGG - Intronic
1071715012 10:88086856-88086878 GTAGCAGCTCCTTGTGCTGAGGG - Intergenic
1072711252 10:97717103-97717125 GCACCAGCACTTGGGGCTGAGGG - Intronic
1073072441 10:100803241-100803263 CTTCCAGCTTCTGGTGCGGAAGG + Intronic
1075030863 10:119023848-119023870 TGTCAAGCACCTGGTGCTGATGG + Intergenic
1076160135 10:128237356-128237378 GATCCAGCTTCTGGAACTGAAGG + Intergenic
1076235438 10:128860725-128860747 GCACCAGCTCCTGCTGCTGAGGG + Intergenic
1076258643 10:129048696-129048718 GCTCCGGCCTCTGGTGCCGAGGG - Intergenic
1076552256 10:131288860-131288882 GCTCCCGCTCGAGGCGCTGAGGG - Intronic
1077184867 11:1231481-1231503 GCTGCAGCTGCTGGTGCAGCTGG + Exonic
1077414451 11:2418244-2418266 GCCCCACCTCCTGGTGCCCAAGG - Exonic
1079080165 11:17408394-17408416 TCTCCAGCTCTTGGTCCTGTCGG + Exonic
1079097906 11:17522788-17522810 GCTCCATCTCCTGCTGCTCCTGG + Exonic
1080255967 11:30290926-30290948 GCATCAGCTCCTGGTGATGCTGG + Intergenic
1081867125 11:46366205-46366227 GATCCAGCTCCTGATGCTCCCGG + Intronic
1081869973 11:46378984-46379006 GGTGCAGCTCCTGGAGCTGAGGG - Exonic
1081874740 11:46400910-46400932 GCTCCAGCTCCCAGGGCAGAAGG + Intronic
1083242305 11:61397969-61397991 TCTCCAGGTACTGCTGCTGAGGG + Exonic
1083294004 11:61705548-61705570 GCTCCAGCTCCTAGTTCTATAGG + Intronic
1083679192 11:64343494-64343516 AGTCCAGCTCCTGGGGGTGAGGG - Exonic
1084046096 11:66568453-66568475 GCTGCAGCTCCTGTCGCTGCTGG - Exonic
1084185137 11:67467530-67467552 GCTGCTGCTGATGGTGCTGAAGG + Exonic
1084195477 11:67521967-67521989 GCCGCAGCTCCCGGTCCTGAAGG + Exonic
1084673768 11:70622561-70622583 GCCGCAGCCCCTGGAGCTGAGGG - Intronic
1084725640 11:70940033-70940055 CCTCCAGCTCTGGGTGGTGATGG - Intronic
1085620913 11:78037422-78037444 GCACCAGTCCCTGGTGCTCAGGG - Intronic
1085851374 11:80124331-80124353 GCTCCAGCTGCTGCTTCAGAAGG + Intergenic
1086900066 11:92357244-92357266 GCCCCAGCTCATGGTGCTGTTGG - Intronic
1087297044 11:96389776-96389798 GCTCGCGCTCCCGGTGCTAATGG - Intronic
1090028427 11:123186916-123186938 GCCCCAAATGCTGGTGCTGATGG + Intronic
1090306722 11:125697736-125697758 GCTCATGCTCCTGCTGCTGGGGG + Intergenic
1090476990 11:127032027-127032049 GCTGCTGCTGCTGGTGCTGTTGG + Intergenic
1090788479 11:130070019-130070041 GCTCCTGCTTCTGCTGCTGGTGG + Exonic
1091445957 12:544217-544239 GCTCATCCTCCTGGAGCTGAGGG + Intronic
1091865684 12:3834199-3834221 GCCACTGCTCCTGGGGCTGAAGG - Intronic
1098981979 12:76966200-76966222 GCTCCTTCACCTGGTTCTGAGGG - Intergenic
1100984228 12:100189416-100189438 GCTCCTGCTCCTGCTGCTTGGGG - Intergenic
1101953463 12:109194104-109194126 TCCCCAGCTTCTGGTGCTGCTGG + Intronic
1102261940 12:111448188-111448210 GCTCATGCTCCAGGTGCTGCAGG - Exonic
1102408222 12:112692911-112692933 GCTCCTGCCCCCGATGCTGATGG + Intronic
1102571955 12:113832123-113832145 TCTCCAGCTCCTGGTCATGTTGG - Intronic
1103212725 12:119178681-119178703 GCTCCAGCTCCTGGAGCAAGAGG + Exonic
1104751952 12:131245500-131245522 CCTCCAGTCCCTGGTGCTGCAGG + Intergenic
1105893115 13:24696267-24696289 GCTCCAAGTCCTGCTGCTGATGG - Intronic
1106239760 13:27901997-27902019 TCTACAGCTGATGGTGCTGAAGG + Intergenic
1106793882 13:33184361-33184383 GCTGCTGCTGCTGCTGCTGATGG + Intronic
1107986935 13:45783904-45783926 GCCCCGCCTCCTGGTGGTGAAGG + Exonic
1108009944 13:45995740-45995762 GCTCCAGCATCTGCTGCTGGTGG - Intronic
1108025966 13:46177853-46177875 GCTGCTGCTGCTGCTGCTGATGG + Intronic
1108578782 13:51811292-51811314 GCGCCAGCACCTGCTGCTGGGGG + Intergenic
1111942338 13:94624011-94624033 GCTCCAGCTGCTTATGCTGAAGG - Intronic
1112189504 13:97162529-97162551 GCTGCAGTTCCTGCTGCTTATGG + Intergenic
1112598787 13:100834178-100834200 TCTCCAGCTTCTGGTGCTGCTGG + Intergenic
1113544455 13:111137347-111137369 GGTCCAGGTCATGGTGCTGCTGG - Intronic
1113675547 13:112204576-112204598 GCTCCAGCTCCTGGAGGGCACGG - Intergenic
1113844704 13:113380204-113380226 GCTGCAGCTCCAGGCGGTGAGGG - Intergenic
1113990645 14:16024853-16024875 ACTCCAGCTCCTGGAGCGGTTGG + Intergenic
1114057407 14:18984244-18984266 GCTCCCGCTCTTGCTGCTGCCGG + Intronic
1114105139 14:19417503-19417525 GCTCCCGCTCTTGCTGCTGCCGG - Intronic
1114454418 14:22845931-22845953 GCTGCTGCTCCTGGTGCTGGCGG + Exonic
1114635446 14:24184436-24184458 CCTCCACCTCCTGGTGCTAATGG - Intronic
1115747171 14:36449660-36449682 GAACTAGCTCCTGGTGCAGAGGG + Intergenic
1117453977 14:55879454-55879476 GCTCCACTCCCTGGAGCTGATGG - Intergenic
1119779248 14:77267163-77267185 GCTCCAACTCCTGGGCCTGTTGG + Intronic
1120013475 14:79444033-79444055 GCCCCAGCTCCTTGAGATGAAGG + Intronic
1120984084 14:90318020-90318042 GCTCCAGCCCATGTTTCTGAAGG - Exonic
1121106225 14:91281619-91281641 GCTCCAGCTCTTGGGGATGAGGG + Intronic
1121559145 14:94861676-94861698 GCTCCATTTCCTGGGGCTGTAGG + Intergenic
1122259200 14:100502469-100502491 GCTCCCTCTCCTGGAGCTGGGGG + Intronic
1122822010 14:104352310-104352332 GCGCCTTCTCCTGGTGCTCACGG + Intergenic
1122915464 14:104856309-104856331 GCTCCAGCACCTGCTCCTGGAGG + Intergenic
1124369109 15:29093327-29093349 GCTCCTGCCCCCTGTGCTGAGGG - Intronic
1124622189 15:31280090-31280112 GCTCCAGCTCCATGTGCTGGGGG - Intergenic
1125815642 15:42581549-42581571 GCTCCAGCTCCTAGGGCGGGTGG + Intronic
1125904659 15:43379899-43379921 TCTCCAGGTCATGCTGCTGATGG + Intronic
1126473921 15:49046460-49046482 GCTCCAGCTCCGGGAGATGGAGG + Exonic
1128226260 15:66003530-66003552 GCTCTTTCTCCTGGTGCTGTTGG - Intronic
1128659075 15:69484700-69484722 GCTCCAGCACCTCCTGCTGATGG - Intergenic
1129480000 15:75816113-75816135 GCTACTGCTGCTGGTGGTGAGGG - Intergenic
1130407263 15:83613034-83613056 GCCCCAGCTCCTTGGGTTGAGGG + Intronic
1130991387 15:88877960-88877982 GCCCCAGGTCCTAGTGCTGGCGG + Exonic
1131098978 15:89673405-89673427 TCTCCTGCTCCTGGTGCGGAAGG + Exonic
1131847692 15:96505221-96505243 GTTCCAGCACGTGGTGCAGAAGG + Intergenic
1132349306 15:101128947-101128969 GCTCAAGCTTCTGGTTCTAAGGG + Intergenic
1132698400 16:1212062-1212084 CCTCCGCCTCCTGGTGCTGCCGG - Exonic
1132715395 16:1287667-1287689 GCTCCAGGTGCTGATGCTGCGGG + Intergenic
1132892369 16:2210584-2210606 GCTCCTGCTGCTGCTGCTGCTGG - Exonic
1133175151 16:4008875-4008897 GCTCCAGCTTCAGGTCGTGAAGG + Intronic
1133216726 16:4297133-4297155 GCAGCAGCTCCTGGAGCGGAAGG + Intergenic
1135413151 16:22250195-22250217 GCCGCTGCTCCTGGTGCTGCAGG + Intronic
1136069348 16:27778707-27778729 CTTCCAGCTCCTGGGACTGAGGG - Exonic
1136365876 16:29809079-29809101 TCTCCAGCTCCTGGGGCAGGTGG + Intronic
1136394393 16:29985218-29985240 GCTCATGCTCCTGGATCTGACGG - Exonic
1136909802 16:34135918-34135940 GCTCCAACTCCTGGAGCGGTTGG + Intergenic
1137395375 16:48113376-48113398 GCTCCAGCTCCAGGAGCTCCCGG + Intronic
1139488168 16:67271096-67271118 GCTGCAGCTCCTGCTGCTGGGGG - Exonic
1139506111 16:67398886-67398908 CGTCCTGCTCCTGGTGCTGGTGG - Exonic
1139650272 16:68358916-68358938 GGTCCCGGTCTTGGTGCTGAGGG + Exonic
1139917944 16:70439467-70439489 GCTCCAGCGGCTGGAGCAGACGG + Intergenic
1139924838 16:70480355-70480377 GATCCAGCTTGTGGTGCTGGGGG + Intergenic
1140224515 16:73067007-73067029 GCTCTTGCACCTGGGGCTGAGGG - Intergenic
1140255721 16:73334475-73334497 ACTTCAGCTCTTGGAGCTGAAGG + Intergenic
1140795736 16:78435725-78435747 TCTCCTGCTAATGGTGCTGATGG + Intronic
1140948944 16:79797516-79797538 CCTCCAGCTTCTGGTGCTCCTGG - Intergenic
1141490423 16:84368672-84368694 TCTCCAGCGCCTGGTACTGGCGG - Exonic
1141608721 16:85169716-85169738 GCGCCGGCTCCTGCTGCTGCAGG - Intergenic
1142234765 16:88916775-88916797 GCTACAGCCCCTGGGGGTGAAGG + Intronic
1142418763 16:89957639-89957661 GCTGAAGCTCCAGGAGCTGAAGG + Exonic
1142604604 17:1074540-1074562 TCTCAGGCTCCTGGAGCTGAAGG + Intronic
1143385759 17:6529637-6529659 CCTCCAGCTCATGGAGCCGAGGG + Intronic
1143490994 17:7285120-7285142 GCTCCATCTCCTGGGCCTGGCGG + Exonic
1143497472 17:7320755-7320777 GCCCCAGCTGCTGGTGCAGGTGG - Exonic
1143595050 17:7909136-7909158 GCGCCTGCTCCAGGAGCTGAGGG - Exonic
1143882845 17:10043006-10043028 GCTCCAGCTCCATGTGCCAAGGG - Intronic
1144354854 17:14435477-14435499 GCTCCCCCGCCAGGTGCTGATGG - Intergenic
1145165862 17:20613003-20613025 GCTGAAGCTCCAGGAGCTGAAGG + Intergenic
1145212993 17:21028944-21028966 CCTCCTGCTCCTGATCCTGATGG + Intronic
1145413583 17:22694667-22694689 GCTCCAGCTCCAGGGGCTGCTGG + Intergenic
1146022930 17:29293972-29293994 GCTGCTGCTGCTGCTGCTGAGGG + Exonic
1146222276 17:31034749-31034771 GCTCAGGCTCCTGATACTGATGG + Intergenic
1146264767 17:31445116-31445138 GCCCAAGCTCCTGCTGCAGATGG + Intronic
1146692755 17:34888032-34888054 GACAGAGCTCCTGGTGCTGAGGG - Intergenic
1146972781 17:37086157-37086179 AGGCCAGCTCCTGGTGCTGAGGG + Exonic
1147187941 17:38722702-38722724 GCTGCTGCTCTTGCTGCTGAAGG - Exonic
1147250737 17:39151398-39151420 GCTCCTGGTGCTGGTGCTCAGGG - Exonic
1147535040 17:41315375-41315397 GCTGCGGCTCCGGGTGCTGTGGG - Exonic
1147818615 17:43228461-43228483 GCTGCAGCTCCTGCTGCTGCTGG + Intergenic
1147831898 17:43303163-43303185 GCTGCAGCTCCTGCTGCTGCTGG + Intergenic
1147968566 17:44207269-44207291 GCTCCAGCTCCTCCTCCTCAGGG - Exonic
1148074128 17:44925982-44926004 GGTCCAGCTCCTGGTGCAGGTGG + Exonic
1148078812 17:44956028-44956050 GCACCAGCTCCTAGGGCTGGTGG + Intergenic
1149850724 17:60032074-60032096 GCTCCAGCCCCTGGTGCCCTGGG - Intergenic
1149859442 17:60114450-60114472 GCTCCAGCCCCTGGTGCCCTGGG + Intergenic
1150642762 17:66960753-66960775 GCTCCAGCTCCCTGTGCCGGCGG + Intergenic
1151547371 17:74801351-74801373 AGTCCAGCTCCTGGTGGTGGTGG - Intronic
1152154060 17:78621600-78621622 GCTGCAGCCCCTGGTACTGATGG + Intergenic
1152246342 17:79186606-79186628 GCCCCCGCTCCTGGGGCGGAGGG + Intronic
1152374896 17:79913930-79913952 GCTCCTTCTCATGGAGCTGAAGG - Intergenic
1152586233 17:81190652-81190674 CCTCCAGCTCCAGCTGCTGGCGG + Exonic
1152586770 17:81192818-81192840 GCTCCTGCTCCAGGTGCTGCTGG + Exonic
1152659645 17:81536339-81536361 GGTCCAGCTCTTGGTGGAGATGG - Intronic
1152735940 17:81996786-81996808 GCTCCTGCTCCTGCTCCTGCTGG - Exonic
1152735951 17:81996822-81996844 GCTCCCGCTCCTGCTCCTGCTGG - Exonic
1152747543 17:82048381-82048403 GCTCCATTACCTGTTGCTGAAGG - Exonic
1152863568 17:82709534-82709556 GCTACAGCTCCGGCTGCTGAGGG - Intergenic
1152889547 17:82872803-82872825 TGTCCAGCACCTTGTGCTGACGG + Intronic
1155874746 18:31072384-31072406 GCTGCATCTCCTGGTCCTAAAGG + Intronic
1157410754 18:47460944-47460966 TCTCAAGCTCTTGGTGCTGAAGG + Intergenic
1159402919 18:67960335-67960357 GCTGCTGCTGCTGCTGCTGATGG + Intergenic
1160383572 18:78479359-78479381 GCCCCACCTCCTGGTGTTGTGGG - Intergenic
1160683447 19:423100-423122 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683471 19:423161-423183 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683495 19:423222-423244 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683519 19:423283-423305 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683543 19:423344-423366 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683567 19:423405-423427 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683591 19:423466-423488 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683615 19:423527-423549 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683641 19:423588-423610 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683665 19:423649-423671 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160748816 19:724091-724113 GCACCAGCTTCTGGAGCTGCAGG + Intronic
1160799761 19:962334-962356 GGTCCAGCTGCTGCTGCTGAGGG - Intronic
1161283636 19:3458250-3458272 TCTCCCCCGCCTGGTGCTGATGG + Intronic
1161514106 19:4687128-4687150 GCTCCAGCTCCTGGCGGTGTCGG + Intronic
1162403361 19:10459387-10459409 TCTCCAGTTCCTGGTGGAGACGG - Exonic
1162421527 19:10568554-10568576 GCACCAGCTCCCGGTGCAGAAGG + Exonic
1163267036 19:16227737-16227759 GCTTCACCTCCTGGAGGTGAAGG - Intronic
1163390263 19:17026588-17026610 GCTCCTGCTCCTGCTGCTGTCGG - Exonic
1163602517 19:18257561-18257583 GCTCCCGATCCTGGAGCTCAGGG + Exonic
1164509955 19:28888969-28888991 GCTCCAGCTCCGGCTGCAGATGG + Intergenic
1164721536 19:30435609-30435631 GCTCTTGCTGCTGCTGCTGAGGG + Intronic
1164816143 19:31204876-31204898 GCTCCAGCTCCCTGTGTCGAAGG - Intergenic
1164918584 19:32071767-32071789 GTTCCAGCTCCTGGCCCAGAAGG - Intergenic
1164995835 19:32720075-32720097 GCTCCAGCTCCTGGTGCTGAAGG + Exonic
1165016196 19:32881884-32881906 GCACCTGCACCAGGTGCTGAAGG - Exonic
1166331172 19:42078879-42078901 GGTGCAGCTCCTGGTGCTCCAGG - Exonic
1166334898 19:42099785-42099807 GCACCAGCTGCTGGAGCTGGAGG + Exonic
1166843645 19:45713251-45713273 GCAGCAGCTGCTGGTGATGAGGG - Exonic
1167313757 19:48752418-48752440 GGTGCACCTCCTGGTTCTGAAGG + Intronic
1167323019 19:48807793-48807815 CCTTCAGCCCCTGGGGCTGAGGG + Intronic
1167506563 19:49873973-49873995 GCATCAGCTCCGGGTGCTGAAGG - Intronic
1202699607 1_KI270712v1_random:154471-154493 ACTGCATCTTCTGGTGCTGATGG - Intergenic
925055454 2:853626-853648 GCTCCAGCTCCGGGGAGTGACGG - Intergenic
925274409 2:2638572-2638594 GCACCAGGTCCAGGTCCTGAGGG + Intergenic
925867680 2:8243461-8243483 GTTCCAGCTTCTGGTGTTGCCGG - Intergenic
927854035 2:26516817-26516839 GCTCCAGGTCCCGCTGCTGGTGG + Intronic
927883959 2:26707191-26707213 GCCCCAGCCCCTGGGGCTGCTGG + Intronic
927948737 2:27153244-27153266 GCACCAGCCCCAGGTGCTGATGG + Exonic
928133898 2:28673651-28673673 CCTCCACCTCCTGGTGTTCATGG - Intergenic
928188041 2:29132753-29132775 GCTGAAGCTACTGGTGGTGATGG + Intronic
929243938 2:39681944-39681966 CCTACAGCTCCTGGTTCTCAGGG - Intronic
929244444 2:39686501-39686523 GCACCGGCTTCTGGTGCCGAGGG + Intronic
930027750 2:47039792-47039814 GCTCCAGCTCAGGCTGATGATGG - Intronic
931637637 2:64355127-64355149 GCTCCAGCTCCGGGCCCTGTGGG - Intergenic
932562970 2:72888549-72888571 GTTCCAGGTCCTGGCGCTGGAGG + Exonic
932842731 2:75098950-75098972 ACTCCACCTGCTGGTTCTGAGGG - Intronic
934170551 2:89537959-89537981 ACTGCATCTTCTGGTGCTGATGG - Intergenic
934280853 2:91612279-91612301 ACTGCATCTTCTGGTGCTGATGG - Intergenic
934761942 2:96861282-96861304 GCTCCAGGCCCTGGTTGTGATGG - Exonic
934975246 2:98797501-98797523 GCTCCAGGCCCTGTTGCTGCAGG + Exonic
935328808 2:101961635-101961657 GCTGCCCCTCCTGGTGTTGAAGG + Intergenic
935679169 2:105621153-105621175 GCTCCAGCTCCTGAGGAAGATGG - Intergenic
935705656 2:105855108-105855130 TGTCCAGCTCCTGGTCCTGCTGG - Exonic
936068247 2:109348219-109348241 GGTTCTGCTCCTGGTGCTGATGG - Intronic
936118483 2:109721726-109721748 CCTCCAGCACCTAGGGCTGAGGG - Intergenic
936349997 2:111705319-111705341 TCCCCAGCTGCAGGTGCTGAAGG - Intergenic
938408592 2:131046102-131046124 GCAGCAGGTCCTGGTGCTGGCGG + Exonic
939769566 2:146298851-146298873 GCTGCAGCTGCTGTTGGTGATGG - Intergenic
942591585 2:177552526-177552548 GCTCCAGTTCCGGGTGCAGCTGG + Exonic
942598708 2:177618464-177618486 GCTCCAGTTCCGGGTGCAGCTGG + Exonic
943853304 2:192755957-192755979 GCTCCTAATCCTGGTGCAGATGG - Intergenic
946292682 2:218757215-218757237 GCTCCACCTCCTGGAGGAGAGGG - Intergenic
947156007 2:227164018-227164040 GCGGCAGCTCCTGGCGCTGCGGG - Exonic
947792967 2:232878245-232878267 GCTCCACCTCAGTGTGCTGAGGG - Intronic
947875965 2:233468523-233468545 GCTCCTGCACCTGGAGCGGAGGG + Exonic
948355925 2:237377000-237377022 GCTTCAGTTCCTGGTGCTGCTGG - Exonic
948398070 2:237662119-237662141 TCTCCAGCTTCTGGTGCTGCTGG + Intronic
948612134 2:239176470-239176492 TCTCCAGCTCCTGCTCCTGGCGG + Exonic
949014692 2:241702481-241702503 GCGCCAGCTCCTCCTGCAGACGG - Intronic
1169131498 20:3168287-3168309 GCGCCAGCTGCTGGCACTGACGG + Intronic
1171240663 20:23564996-23565018 CATCCAGGGCCTGGTGCTGATGG + Exonic
1171771234 20:29324845-29324867 ACTCCAGCTCCTGGAGCCGTTGG - Intergenic
1171905278 20:30894618-30894640 GCTCCAGCTCTTGGAGCGGTTGG + Intergenic
1174225272 20:48993753-48993775 GCTGGATCTCCTGGTCCTGAGGG - Intronic
1175012382 20:55752714-55752736 GCTGCTGCTGCTGGTGCTGGTGG - Intergenic
1175503999 20:59469366-59469388 CCTTCAGCTGCTGGTGCTGGGGG - Intergenic
1175641494 20:60634074-60634096 GCTCCTGCTCTTGGTGGGGATGG - Intergenic
1175679720 20:60977084-60977106 TCTCCAGCTCCAGAAGCTGATGG + Intergenic
1175820760 20:61907586-61907608 GCGCCAGCTCCTTGTCCTGCTGG + Intronic
1176143685 20:63556023-63556045 GATCCAGCTCCTGCTGCTCGGGG + Exonic
1179539369 21:42074191-42074213 CCTCCAGCTTCTGGAGCTGCTGG + Intronic
1179551374 21:42146079-42146101 GCACCAGCTCCTAGGGCTGCTGG - Intergenic
1179569710 21:42271261-42271283 GCTCCAGGTGATGGGGCTGATGG - Intronic
1179873904 21:44257857-44257879 CCCCCAGCTCCTGGGGCTGCTGG + Intronic
1179907615 21:44432270-44432292 TCTCCAGCTCCTGGTGTTCCTGG + Intronic
1180316625 22:11282673-11282695 ACTCCAGCTCCTGGAGCGGTTGG - Intergenic
1180338708 22:11600822-11600844 GCTCCAGCTCCTGGAGCGGTTGG + Intergenic
1180475896 22:15706853-15706875 GCTCCCGCTCTTGCTGCTGCCGG + Intronic
1181018960 22:20088259-20088281 GCTTCAGCTTCTGGGGCTGGGGG + Intronic
1181850783 22:25748582-25748604 GCCCCAGGTTCTGATGCTGAGGG + Intronic
1182177533 22:28306526-28306548 TCTCCAGCTTCTGGTGGGGATGG - Exonic
1182974929 22:34614620-34614642 GCTCCAGCTCTGGGTGCTGCCGG - Intergenic
1183040491 22:35174222-35174244 GCTGCAGCTCCTTGACCTGAAGG - Intergenic
1183360463 22:37380494-37380516 CCACCTGCTCCTGGAGCTGACGG - Intronic
1183529652 22:38346563-38346585 GCTCCAGCGGCTGATTCTGAAGG + Intronic
1183682639 22:39342380-39342402 GCTCAAGATGCTGGTGGTGATGG + Intergenic
1183702661 22:39458553-39458575 GCTGCAGCTCCTGGGGGTGGGGG - Intronic
1183942229 22:41302239-41302261 CCTCCAACTCCGGGTGCTGCGGG - Intronic
1184660607 22:45963941-45963963 GCTGCAGCTCCTGGAGGTGCGGG - Intronic
1184893423 22:47393254-47393276 GCTCCAGCCCCTGGTGCACAGGG - Intergenic
1184942580 22:47780063-47780085 TGTCCAGCACCTGGTGATGATGG + Intergenic
949980804 3:9500738-9500760 GCACCAGCAACTAGTGCTGAGGG + Exonic
950427476 3:12932226-12932248 GCCCCAGCTCCATGTGCTGCAGG + Intronic
950538870 3:13598116-13598138 GCACCAGCTTCTACTGCTGAAGG + Intronic
950650347 3:14403048-14403070 GCTCCGGCTCTTGGTGCGGGCGG + Intronic
950798616 3:15531506-15531528 ACTCCAGCTCCTGCTCCTGCTGG + Intergenic
950940790 3:16889236-16889258 GCTCCAGCACCTGGGGCACAGGG - Intronic
951412358 3:22380323-22380345 GCTCCAGCCCCTGGACCAGAGGG + Intergenic
952886009 3:38011274-38011296 CCTCCCGCTGCTGGTGCTGCAGG + Exonic
952919914 3:38277095-38277117 GCCCCAGCTCCAGGTCCTGGAGG - Exonic
953056152 3:39388788-39388810 GCTGCAGCTCCTGGAACTAAGGG + Intronic
955935608 3:64099731-64099753 CCTCCATCTCCTGGTACTGCTGG + Exonic
960338228 3:116444752-116444774 ACTCCAGCTCCTGATGCTGCAGG - Intronic
960638761 3:119808509-119808531 GCACCAGCTCCAGATGCTGCTGG + Intronic
960951194 3:122999613-122999635 CCTCTACCTCCTGGGGCTGAGGG + Intronic
961204409 3:125069407-125069429 GCTGCAGAGCCTGGAGCTGATGG + Intergenic
961205791 3:125080532-125080554 GCTCCTGCACTTGGTGCTTAAGG + Intergenic
961211940 3:125132134-125132156 GCACCAGCTCCAGGGGCTTAGGG - Intronic
962958128 3:140285363-140285385 GCAGCAGCTCCTGTTGCTTAAGG + Intronic
962974544 3:140434425-140434447 GCTCCAGCTCATGGTTCCCAGGG - Intronic
963313842 3:143737846-143737868 GCTGCTGCTGCTGTTGCTGATGG - Intronic
963719285 3:148841700-148841722 GATCCAGCTCTTGCTGCTGTCGG + Intronic
964333758 3:155633155-155633177 GCTACAGCTCCCATTGCTGAGGG + Intronic
965670039 3:171138271-171138293 GCTCCTGCCGCTGATGCTGAAGG + Exonic
968228206 3:196989132-196989154 TCTCCAGCTCCAGCTGCTGCTGG - Intronic
968650984 4:1760202-1760224 CCTCCAGCTCCGGGAGCTCAGGG + Intergenic
968747760 4:2369713-2369735 TCTCCAGCTCCCGGTGTTGCCGG - Intronic
969029247 4:4197918-4197940 ACTGCATCTTCTGGTGCTGATGG + Exonic
969444806 4:7238795-7238817 CCGCCAGCTCCTGGTGCACACGG + Intronic
969560814 4:7946678-7946700 GCCCCACCTGCTTGTGCTGAGGG - Intergenic
969682285 4:8649912-8649934 GCTCCTCGTCCTGGAGCTGAGGG - Intergenic
969722668 4:8901171-8901193 GCTCCGGCTCCTGGGGCGGCTGG + Intergenic
972335549 4:38104560-38104582 GTTGCAGCTGCTGCTGCTGAAGG + Intronic
978565309 4:110074878-110074900 GTTCCAGCTCCAGGAGATGAAGG - Intronic
978618983 4:110621250-110621272 CCTCCAGCTCCTGGAGCTGCTGG + Exonic
979690270 4:123552014-123552036 GCTCCAGGTATTGCTGCTGAGGG + Intergenic
980625600 4:135371427-135371449 GCTCCAACTCCAGGTGCAGCAGG + Intergenic
981472574 4:145153267-145153289 GCAGCAGGTCCTGGTTCTGAAGG + Intronic
981615578 4:146640124-146640146 CCTCCAGCGCCTGGTGCGGTTGG - Exonic
983650780 4:170034471-170034493 GCGCCAGCTCCCTGTTCTGAGGG + Intergenic
985279451 4:188270832-188270854 GCTGCTGCTGCTGGTGCTGGTGG - Intergenic
985558274 5:568732-568754 GGGCCAGCTCACGGTGCTGAGGG - Intergenic
985670868 5:1205989-1206011 CCTGCAGCTCCTGCTTCTGAAGG + Intronic
985785473 5:1891367-1891389 GCCCAAGTTCCTGGGGCTGACGG - Intergenic
985863548 5:2493786-2493808 GCACCTGCTCCTGGTGCTATGGG + Intergenic
985975821 5:3418373-3418395 GCCCCAGATCATGGTGCTGTAGG - Intergenic
986195842 5:5535823-5535845 ACTGCAGCTCCAGGTGCAGATGG + Intergenic
986669148 5:10127524-10127546 GCAGCAGCTCCTGGAGCTGGCGG - Intergenic
986737015 5:10675386-10675408 GATCCATCTCCTGGAGCAGATGG + Intergenic
992949904 5:81848854-81848876 ACTCCAGCTCCTGGAGCTGTAGG + Intergenic
994109678 5:95987127-95987149 GCTCCAGCTTCTGGAGCTGTGGG - Intergenic
997383489 5:133454490-133454512 GATCCAGCGACTGCTGCTGAAGG - Intronic
998142094 5:139705791-139705813 GCTACAGCTGCTACTGCTGAAGG - Intergenic
998279116 5:140787856-140787878 GCTCCAGCTCCTCGTGGTCCAGG - Exonic
998367621 5:141641083-141641105 GCTCCAGCTCCTGATTCCCAAGG + Exonic
998404115 5:141863951-141863973 GCTACACCGCCTGGTGGTGAAGG - Exonic
1000254901 5:159528396-159528418 GCAGCAGCTCCAGTTGCTGATGG + Intergenic
1001482649 5:172099215-172099237 GCTGCTGCTCCTGCTGCTGACGG - Intronic
1001858753 5:175034817-175034839 GCTGCTGCTGCTGGTGGTGATGG + Intergenic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1003361261 6:5428024-5428046 ACTAGAGCTGCTGGTGCTGATGG - Intronic
1003950016 6:11108387-11108409 CCTTCAGCTCCTTGAGCTGAAGG - Intronic
1004780784 6:18906137-18906159 GCACCAGACCCTGGAGCTGAGGG - Intergenic
1005134837 6:22556198-22556220 GATGCAGCTCCTGTAGCTGAAGG + Intergenic
1006093222 6:31640452-31640474 GGTCCACCTCCTGCTCCTGAGGG - Exonic
1006463513 6:34177502-34177524 GCTCCCTCTCCTGCTGCTAAGGG + Intergenic
1006465357 6:34190799-34190821 GCTCCAACTCCAGGTGCAGCAGG - Intergenic
1006480927 6:34293520-34293542 GCTTCCTCTCCTGGTTCTGAAGG + Exonic
1007262200 6:40571712-40571734 GATCCACCTGCTGGTGGTGACGG - Intronic
1007350747 6:41271923-41271945 GCTGCTGCTCCTGCTGCTGCAGG - Intronic
1007371619 6:41429904-41429926 TCTCCAGCCCCTGCGGCTGAGGG + Intergenic
1007602106 6:43088829-43088851 CCTCCTCCTCCTGGTGCTGCTGG + Intronic
1007829425 6:44627148-44627170 GCCCCAGCTCCACGTGCTGAGGG - Intergenic
1009992157 6:70856865-70856887 GTTGCAGCTGCTGGTGCAGAGGG - Exonic
1013368736 6:109453335-109453357 GCTCCAGCTGCTTCTGCTGAAGG - Exonic
1013435548 6:110101902-110101924 GCTCTAGCTACTGGTGGAGAGGG + Exonic
1015456143 6:133428876-133428898 CCTCCATCTTCTGGGGCTGAGGG + Intronic
1016034653 6:139373815-139373837 GCTGCTGCTGCTGGTGGTGATGG + Exonic
1016840157 6:148517611-148517633 GCTGCATCTGCCGGTGCTGAGGG - Intronic
1018446900 6:163866520-163866542 GCTGCAGCTAATGGTGTTGACGG - Intergenic
1019130241 6:169867990-169868012 GCTCCAGCTCCATGTCCTAAAGG - Intergenic
1019532487 7:1510796-1510818 CCCCCAGCCCCTGGTGCTGGTGG - Intergenic
1020560586 7:9726273-9726295 GCTCCTGCTCCTGCTGCTGTCGG + Intergenic
1023418400 7:39951798-39951820 GCGCCAGCTGCTGCTGCTGTAGG - Exonic
1023860078 7:44213292-44213314 GCACCCACTCCTGGTGCTCAAGG - Exonic
1024902714 7:54339419-54339441 GCTCCAACTCCTTGGACTGAAGG + Intergenic
1025813403 7:64889338-64889360 GCCCCAACAGCTGGTGCTGAGGG + Intronic
1026154105 7:67812302-67812324 GCTCCAGGAAATGGTGCTGATGG - Intergenic
1026858332 7:73769317-73769339 GCTCCAGCTCGCGGTGGTGGTGG + Exonic
1028975984 7:96914634-96914656 GCTCCAGCCACCTGTGCTGATGG - Intergenic
1029926915 7:104328470-104328492 GCTGCAGCTGCTGCAGCTGAAGG - Intergenic
1030276154 7:107723906-107723928 TCTCAAACTCCTGGTGCTCAAGG + Intergenic
1032704396 7:134409509-134409531 GCTCCTGCTCCTGGGAATGATGG - Intergenic
1034225479 7:149477675-149477697 GCTCCAGCTCCAGGAGCAGCAGG - Exonic
1034426349 7:151016208-151016230 GCTCCTGCTGCTGCTGCTGCTGG + Exonic
1034429279 7:151033114-151033136 GCCCCACCTCCTGGAGCTAATGG - Intronic
1034498597 7:151436114-151436136 CCTCCCACGCCTGGTGCTGAAGG + Intronic
1034563095 7:151894277-151894299 CCTCCAGCTCCTCGTGCTGCAGG - Intergenic
1034762361 7:153684969-153684991 CTTCCAGCTCCTGGTGCTGCCGG + Intergenic
1035168783 7:157006559-157006581 GCTCCAGCTCCAGCAGCTGCTGG + Exonic
1035475134 7:159138098-159138120 GCTCCAGCTCCCGCAGCAGAGGG + Intronic
1036783814 8:11671904-11671926 GCTCCAGGCCCAGGAGCTGAGGG - Intergenic
1037175236 8:15939350-15939372 GCTCCTGCTCCTGGAGGTGAAGG - Intergenic
1037764253 8:21762205-21762227 GCCCCCACTCCTGGTGGTGAGGG - Intronic
1038535316 8:28349311-28349333 TCCCCAGCTCCTGGTGCAGAAGG + Intronic
1040598963 8:48865651-48865673 GCTGAAGCTCCTGGAGCTGCAGG + Intergenic
1041085177 8:54250092-54250114 GCTCCTGCTGCTTGTGGTGACGG + Intergenic
1041167204 8:55102132-55102154 GCTGCTGCTCCTGCTGCTGGCGG + Intergenic
1043425491 8:80144454-80144476 GCTCCTGCTCCTGTTCCTGAGGG + Intronic
1044048987 8:87475795-87475817 GCTCCCCCACCTGGTTCTGAGGG - Intronic
1045904068 8:107321944-107321966 GCTCCAGTTGCTGCTTCTGAAGG + Exonic
1046238880 8:111464290-111464312 GCTCCAGATCCTTCTGCTGGTGG + Intergenic
1048355695 8:133652420-133652442 GCTCCAGCTCGTGCTGCCCACGG + Intergenic
1049711124 8:144063820-144063842 GCTTCAGCTCCTGGTTCTCCTGG + Intronic
1049794068 8:144488540-144488562 GCTGCAGTTACTGGTGGTGATGG + Intronic
1050287433 9:4118055-4118077 GCCCGAGCTCCGGGTGGTGAAGG + Exonic
1053104424 9:35398071-35398093 GCCCCAGCTCTTAGTGCTGAGGG + Intronic
1056273171 9:84967277-84967299 GCCCCAGCTCCTTGTGGAGAGGG - Intronic
1056717000 9:89039917-89039939 GCTGCCGCTCCTGTTGCTGCTGG - Intronic
1056763600 9:89431254-89431276 GCTCCTGCTCCTGCTCCTGCGGG + Intronic
1057313843 9:93956924-93956946 TCTCCAGCTCCAGCTGCTGGTGG + Intergenic
1057481677 9:95449482-95449504 GCTCCAGCTGCGGGACCTGAAGG - Intronic
1057763111 9:97892106-97892128 CCCCCAGATCCTGCTGCTGACGG - Intergenic
1057941158 9:99286153-99286175 GCTCCAGCTCCAGCTCCAGAAGG + Intergenic
1059231827 9:112727759-112727781 GCACCAGCATCTGGTGTTGAGGG + Intergenic
1059358524 9:113720079-113720101 GTTCCAGCTCCAGCTGCAGATGG - Intergenic
1060934753 9:127508484-127508506 TCCCCAGCTCCTGGTGCAGGAGG + Exonic
1061089961 9:128420904-128420926 GCTCCAGCTGCTGCTCCTGCTGG + Exonic
1061118117 9:128627379-128627401 GCTCCAGCTCCCTCTCCTGAGGG - Exonic
1061165660 9:128920804-128920826 GCTCAGGCTCCTGGTTCAGAGGG - Intergenic
1061205236 9:129159199-129159221 GCCCCTACTCCTGGTGCTGGGGG - Intergenic
1061301047 9:129705230-129705252 CCCCCAGCTCCTAGTGCAGAGGG + Intronic
1061809857 9:133155905-133155927 GCTCCAGCAGCTTGGGCTGAGGG + Exonic
1061821496 9:133229385-133229407 GATCCAGCTCCTGGGAGTGATGG + Intergenic
1062445527 9:136592562-136592584 CCTCCAGCTTCTGATGCTGCAGG - Intergenic
1062503186 9:136859941-136859963 GCTCATGCTCCTGGTGCTGCTGG + Exonic
1062627358 9:137449334-137449356 GCCCCAGGTCCCGGTGCAGAGGG + Exonic
1203364932 Un_KI270442v1:248625-248647 ACTCCAGCTCCTGGAGCGGTTGG - Intergenic
1187279612 X:17847836-17847858 GCCTCAGCCCCTGGTGATGATGG + Intronic
1187925996 X:24250554-24250576 TCTCCAACTCCTGGGGCTCAAGG + Intergenic
1188113674 X:26219618-26219640 GCTGCAGCTGCTGGTGCTGCAGG + Intergenic
1189330614 X:40142577-40142599 GCTCCAGCTCCTGTGCGTGAGGG + Intronic
1189468807 X:41298425-41298447 GCTCCAGTGGCTGTTGCTGATGG + Intergenic
1190073333 X:47296856-47296878 GCAGCAGCTCTTTGTGCTGAGGG - Intergenic
1190982278 X:55466850-55466872 CTTCCAGCTTCTGGTGCTTATGG - Intergenic
1190986421 X:55506333-55506355 CTTCCAGCTTCTGGTGCTTATGG + Intergenic
1194239071 X:91422067-91422089 GCTGCAGCAGCTGGTTCTGACGG - Intergenic
1197130686 X:123002371-123002393 GCTCCAGTTCCATGTGCTGCAGG - Intergenic
1197346337 X:125328023-125328045 GCTTCAGCTCCTGGTGTGGCTGG + Intergenic
1200041080 X:153369998-153370020 CCTCCAGCTTCTGGTGCTCCAGG + Intergenic
1200117553 X:153776021-153776043 GTTCCAGCCCCTGACGCTGATGG + Exonic
1200184931 X:154175989-154176011 CCTCCAGCTCCTGGAGCTGCTGG + Intergenic
1200190584 X:154213127-154213149 CCTCCAGCTCCTGGAGCTGCTGG + Intergenic
1200196335 X:154250929-154250951 CCTCCAGCTCCTGGAGCTGCTGG + Intergenic
1200201990 X:154288047-154288069 CCTCCAGCTCCTGGAGCTGCTGG + Exonic
1200250991 X:154553627-154553649 TCTCCAGCCCCAGGTGCCGATGG - Intronic
1201073787 Y:10171772-10171794 ACTCCAGCTCCTGGAGCTGTTGG + Intergenic
1201906789 Y:19093567-19093589 TCTCCAGCTCCTGGGGCTCTAGG + Intergenic