ID: 1164996137

View in Genome Browser
Species Human (GRCh38)
Location 19:32720972-32720994
Sequence CAAGCGACACTGGCGTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164996132_1164996137 -1 Left 1164996132 19:32720950-32720972 CCGAATGCTCGATCACCCGGGCC No data
Right 1164996137 19:32720972-32720994 CAAGCGACACTGGCGTCCCCAGG No data
1164996128_1164996137 28 Left 1164996128 19:32720921-32720943 CCTGGAGGAGCGCGGAATTGGTT No data
Right 1164996137 19:32720972-32720994 CAAGCGACACTGGCGTCCCCAGG No data
1164996129_1164996137 2 Left 1164996129 19:32720947-32720969 CCTCCGAATGCTCGATCACCCGG No data
Right 1164996137 19:32720972-32720994 CAAGCGACACTGGCGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164996137 Original CRISPR CAAGCGACACTGGCGTCCCC AGG Intronic