ID: 1164996028

View in Genome Browser
Species Human (GRCh38)
Location 19:32720660-32720682
Sequence GAGTGGGGGCGGTGGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 476}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164996028 Original CRISPR GAGTGGGGGCGGTGGGAATA AGG (reversed) Intronic
900376677 1:2357940-2357962 GAGAAGGGCCGGTGGGAAAAGGG + Intronic
900502329 1:3012591-3012613 GGGTGGGGGCGGTGGGGATGCGG - Intergenic
901862629 1:12084554-12084576 GAGTGGGGGCGTTGGGGGTGGGG + Intronic
902112046 1:14089073-14089095 GTGTGGGTGCAGAGGGAATATGG - Intergenic
902479249 1:16702860-16702882 GGGTGGGGGTGGTGGGGGTATGG + Intergenic
902651807 1:17842353-17842375 TAGTGGGGGCGGGGGGAGTGGGG - Intergenic
902761789 1:18585894-18585916 GAGTGGGGGTGGGGGGAAGCTGG + Intergenic
903172438 1:21562709-21562731 GAGTGGGGGGTCTGGGGATAGGG - Intronic
903233854 1:21937315-21937337 GAAAGGGGGCGGTGGGGAGAGGG - Intergenic
903284581 1:22268696-22268718 GAGTGGAGGCGGAGGAAGTAGGG + Intergenic
903366151 1:22806629-22806651 GCCTGGCGGGGGTGGGAATAGGG - Intronic
903543244 1:24108421-24108443 GACTGGGGGCCCTGGGAACAGGG + Intronic
903869914 1:26426514-26426536 GAGTGGAGAAAGTGGGAATAGGG + Exonic
904601087 1:31672945-31672967 GAGTGTGGGAGGAGGGAAGACGG - Intronic
905925361 1:41745748-41745770 GGGTTGTGGGGGTGGGAATATGG + Intronic
906334885 1:44920517-44920539 GTGTGGGGGTGGTGGGAGTGGGG - Intronic
906377162 1:45304646-45304668 GAGTAGGGGCCTTGGTAATAGGG - Intronic
906534866 1:46545808-46545830 GGGTGGAGGGGGTGGGAATGGGG - Intronic
907082767 1:51639517-51639539 GAGTTGGGGTGGTGGGGACAAGG + Intronic
907438005 1:54461938-54461960 GAGTGGGGGCTGGGGGCAGAGGG + Intergenic
908501141 1:64745027-64745049 GAAGGGGGGCGGTGGGAGGAGGG - Intergenic
909653875 1:78007910-78007932 GAGCTGGGATGGTGGGAATAAGG + Intronic
913301226 1:117371466-117371488 GTGGAGGGGCAGTGGGAATAAGG + Intronic
913446770 1:118958656-118958678 AGGTGGGGCTGGTGGGAATATGG - Intronic
914333715 1:146696816-146696838 GACTGGAGGGGGTGGGAATGGGG + Intergenic
915214349 1:154329923-154329945 GAGTGGGGTAGGTGGCAAGAAGG - Intronic
915331643 1:155116482-155116504 GAGTTTGGGCAGGGGGAATAGGG - Intergenic
915388449 1:155518689-155518711 GTGGGGGGGCGGTGGGAGGAAGG + Intronic
915444881 1:155968962-155968984 GGGTGGTGGCTGTTGGAATATGG - Intronic
915508784 1:156374397-156374419 GAGTGGGGGAAGGGGGAATAGGG - Intronic
916473132 1:165143029-165143051 GAGTGGGGATGGTGGTAAAAGGG + Intergenic
917235385 1:172886267-172886289 GATTGGGAGCTGTGGGAAGAAGG + Intergenic
918129831 1:181617601-181617623 GAGTGATGGAGGTGGGAAGAAGG - Intronic
918665407 1:187145033-187145055 GTGTGGGGTCAGGGGGAATATGG - Intergenic
919230658 1:194769101-194769123 GAGTCGGGGAAGTGGGAAGAAGG + Intergenic
920286962 1:204887149-204887171 GCTTGGGGGAGGAGGGAATAGGG - Intronic
920397966 1:205660273-205660295 GGCTGGGGGAGGTGGGAAGAGGG - Intronic
920487106 1:206381210-206381232 GAGTGGGGGATGGGGGAAGAAGG - Intronic
920958987 1:210647555-210647577 GGCTGGGGGCGGTGGGAAGCAGG - Intronic
921441833 1:215196695-215196717 GTGTGGGGGCGGTGGGAGATGGG + Intronic
923291608 1:232551587-232551609 CAGTGGGGGAGGTGAGAAGAAGG + Intronic
1063882188 10:10542568-10542590 GATTGGAGGCTGTTGGAATAGGG + Intergenic
1063960375 10:11301420-11301442 GCGGGGGGGCGGTGGGAGCAGGG - Intronic
1064005210 10:11693805-11693827 CAGAGGGGGAGGTGGAAATAGGG + Intergenic
1064449183 10:15426189-15426211 TGGTGGGGGCGGGGGGAAGAGGG + Intergenic
1066746406 10:38606184-38606206 GAGGGTGGCTGGTGGGAATAGGG + Intergenic
1067007129 10:42674621-42674643 GGGGGGGGGCGGTGGGGAGATGG + Intergenic
1068896528 10:62209604-62209626 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1069777932 10:70937673-70937695 GAGGGAGGGCGGTGGGAGTGAGG + Intergenic
1069917763 10:71797826-71797848 GAGTGGGGGAAGTGGGGATGGGG + Intronic
1070566940 10:77610719-77610741 GACTGGGAGCAGAGGGAATAGGG + Intronic
1070567194 10:77612913-77612935 CAGTGGGGGTGGGGGGAGTAGGG - Intronic
1071104554 10:82079403-82079425 GTGTGGGGGCAGTAGGTATATGG - Intronic
1072862958 10:99025699-99025721 GAGTGGGGAGGGTAGGAAGAGGG + Intronic
1074503252 10:114044490-114044512 GTGTGGGGCCGCTGGGAGTACGG + Exonic
1074661526 10:115663982-115664004 AAGTGGGAGCTGTGGGAAAATGG - Intronic
1075664830 10:124222728-124222750 GAGTGGGGGCAGTGGGCCCAAGG + Intergenic
1075999873 10:126905787-126905809 GAGGGGGTGGGGTGGGAATGGGG + Intronic
1076174675 10:128358914-128358936 TATTGGGGGAGGTGGGGATAAGG + Intergenic
1077098053 11:808071-808093 GGGTGGGGGAGCAGGGAATAGGG + Intronic
1077233766 11:1470219-1470241 CAGTGGGGGCAGTGGGGATGGGG - Exonic
1077248517 11:1550635-1550657 GAGTGGGGTGGGTGGGTACATGG - Intergenic
1077660386 11:4063107-4063129 GGGTGGGGGCAGTGGGAAATAGG + Intronic
1077914995 11:6605652-6605674 GAGTGGGGCGGGTAGGAAGAGGG - Intronic
1078221914 11:9358503-9358525 GATTCTGGGTGGTGGGAATATGG - Intergenic
1078730158 11:13966189-13966211 GAGGGGGGACTGTGGGAAGAGGG - Intronic
1079125430 11:17715006-17715028 GGTTGGGGGCGGAGGGAAAAAGG - Intergenic
1079149651 11:17886055-17886077 AAGTGGGGGCGGGGGGCATCAGG - Intronic
1080086469 11:28288662-28288684 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
1080406911 11:31987591-31987613 GGCTGGGGGCGCTGGGAAGAGGG + Intronic
1081656664 11:44862007-44862029 GAGTGGAGGTGGGGGGAAAAAGG - Intronic
1082928209 11:58573720-58573742 GAGTGGGGGCGGGGGAAGTGGGG + Intronic
1083273845 11:61586096-61586118 GTGAGGGTGAGGTGGGAATATGG - Intergenic
1083419319 11:62544499-62544521 GTTTGGGGGCTGTGGGAATGTGG - Intronic
1084263336 11:67992348-67992370 GAGGGGGCGCGGTGGGGAAACGG - Intronic
1084810071 11:71606779-71606801 GAGGGGGCGCGGTGGGGAAATGG + Intergenic
1084963708 11:72732483-72732505 GAGGTGGAGCGGTGGGAACAGGG - Intronic
1085300557 11:75455893-75455915 GAGGGGGGGCACTGGGAACAGGG + Intronic
1085304061 11:75475295-75475317 GGGCGGGGGTGGTGAGAATAAGG + Intronic
1085395314 11:76204226-76204248 TAGAGGGGGAGGTGGGAAAAGGG - Intronic
1085505603 11:77056895-77056917 GGGTGGGGGTGGGGGGCATATGG - Intergenic
1086089584 11:82992250-82992272 TAGTGTGGGGGGTGGGAAGAAGG - Intronic
1086932359 11:92706401-92706423 GTGTGGGAGCGGTGGGGATGTGG + Intronic
1086942281 11:92810646-92810668 GAGTGGGGGTGGGGGAGATAAGG + Intronic
1089046509 11:115505284-115505306 GAGCGGGGGTGGTGGGAGTTGGG + Intergenic
1089311648 11:117562000-117562022 GAGTGGGGACAGTGGGAAGCAGG + Intronic
1089418878 11:118316059-118316081 GAGGGGGGGTGGAGGGAGTAGGG - Exonic
1089470442 11:118716267-118716289 GGGTGGGGGCGGGGGGTAAAAGG - Intergenic
1090840845 11:130486602-130486624 GGTTGGGGGCGGTGGGCATCTGG + Intergenic
1092014785 12:5149559-5149581 GAGTGGGACGGGTGGGAGTAGGG + Intergenic
1092193532 12:6535990-6536012 GACTGGGGCGGGTGGGAAGAGGG - Intronic
1092236545 12:6814303-6814325 GAGTGGGGCAGGTGGGGATGAGG + Intronic
1093948311 12:25135487-25135509 GATGGGGGGCGGTGGGAAATGGG + Intronic
1094229557 12:28087098-28087120 GCGGGGGGGCGGGGGGATTAGGG + Intergenic
1094493827 12:30977310-30977332 GAGTGTGGGCAGGGGGGATACGG - Intronic
1094511900 12:31102081-31102103 GACTGGGAGCGGTGGGGATGAGG - Intronic
1095424438 12:42060456-42060478 GAGTGGTGGGGGTGGGATGAAGG - Intergenic
1095529029 12:43162661-43162683 GAGTGGGTGGGGTGGGGAAAGGG + Intergenic
1095904065 12:47359322-47359344 GAGTGGGGAGGATGGGAAGAGGG - Intergenic
1096523179 12:52195442-52195464 GGGTGGGGGCAGAGGGAACAGGG + Intergenic
1097188373 12:57207970-57207992 GAGTGGTGGCGGGGGGATAATGG + Intronic
1097973320 12:65658445-65658467 TAGTGGTGGAGGTGGGAAGAAGG - Intergenic
1100224149 12:92539486-92539508 GATGGGGGGTGGGGGGAATATGG - Intergenic
1100676639 12:96875841-96875863 GGGCGGGGGCGGCGGGAAGAGGG + Intergenic
1100805282 12:98277041-98277063 AAGTGGCGGTGGTGGGATTAGGG - Intergenic
1100849294 12:98692536-98692558 GAGTTGGGGAGGGGGGAATGAGG - Intronic
1101986519 12:109451552-109451574 GAGTGGGGGCGGTGAGAGGAGGG + Exonic
1102536756 12:113587682-113587704 GAGTGGGGGAAGTGGGAAGGAGG - Intergenic
1102973332 12:117188983-117189005 GAGTGGGGGTGGAGGGAGCAGGG - Intronic
1103080086 12:118016906-118016928 GAGCGGCGGCGGTGGGCAGAGGG + Intronic
1103404641 12:120666778-120666800 GAGTTGGGGCAGTGGCAACAGGG + Intronic
1104068637 12:125326535-125326557 GATGGGGGGAGGTGGGAATTAGG + Intronic
1104731757 12:131108996-131109018 GATGGGGGGAGGTGGGAATGGGG + Intronic
1105472506 13:20705306-20705328 GAGCGGGGGCGGTGGGGGTGGGG + Intronic
1105514205 13:21076053-21076075 GAGCGGGGGCGGGGGGAGGAAGG - Intergenic
1107014129 13:35695294-35695316 GGGTGGGGGCGTTGGGAATGGGG - Intergenic
1107217179 13:37935060-37935082 GAGTGGGGGCGGTGGGGGGGGGG + Intergenic
1107445629 13:40468050-40468072 GAGTGGGGGTGGTAGGATGATGG - Intergenic
1107797308 13:44065776-44065798 GAGTGGGGGAGTAGGGAGTATGG - Intergenic
1107886811 13:44880644-44880666 GGGTGGGGGGGGGGGCAATAAGG - Intergenic
1108601348 13:51997875-51997897 GAGCGGGGAGGGTGGGAAGAAGG + Intronic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1108779999 13:53818401-53818423 AAGTGGGCCAGGTGGGAATAAGG - Intergenic
1109178459 13:59184645-59184667 GTTTGGGGGAGGTGGGAATAGGG - Intergenic
1110317536 13:74128362-74128384 GTGTGGGGGCGGTGGAGGTATGG + Intronic
1111167034 13:84472803-84472825 GTGTGGAGGCAGTGGGTATATGG + Intergenic
1111466245 13:88615009-88615031 GAGTTGGGGTGGCGGGAATGGGG + Intergenic
1112544646 13:100354329-100354351 GAGAGGGGGCGGTGGGAGGAGGG + Intronic
1113146413 13:107212952-107212974 GTGAGGGAGCGGTGGGAATGGGG - Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1114445309 14:22783756-22783778 GAGTGGGGGAGGTGGGATACTGG - Intronic
1115308596 14:31957262-31957284 GAGTGGGGGCAGTGGGGAGTGGG - Intergenic
1115455019 14:33592101-33592123 GAGGGGGTGGGGTGTGAATAAGG - Intronic
1115767318 14:36636691-36636713 GAGAGGGGGCAGTGGGGATTAGG + Intergenic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1117715236 14:58573579-58573601 GTGTGGGGGCGTTGAGAGTAGGG + Intergenic
1117830069 14:59741342-59741364 GAGTGGTGGCGGTGGGGGTGAGG - Intronic
1118748635 14:68791366-68791388 GATTGGGGGTGGTGGGGATGGGG + Intronic
1119276490 14:73361604-73361626 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1119646564 14:76352839-76352861 GCGTGGGGGCGGAGGGAAAGAGG - Intronic
1119826713 14:77662653-77662675 GAGTGGGGGAGAGTGGAATATGG + Intergenic
1120143603 14:80955565-80955587 GAGCGGGAGGGGTGGGAAGAGGG - Exonic
1120249753 14:82048951-82048973 GAATGGGGGCAGGGGGAATCTGG + Intergenic
1120881740 14:89419003-89419025 GACTGGGGCCGGTGAAAATAAGG - Intronic
1121105234 14:91275026-91275048 GTGGGGGCGCGGTGGGCATACGG + Intronic
1121176165 14:91892319-91892341 GATTGGGGGAGGTGGGGATAAGG - Intronic
1121791508 14:96702880-96702902 GAGTGGGGGCGGGGTGAAGGGGG + Intergenic
1122360202 14:101154996-101155018 GTGTGGGGGCAGGGGGTATATGG - Intergenic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1122903854 14:104793055-104793077 GGCTGGGGGAGGTGGGAATGGGG - Exonic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1126251180 15:46570090-46570112 GAGGGGTGGGGGTGGAAATAAGG - Intergenic
1126357506 15:47812020-47812042 GTGTGGGGGCGGGGGGTATTAGG - Intergenic
1126613039 15:50549093-50549115 GAGTGGGGTGGGGGGGAATGGGG - Intergenic
1127065337 15:55231569-55231591 GAGTGAGGGGGATGGGAATAGGG - Intronic
1127320000 15:57834690-57834712 GAGTGGGGGCGGGGGGAAGCTGG + Intergenic
1129599789 15:76992034-76992056 GGGTGGGGCTGGTGTGAATAGGG + Intergenic
1129758225 15:78111499-78111521 GGGTGGGTGTGGTGGAAATAGGG - Intronic
1130062745 15:80581314-80581336 GAGAGGGGGCTGTAGGAAGAGGG - Exonic
1130281999 15:82526145-82526167 GAGGGAGGGGGGTGGGAATCTGG - Intergenic
1130421777 15:83755415-83755437 GACTGGGGGAGGAGAGAATAGGG - Intronic
1130473366 15:84242308-84242330 GAGGGAGGGGGGTGGGAATCTGG - Intronic
1130480780 15:84356372-84356394 GAGGGAGGGGGGTGGGAATCTGG - Intergenic
1130490932 15:84431387-84431409 GAGGGAGGGGGGTGGGAATCTGG + Intergenic
1130502516 15:84510186-84510208 GAGGGAGGGGGGTGGGAATCTGG + Intergenic
1131170539 15:90174984-90175006 GAGGGGGGGCGGGGGGGACAGGG + Intronic
1131224067 15:90609324-90609346 GAGTGGGGTGTGTGGGAAGAGGG + Intronic
1132022555 15:98375425-98375447 GGTCGGGGGGGGTGGGAATAAGG + Intergenic
1132279698 15:100602487-100602509 GGGTGGGGGTGGAGGGAGTAGGG - Intronic
1132341754 15:101083166-101083188 GAGGAGGGGAGGTGGGAATCAGG + Intergenic
1133220867 16:4318668-4318690 GAGTGGGGGCCTTGGAAATGGGG - Intronic
1133744375 16:8675495-8675517 GATTGGGAGCGGTGGGAGGATGG - Intronic
1133998574 16:10765663-10765685 GTGTGAGGGAGGTGGGAAGATGG - Intronic
1134578802 16:15354329-15354351 GAGTGGGGGCGGGGGGGTAAGGG + Intergenic
1134608984 16:15592885-15592907 GGGGGGGGGCGGGGGGAAAAGGG - Intronic
1134624623 16:15714799-15714821 GAGTGGCGGCTGTGGGCACAAGG + Intronic
1134723785 16:16403218-16403240 GAGTGGGGGCGGGGGGGTAAGGG - Intergenic
1134943644 16:18308652-18308674 GAGTGGGGGCGGGGGGGTAAGGG + Intergenic
1135070497 16:19347555-19347577 GCTTGGGGGAGGGGGGAATAGGG - Intergenic
1136043638 16:27599394-27599416 GGGTGGGGAAGGTGGGAATGAGG + Intronic
1136453401 16:30367524-30367546 GAGTGGGGGCAGTGGGTATCAGG + Intronic
1136554804 16:31001450-31001472 GAGGCTGGGCGGTGGGACTAGGG + Intronic
1136736652 16:32473458-32473480 GAGGGTGGCTGGTGGGAATAGGG - Intergenic
1137018458 16:35398572-35398594 GAGTTGGGGTGGTGGGGATATGG + Intergenic
1137506906 16:49062010-49062032 GAGTGGGGAGGGTGGGAGGAGGG - Intergenic
1138391923 16:56676389-56676411 GTGGGGGGGCGCTGGGAAGATGG - Intronic
1138418882 16:56886643-56886665 GAGTGGGGGCCGAGGGGATGCGG + Intronic
1138489346 16:57367052-57367074 GGGTGGGGGTGGTGAGAATGGGG - Intergenic
1138540466 16:57684486-57684508 GAGTGGCGGCTGTGGGAGCAGGG + Intronic
1140122660 16:72096904-72096926 GAGCGGGAGCGGCGGGAACATGG + Exonic
1140151449 16:72371585-72371607 GAGTGGGGGCTGTCGGGAGAGGG - Intergenic
1141882182 16:86867413-86867435 GAGTGGGAGCAGTGGAAATGAGG - Intergenic
1142270747 16:89088211-89088233 GAGTGGTGGTGGTGGGAGGAAGG - Intergenic
1203016416 16_KI270728v1_random:356119-356141 GAGGGTGGCTGGTGGGAATAGGG + Intergenic
1203034751 16_KI270728v1_random:629277-629299 GAGGGTGGCTGGTGGGAATAGGG + Intergenic
1143926604 17:10376720-10376742 GGGTGGGGTCGGGGGTAATACGG + Intergenic
1144669086 17:17121803-17121825 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1144673822 17:17148183-17148205 GAGTGTGGGCGGTGGGCCTCTGG + Intronic
1145898277 17:28473539-28473561 GAGTTGGGGAGGTGAGAGTAAGG - Exonic
1146759664 17:35466050-35466072 GAGTGCGGGCAGTGGGTATATGG - Intronic
1146790964 17:35750322-35750344 GAGTGGAGGCGGGGAGAAAAGGG + Intronic
1146799491 17:35807249-35807271 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1147115585 17:38297005-38297027 GAGTGGGGGAGGGTGGAGTAAGG - Exonic
1147575480 17:41596462-41596484 GGGTGGAGGCTGTGGGAATAGGG + Intergenic
1147612361 17:41809557-41809579 GTCTAGGGGTGGTGGGAATATGG - Intronic
1147904888 17:43816335-43816357 GAGTGTGAGCAGTGTGAATAGGG + Intronic
1148086528 17:44996926-44996948 GAGAGGGGATGGTGGGAACACGG + Intergenic
1148414097 17:47492616-47492638 GAGTGGGGGAGGGTGGAGTAAGG + Intergenic
1148754493 17:49965605-49965627 GAGTTGGGGGGGAGGGGATACGG - Intergenic
1149101562 17:52912476-52912498 GAGTTGGGAGGGTGGGAAGAGGG + Intergenic
1149335071 17:55627153-55627175 GAGTCAGGGCAGTGGGACTAGGG + Intergenic
1150382639 17:64732797-64732819 GAGGGGACGCGGTTGGAATAAGG + Intergenic
1150410473 17:64937250-64937272 GAGTGGTGGGGGTGGGGAGAAGG + Intergenic
1150604685 17:66680792-66680814 GGGTGGGGGAGGTGGGAAAGGGG + Intronic
1150899785 17:69259547-69259569 GACTGGGAGCTATGGGAATAGGG + Intronic
1151159120 17:72150119-72150141 GGGTGGGGGCAGGGGGAACAGGG + Intergenic
1151185741 17:72362724-72362746 GAGTAGGGGGGGTGGGAATGGGG + Intergenic
1151223145 17:72628377-72628399 CAGTGGGGGTGGTGGGAGCAGGG + Intergenic
1152879274 17:82806225-82806247 GAGGCGAGGCGGTGGGAAAAAGG - Intronic
1152992756 18:377872-377894 GAGTGGGGCTGGGGGAAATAGGG + Intronic
1155627752 18:27854280-27854302 GAGAGTGGGGGGTGGGAAGAGGG - Intergenic
1156337322 18:36183353-36183375 CAGTGGGGGAGGTGGGAGTGGGG - Intergenic
1157167810 18:45374531-45374553 GAGAGGTGGGGGTGGGAGTAGGG - Intronic
1157325086 18:46663206-46663228 GAGTGGGGTTGGTGGAAATGGGG - Intergenic
1157503915 18:48212580-48212602 GAATGGGGGCAGGGGGTATAAGG + Intronic
1157778809 18:50419570-50419592 GAGTAGGGAGGGTGGGAAGAGGG - Intergenic
1158162355 18:54499540-54499562 GAGTAGGGATGGGGGGAATAGGG + Intergenic
1158702633 18:59762403-59762425 GTGTTGGGGCAGGGGGAATATGG + Intergenic
1159027730 18:63201357-63201379 TATTAGGGGCGGTGGGAAAAGGG - Intronic
1161597154 19:5156400-5156422 GAGTCGGGGCGGTGGCCACAGGG - Intergenic
1161740427 19:6017913-6017935 GAGTTGGGGGGGTGGGGATGGGG - Intronic
1162575836 19:11498239-11498261 AGTTGGGAGCGGTGGGAATATGG - Intronic
1162729032 19:12706535-12706557 GAGTGGGGGCTGTGGGATCAGGG + Intronic
1162917106 19:13880563-13880585 GAGTGGGGGCAGTCGTCATAGGG - Intronic
1163376395 19:16934972-16934994 GGCTGGGGGAGGAGGGAATAGGG - Intronic
1163390440 19:17027084-17027106 GAGTGGGGGCGGTGGGGGGTCGG - Intergenic
1163492213 19:17623572-17623594 CGGTGGGGGAGGGGGGAATAAGG + Intronic
1163566549 19:18055216-18055238 GAGGAGGGGAGGTGGGAAGAGGG + Intergenic
1163807217 19:19406354-19406376 GGGTGGAGGCGGCGGGAAGACGG + Intronic
1164524140 19:29001096-29001118 GGGTGGGGGAGGTGGGGAGAGGG + Intergenic
1164823495 19:31267536-31267558 GAGTGGGGGCAGGGGAAAGAAGG - Intergenic
1164883179 19:31753423-31753445 GGCTGGGGAAGGTGGGAATAGGG + Intergenic
1164996028 19:32720660-32720682 GAGTGGGGGCGGTGGGAATAAGG - Intronic
1165245589 19:34496718-34496740 GAGTGAGGGCAGGGGGAAGAGGG + Intronic
1165582117 19:36875362-36875384 GAGTAGGGGCAGTGGATATAGGG + Intronic
1165792819 19:38502324-38502346 GGGTGGGGGCTGTGGGCATAGGG + Intronic
1166034009 19:40154194-40154216 GGGTGGGTGAGGTGGGAATGGGG + Intergenic
1166301746 19:41915119-41915141 GGGTGGGGGCGGGGGGAGGAAGG - Intronic
1166364815 19:42273018-42273040 GGGTGGGGGCAGTGGGAGCAGGG - Intronic
1166626953 19:44366638-44366660 AAGTGGGGGTGGGGGGAATGGGG - Intronic
1168061910 19:53898003-53898025 GCTTGGGGTCGGTGGGACTAGGG - Exonic
1168241631 19:55091834-55091856 GAGTAGGGGCAGTGGGGATGGGG - Intronic
1168352453 19:55684450-55684472 TAGTGGGGGCGGGGGGACCAAGG - Intronic
1168411194 19:56141387-56141409 GGGTGGGGGCGGTTGGACGAGGG + Intronic
1202713288 1_KI270714v1_random:28766-28788 GGGTGGGGGTGGTGGGGGTATGG + Intergenic
925894982 2:8464103-8464125 AAGTGGGGGCTGTGGGGCTAAGG - Intergenic
925937956 2:8785507-8785529 GTGTGGGGGAAGTGGGTATATGG + Intronic
926854770 2:17242939-17242961 GAGTGGGGAAAGTGGGAAGAAGG - Intergenic
926904626 2:17794392-17794414 GAGTGGGGGCGGGGAGACTGCGG - Intronic
927633276 2:24793018-24793040 GAGTGGGTGCGGCGGGAGTTGGG - Intronic
928372429 2:30750305-30750327 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
929434119 2:41914252-41914274 GAGTGAGAGCGGTGGAAAGAGGG - Intergenic
929750320 2:44705265-44705287 GAGAGGGAGAGGTGGGAAGAGGG - Intronic
930191745 2:48466764-48466786 GAGTGTGGGGGTTGGGAACAGGG + Intronic
930418632 2:51121231-51121253 GAGTGGGGGCCGTGGGCATTTGG - Intergenic
930612869 2:53562760-53562782 GAGGTGGGGAGGTGGGAAGATGG + Intronic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931665313 2:64606312-64606334 AAGCAGGGGCGGTGGGAATCTGG + Intergenic
931696691 2:64876286-64876308 GAGGGAGGGGGTTGGGAATAGGG + Intergenic
932222583 2:70011114-70011136 GGGTGGGGGGTGTGGGAAAAGGG + Intergenic
932418352 2:71586944-71586966 GGGTGGGAGCAGTGGGAGTAGGG - Intronic
932524288 2:72446620-72446642 GAGTGGGGAGAGTGGGAAGAAGG + Intronic
933213903 2:79604259-79604281 GAGTAAGGGAGGTGGGAAGATGG + Intronic
933532228 2:83525217-83525239 AAGTGGGGAGGGTGGGAATAGGG + Intergenic
934308810 2:91845373-91845395 GAGGGTGGCTGGTGGGAATAGGG + Intergenic
934516724 2:94993108-94993130 GAGTGGTGACGCTGGCAATATGG - Intergenic
934992135 2:98929337-98929359 GAGTAGGTGCGGTGGGCACAGGG - Intronic
935315026 2:101824118-101824140 GGGTGGGGGCGGGGGAAAGAGGG + Intronic
935764533 2:106352778-106352800 GAGTGGGGTGGGGAGGAATAGGG + Intergenic
935930720 2:108121871-108121893 GAGAGAGGGGGTTGGGAATAAGG - Intergenic
935949544 2:108316343-108316365 GAGTGGGAGAGGTGGGAAGAAGG - Intergenic
937087501 2:119181196-119181218 GTGTTGTGGGGGTGGGAATATGG - Intergenic
937190202 2:120088433-120088455 GAGTGGGGAGGGTGGGAAGAGGG + Intronic
937335999 2:121062703-121062725 GAGGGGCGGCAGTGGGAGTAGGG - Intergenic
938163847 2:129009423-129009445 GAGTGGAGCAGGTGGGAAGAAGG + Intergenic
938876024 2:135531907-135531929 GGGTGGGGGCGGTGGGCACAAGG - Intronic
939079916 2:137647441-137647463 GAGTGGGGGCGGGGGGGTTGGGG - Intronic
940365460 2:152843780-152843802 CAGTTGGGGCAGTGGGTATATGG + Intergenic
941541396 2:166790142-166790164 GAGGGGGGAAGGTGGGAAGAGGG - Intergenic
941911772 2:170771012-170771034 GGGTGGGGGCTGGGGGAATTGGG - Intergenic
943081269 2:183261322-183261344 GAGTGGAGAAAGTGGGAATAGGG + Intergenic
946049283 2:216848500-216848522 GAGGGGTGGTGGTGGTAATATGG + Intergenic
946339571 2:219059031-219059053 GAGAGGGGGCGGTGGCAGTGAGG - Intronic
947544706 2:231002645-231002667 AAGTGGGGGTGGTGGGAAGCTGG - Intronic
947695507 2:232183997-232184019 GAAAGGGGGATGTGGGAATATGG + Intronic
948266309 2:236637682-236637704 GTGTGGGGGCAGGGGGAAGATGG - Intergenic
948436266 2:237956232-237956254 GAGTGGGGGCGGAGCCAAGAAGG + Intergenic
1168778057 20:464574-464596 GAGTTGTGGTGGTGGGAATGGGG - Intergenic
1170184981 20:13578978-13579000 GAGTGGGGTCAATGGGATTATGG + Intronic
1170587485 20:17745696-17745718 GGGTGGGGGCAGGGGGAATGAGG + Intergenic
1171779097 20:29402529-29402551 GAGGGGGGAAGGTGGGAAGAGGG + Intergenic
1171869371 20:30513372-30513394 GAGGGGTGGCGGTGGCTATACGG - Intergenic
1171958730 20:31478180-31478202 GGGTGGGAGGGGTGGGAAGAGGG - Intronic
1172066423 20:32223813-32223835 GGGTGGGGGAGATGGGAGTAAGG + Intronic
1172702575 20:36862481-36862503 GAGAGGGGGCGGGGGGAATGAGG + Intronic
1173707928 20:45126652-45126674 GTCTGGGGGTGGGGGGAATAGGG - Intergenic
1173766139 20:45611278-45611300 GAGTGGGGGTGGTGGGAGGCGGG + Intronic
1173822411 20:46028265-46028287 GAGTGGGGGAGGGCGGAATGAGG - Intronic
1174387946 20:50198092-50198114 GAGTGGGGGAGGGAAGAATATGG + Intergenic
1174590455 20:51640757-51640779 GAGTGGGGGCTGTGGCAAGCAGG + Intronic
1175889678 20:62310635-62310657 GAGTGGGGGCTGGGGCAAGATGG + Intronic
1179315647 21:40241996-40242018 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1180019320 21:45111365-45111387 GTGTGGGGGCAGGGGGCATACGG - Intronic
1180081644 21:45490097-45490119 GAGTGGGGGAGGGGGGAGTCAGG - Intronic
1180154572 21:45971750-45971772 GAGAGGGTGCGGTGGGAACGCGG - Intergenic
1180244936 21:46540559-46540581 GAGTGGGGCAGGTGAGAAGAGGG - Intronic
1180742674 22:18064676-18064698 GGGTGGCAGAGGTGGGAATAAGG + Intergenic
1181686582 22:24533343-24533365 GAGTGGAGTCTATGGGAATAGGG + Intergenic
1182715068 22:32351725-32351747 GGGTGGGGGCGGTGGGGGGAGGG + Intergenic
1182808216 22:33093749-33093771 GTGTGGGGGCGGTGGGATGGAGG + Intergenic
1183922312 22:41178663-41178685 GAGTGGGGGGGCTGGGACTGTGG - Exonic
1183980569 22:41537459-41537481 GAGAGGGAGCAGTGGGAACAGGG + Intronic
1185022334 22:48384620-48384642 GTGTGGGGGCAGGGGGTATATGG + Intergenic
949607349 3:5668289-5668311 GAGAGGGGAGGGTGGGAAGAGGG + Intergenic
949634771 3:5970618-5970640 GAGTGGGGGAGAAGGGAAGAAGG - Intergenic
949636504 3:5987857-5987879 GAGTGGTGACAGTGGGAAAAAGG - Intergenic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950896445 3:16455960-16455982 GGGTGGGGGCGGTGGGAGGGAGG - Intronic
951481550 3:23167257-23167279 TAGTGGGGGCTGTGGGAGTCAGG - Intergenic
952278514 3:31901397-31901419 AAGTGGGGGCATTGGGAAGATGG - Intronic
952619816 3:35324215-35324237 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
952621000 3:35342389-35342411 AAGTGGGGGAGGGGGGAAGAAGG + Intergenic
953390326 3:42530143-42530165 GAGTGGGTGGGGTGGGAGTGTGG + Intronic
953824956 3:46243609-46243631 AAGTGAGAGTGGTGGGAATAAGG + Intronic
954287109 3:49626812-49626834 GAGTGAGGTGGGTGGGGATAAGG + Intronic
954388530 3:50257091-50257113 GTGTGGGGACTGTGGGGATAGGG + Intronic
955117638 3:56021714-56021736 GAGTGGGGAAGGTGGGAGGAGGG - Intronic
957078769 3:75620290-75620312 GAGGGGGAGCGGTGGGGAAACGG - Intergenic
957555546 3:81761346-81761368 AAGTGGGGGTGGTGGGATTCCGG + Intronic
957997280 3:87706482-87706504 GAGTGGGAGATGTGGGAAGATGG - Intergenic
958723089 3:97870285-97870307 GAGTGGGGAGGATGGGAAGAGGG - Intronic
958916900 3:100060045-100060067 AAATGGGGGCGGGGGGAAGATGG + Intronic
959006836 3:101029135-101029157 GAGTGTGGAGGGTGGGAAGAGGG - Intergenic
959082863 3:101820872-101820894 GAGTGGGGGAGTTGGGAGGAAGG + Intronic
959300384 3:104591942-104591964 GTGTGGGGGCTGGGGGCATATGG + Intergenic
959779219 3:110207988-110208010 GAGTGTGGGGGGTGGGATGAAGG + Intergenic
959900622 3:111657500-111657522 GGGTGGGGGTGGTGGGAACAAGG + Intronic
960708609 3:120505496-120505518 TAGTGGGGGGGGGGGGAACAAGG - Intergenic
961012145 3:123443520-123443542 GAGGGGTGGGGGTAGGAATATGG - Intronic
962343680 3:134605001-134605023 GGGTGGGGGAGGTGGGGATCAGG - Intronic
962406533 3:135105443-135105465 GAGTGGGGGCTGAGATAATAAGG + Intronic
962883752 3:139603659-139603681 TAGTGGCAGCGGTGGTAATATGG - Intronic
963015198 3:140817269-140817291 CAGTGGGGGCAGGGGGCATATGG + Intergenic
963299912 3:143586154-143586176 GGGTGGGGGCGGGGGAAATGAGG + Intronic
963310683 3:143706993-143707015 GGGTGGGGGCAGTAGGAAGATGG + Intronic
963694750 3:148552270-148552292 TAGTGATGGCGGTGGAAATAAGG + Intergenic
963727655 3:148940049-148940071 GATTGTGGGAGGTGAGAATAAGG - Intergenic
965757727 3:172041521-172041543 GAGGTGGGGCGTTGGGAATGGGG + Intronic
966362862 3:179148628-179148650 TAGCGGGTGCGGTGGGAATGGGG + Intronic
966926135 3:184645739-184645761 GAGTGGAGGCTCTGGGAACAAGG + Intronic
967116483 3:186344590-186344612 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
967118605 3:186363008-186363030 GTGAGGGGTCGGGGGGAATAGGG + Intergenic
967525353 3:190486523-190486545 GTGTGGGGGCAGTGGAAAGAGGG + Intergenic
968360750 3:198145133-198145155 GAGTGGGGGCCATGGGGATTGGG - Intergenic
968587057 4:1423939-1423961 GGGTGGTGGGGGTGGGAGTACGG - Intergenic
968711856 4:2125306-2125328 GAGAGGGGGAGGAGGGTATACGG + Intronic
969021849 4:4144258-4144280 GAGGGGGCGCGGTGGGGAAACGG - Intergenic
969732018 4:8963157-8963179 GAGGGGGCGCGGTGGGGAAACGG + Intergenic
970158439 4:13165190-13165212 CAGTGGGGGAGGTCAGAATAAGG - Intergenic
973088501 4:46100321-46100343 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
975194231 4:71504871-71504893 GGGAGGGGGAGGTGGGAAGAGGG - Intronic
975317034 4:72965969-72965991 GGGTGGGGGCGGTGAGAGAAAGG + Intergenic
976382062 4:84410737-84410759 GAGTGGGGGCAGTGTCACTATGG + Intergenic
977592623 4:98843111-98843133 TGGTGGGGGCGGGGGGAAAAAGG - Intergenic
978049016 4:104172096-104172118 GAGTGGGGAGAGTGGGAAGAGGG - Intergenic
979928175 4:126594254-126594276 GAGTGAGGGCAGAGGGTATATGG + Intergenic
981509866 4:145544197-145544219 GTGTGGGGGTGGGGGGCATATGG + Intronic
981837988 4:149077835-149077857 GAGTGGGGGTGGGGGGAGGAGGG - Intergenic
982125611 4:152181635-152181657 GTGTGGGGGCAGGGGGTATATGG - Intergenic
983158813 4:164384300-164384322 GGGTGGGCGCGGTGGGGATGGGG + Intergenic
984070775 4:175109499-175109521 GAGAGGGGGAGATGGGAATTGGG - Intergenic
985137477 4:186801746-186801768 GAGTGGGGGTGGTGGGAGAGAGG + Intergenic
985668523 5:1194381-1194403 GAGGGTGGGCGGTGGGAGGAGGG - Intergenic
985706791 5:1406135-1406157 GAGTGGGGGCAGTGGGCAGACGG + Intronic
985990915 5:3560571-3560593 GAGTGGAGGCTCTGGGAAGATGG - Intergenic
987083599 5:14448343-14448365 GGGCGGGGGCTGGGGGAATATGG + Intronic
987137149 5:14910957-14910979 GAGTGGGGGTTATGGGAATTTGG + Intergenic
987702985 5:21425960-21425982 GAGTGGGGAGGGTGGGAGGAAGG - Intergenic
989239561 5:39188493-39188515 GAGTGGGGGCAGTGGGGCTACGG - Intronic
990167597 5:53011743-53011765 GAGTGAGGGGAGTGGTAATAAGG + Intronic
991149848 5:63355076-63355098 GTGTGGAGGCAGTGGGTATATGG - Intergenic
991459624 5:66844195-66844217 GTGTTGGGGCGGGGGGATTATGG + Intronic
991927502 5:71719516-71719538 GAGTGGGGGTGGGGGGAGGAGGG - Intronic
993060787 5:83036443-83036465 GAGTGGGGGCGGGGGCAGGAAGG + Intergenic
994618865 5:102138796-102138818 GAGTGGGGAGGGTGGGAGAAGGG - Intergenic
994682066 5:102900256-102900278 GGGGGGGGGCGGGGGGAAGAGGG + Intronic
995314222 5:110749498-110749520 GTGTGGGAGCGGTGGGAAGGGGG + Intronic
996584412 5:125068661-125068683 GTGTGGGGGCAGTGCGTATATGG + Intergenic
996698638 5:126425862-126425884 GGGTGGGGAAGGAGGGAATAGGG + Intronic
997215157 5:132103924-132103946 GGGTGGGGGGGGTGGGGAAAGGG - Intergenic
997428232 5:133819041-133819063 GTGTGTGGGCGGTGGGCATGTGG - Intergenic
998470880 5:142382820-142382842 GAGTGGAGGAGGTAGGAAAAGGG - Intergenic
999147067 5:149403473-149403495 GTATGTGGGAGGTGGGAATATGG - Intronic
999239863 5:150121158-150121180 GAGTGGGGGCTGTGGGGAGGTGG - Intronic
1000150376 5:158494643-158494665 GACTGGGGGCTGTGGGTGTAAGG + Intergenic
1001064182 5:168522711-168522733 CAGTGGGGGGGGTGGGATTGGGG - Intergenic
1001075590 5:168625392-168625414 GAGAGGGGGAGATGGGAAGATGG - Intergenic
1001636792 5:173216154-173216176 GAATGTGGGGGATGGGAATATGG - Intergenic
1003546488 6:7063779-7063801 GACTGGGGGAAGGGGGAATAGGG - Intergenic
1008466979 6:51842257-51842279 GAGTGGGGGCTGTGTGAACTCGG + Intronic
1008739482 6:54588311-54588333 GAGTGGGGGCAGTGGGATATAGG - Intergenic
1010352636 6:74893081-74893103 GAATTGGGGCTGTGGTAATAGGG + Intergenic
1010811141 6:80300078-80300100 CAGTCTGGGCAGTGGGAATATGG - Intronic
1011394435 6:86891462-86891484 GGGTGGGGGCTGGGGGAAGAGGG + Intergenic
1012156509 6:95825762-95825784 GAGTGTGGGAGGTGGGAGGAGGG + Intergenic
1013118397 6:107120467-107120489 GAGAGGGTGAGGTGGGAAGATGG - Intergenic
1013373915 6:109495848-109495870 GAGAGGGAGCGGTGGGACCAAGG - Intronic
1015067821 6:129052531-129052553 GTGTTGGGGCGGGGGAAATATGG - Intronic
1016347588 6:143130865-143130887 GAGGGGTGGAGGTGGGAAGAGGG - Intronic
1017835499 6:158173794-158173816 GAGTGGGGAGGGTGGGAAGCAGG + Intronic
1018108568 6:160513105-160513127 GAGTGGGGAAAGGGGGAATAGGG - Intergenic
1018329239 6:162709898-162709920 GGGTGTGGTGGGTGGGAATAAGG + Intronic
1018341453 6:162855718-162855740 GAGTTGGGGCGCTGGGAAGCTGG - Intronic
1019329493 7:455614-455636 GCGTGGGGGCGGGGGGCAGAGGG - Intergenic
1019597470 7:1864781-1864803 GAGTGGGGGCGGGGGGCACCAGG - Intronic
1020309270 7:6856288-6856310 GAGGGGGCGCGGTGGGGAAACGG - Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021734149 7:23626649-23626671 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1021761226 7:23904756-23904778 GCGTGGGGGCGGGGGGATTGGGG + Intergenic
1022310787 7:29194437-29194459 GAGTTGGGGCGGAGGGAGAAGGG + Exonic
1024003550 7:45208612-45208634 GAGAGGGGGAGTTGAGAATACGG - Intergenic
1024930273 7:54661597-54661619 GAGTGGGGCCGGTGGGTGTCGGG - Intergenic
1027053151 7:75032219-75032241 GAGTGGGGACGGTGGGGGGAAGG + Intronic
1029933301 7:104396457-104396479 GAGTGGGGCCAGTGAGGATAGGG + Intronic
1032928507 7:136637900-136637922 GAATGTGGGTGGTGGGAAGAGGG - Intergenic
1033060008 7:138097106-138097128 GAGGTGGGGTGGTGGGAATGAGG - Intronic
1033213449 7:139477574-139477596 GATTGGGGGCGGGGGAAATGGGG + Intronic
1033622465 7:143074580-143074602 GAGTGATGGGGGTGGGAGTAGGG - Intergenic
1034264494 7:149774278-149774300 GAGTGGGCGCAGCGGGAACAAGG - Intergenic
1034381978 7:150705150-150705172 GAGTGGGGAGGGTGGGAAGGGGG + Intergenic
1034649180 7:152675999-152676021 GAGTGAGGGAGATGGGAACAAGG - Intronic
1034968784 7:155407042-155407064 GAGTGTGGGCTGTGGGAGTGTGG + Intergenic
1034968808 7:155407117-155407139 GAGTGTGGGCTGTGGGAGTGTGG + Intergenic
1034968843 7:155407241-155407263 GAGTGTGGGCTGTGGGAGTGTGG + Intergenic
1035074390 7:156168820-156168842 GGGGGGGGGCGGGGGGAATGGGG + Intergenic
1035080315 7:156210258-156210280 AAGTGGGGGCTGAGGGAAAATGG + Intergenic
1037848196 8:22303494-22303516 GACTGAGGGAGGTGGGAAGACGG - Intronic
1039183247 8:34889810-34889832 GAGTTAGGGCAGTGGGAATTGGG + Intergenic
1039749703 8:40466081-40466103 GAGTGCGGGCTTTGGAAATAAGG - Intergenic
1039808942 8:41027646-41027668 CAGTGGGGGCAGAGGGAATCTGG - Intergenic
1040572533 8:48623392-48623414 GAGTGTGGGCTGGAGGAATAGGG + Intergenic
1041106870 8:54453467-54453489 GAGAGGTGGCGTTGGGAATGAGG - Intergenic
1041167645 8:55105354-55105376 GAGTGGGGGCGGGGAGAGAAGGG + Intronic
1041620632 8:59963986-59964008 TAGTGGTGGGGATGGGAATATGG + Intergenic
1041749702 8:61246949-61246971 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1041777204 8:61536524-61536546 GAGTGGGGGCTGTTGGCCTAAGG + Intronic
1044902462 8:96962142-96962164 GAATGAGGGCCTTGGGAATAGGG - Intronic
1045127118 8:99104545-99104567 GAGGGGGGACGGTGGGGAGAGGG - Intronic
1045734103 8:105275175-105275197 GAGTGGGGGAGTGGGGAATGGGG - Intronic
1046166405 8:110442145-110442167 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
1046432161 8:114142525-114142547 GAGTGGGGAGAGTGGGAGTAGGG - Intergenic
1047205914 8:122802928-122802950 GAGTGGGGGCAGTGGGATGCAGG - Intronic
1047446721 8:124926686-124926708 GAGCGGGGGCGGTGGTGAGAAGG + Intergenic
1047493228 8:125390917-125390939 GAGTGGGGTCGGTGGGGGTGGGG - Intergenic
1048883879 8:138892862-138892884 GGGTGGGGGCTGGGGGAATGAGG + Intronic
1049368339 8:142251675-142251697 GAACGCGGGCGGTGGGTATATGG - Intronic
1049411762 8:142476708-142476730 GAGGGGGGTGGGTGGGACTAGGG + Intronic
1051370516 9:16355282-16355304 GAGTGTGGGAGGTGGCAAGAGGG - Intergenic
1052014253 9:23446676-23446698 AGGTGGGGGCGGTGGGAAATTGG + Intergenic
1052151906 9:25127424-25127446 GAGTGGGGAGGATGGGAAGAGGG + Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1053522190 9:38791491-38791513 GTGTGGAGGGGGTGGGAAGAAGG - Intergenic
1053613984 9:39744945-39744967 GGTTGGGGGCGGTGGGGAGAGGG - Intergenic
1054239532 9:62597448-62597470 GGCTGGGGGCGGTGGGGAGAGGG + Intergenic
1054553664 9:66631975-66631997 GGTTGGGGGCGGTGGGGAGAGGG + Intergenic
1056241138 9:84647635-84647657 GAGTGGGGACTGTGGGCATTTGG + Intergenic
1059371092 9:113836973-113836995 GAGTGTGGGGGATGGGAAGAGGG - Intergenic
1059858875 9:118434626-118434648 GGATGGGGGCAATGGGAATAAGG - Intergenic
1060254397 9:122014473-122014495 GAGTGGGGAAGGTGGGAAGGTGG - Intronic
1060277722 9:122194472-122194494 GAGTGGAGGCGGTTAGATTAGGG + Intronic
1060407945 9:123381969-123381991 GAGTGGTGGCTGTGGGAATGGGG + Exonic
1060558910 9:124526754-124526776 GAGTGGCTGGGGTGGGAAAAGGG - Intronic
1061148589 9:128815874-128815896 GAGTTGGGGCGGTGGGGAATGGG + Intergenic
1061644266 9:131987426-131987448 GAGGGGGAGCGGTGGGAATGTGG + Intronic
1062745453 9:138208964-138208986 GAGTGGGGGCCATGGGGATTGGG - Intergenic
1185532858 X:835542-835564 GAGTGTGGACGGTGGGAGGAGGG - Intergenic
1185835048 X:3337830-3337852 GAGTGGTGGGAGTGGGAATGAGG + Intronic
1186121990 X:6373316-6373338 GAGGGTGGGAGGTGGGAAGAGGG + Intergenic
1186603698 X:11066233-11066255 GAGAGGGGAGGGAGGGAATAGGG - Intergenic
1188574903 X:31636190-31636212 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1188689025 X:33106280-33106302 AAGTGGAGGGGGTGGGAATGAGG + Intronic
1189036183 X:37495709-37495731 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1189037691 X:37509251-37509273 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1189532192 X:41896923-41896945 TAGTGGGGGAGGAGGGAGTAGGG - Intronic
1190444017 X:50504933-50504955 GAGTGGAGGAGGAGGGAAAAGGG - Intergenic
1190862889 X:54360196-54360218 GTGTGGCAGTGGTGGGAATAGGG - Intergenic
1192373425 X:70534923-70534945 GGCTGGGGGCAGGGGGAATATGG - Intronic
1193490500 X:82143253-82143275 GAGTGGGGGAGGTGGCGATGGGG - Intergenic
1193913025 X:87328277-87328299 GAGTGTTGGGGGTGGGAAAATGG - Intergenic
1195212149 X:102660415-102660437 GGGTGGGAGAGGTGGGCATATGG + Intergenic
1195218191 X:102721188-102721210 GGGTGGGGGAGGTGGGCATATGG + Intronic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1196604985 X:117646735-117646757 GGGTGGGGGTGGGGGGAGTATGG - Intergenic
1196866805 X:120077844-120077866 GTGTGGGGGAGGGGGGAGTAGGG + Intergenic
1196876294 X:120158437-120158459 GTGTGGGGGAGGGGGGAGTAGGG - Intergenic
1196886602 X:120251453-120251475 GAGTGAGGGCGGGAGGAATATGG - Intronic
1198107033 X:133471628-133471650 GAGAGTGGAGGGTGGGAATAGGG - Intergenic
1198494680 X:137179854-137179876 GAGTTGTGGCAGTGGCAATAGGG - Intergenic
1198934800 X:141894984-141895006 GAGTGGGAGTGGTGGGAATATGG + Intronic
1200112058 X:153745337-153745359 GAGGGTGGCTGGTGGGAATAGGG + Intergenic