ID: 1164998843

View in Genome Browser
Species Human (GRCh38)
Location 19:32744203-32744225
Sequence GTATATGGATGAATCTGACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164998836_1164998843 21 Left 1164998836 19:32744159-32744181 CCACTAGGTTGTTTCCAAACCAT 0: 1
1: 0
2: 0
3: 16
4: 156
Right 1164998843 19:32744203-32744225 GTATATGGATGAATCTGACCGGG 0: 1
1: 0
2: 0
3: 7
4: 86
1164998838_1164998843 2 Left 1164998838 19:32744178-32744200 CCATTTGCACAGTACAGTCCCGT 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1164998843 19:32744203-32744225 GTATATGGATGAATCTGACCGGG 0: 1
1: 0
2: 0
3: 7
4: 86
1164998837_1164998843 7 Left 1164998837 19:32744173-32744195 CCAAACCATTTGCACAGTACAGT 0: 1
1: 0
2: 1
3: 13
4: 125
Right 1164998843 19:32744203-32744225 GTATATGGATGAATCTGACCGGG 0: 1
1: 0
2: 0
3: 7
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164998843 Original CRISPR GTATATGGATGAATCTGACC GGG Intronic
901971754 1:12913909-12913931 CGATGTGCATGAATCTGACCTGG + Intronic
902013414 1:13287831-13287853 CGATGTGCATGAATCTGACCTGG - Intergenic
905327102 1:37161335-37161357 GCGTATGGAAGAAGCTGACCAGG - Intergenic
907181391 1:52573319-52573341 GGAGATGGATGAATGTGAGCAGG + Intergenic
908655349 1:66382628-66382650 GTATACAGATGAATCTAGCCGGG + Intergenic
910418640 1:87030489-87030511 GTATATGAATGAATGAGACAGGG - Intronic
916647161 1:166797427-166797449 GTATCTGGATGAATGTGAAGTGG + Intergenic
924333870 1:242967462-242967484 GTTTATGACTGAAACTGACCCGG - Intergenic
924501287 1:244640813-244640835 GTATTTGGATGTATCAGTCCGGG + Intronic
1066005874 10:31145862-31145884 GTATACGGATGAATAAGACATGG + Intergenic
1068021920 10:51595759-51595781 GTGAATAGGTGAATCTGACCTGG - Intronic
1082204299 11:49413425-49413447 TTCTATGTATGAATCTGTCCTGG - Intergenic
1082276558 11:50228512-50228534 GGGTATCTATGAATCTGACCTGG + Intergenic
1083423048 11:62566858-62566880 GGAGATGGATGAATGTGAGCAGG - Exonic
1086528557 11:87757357-87757379 GTATCTGGATAAAGATGACCAGG + Intergenic
1092781843 12:11994859-11994881 GGATTTGGATGTATCAGACCAGG - Intergenic
1094229028 12:28081525-28081547 GTATAAGGATTATTCTGAGCTGG - Intergenic
1104331131 12:127846772-127846794 GAATATGGATGAACCTGACACGG + Intergenic
1117488154 14:56219641-56219663 GTTTATGGATGATTCTTAACTGG + Intronic
1120708923 14:87773130-87773152 GTATCTCGTTGAATCTTACCAGG - Intergenic
1121777829 14:96602468-96602490 GTATATGGAGGCTTCTGAGCTGG + Intergenic
1122628239 14:103095122-103095144 GTATGTGCATGACTCTGCCCTGG - Intergenic
1125156424 15:36591914-36591936 GTGAATGAATGAAGCTGACCTGG + Intronic
1126215770 15:46153064-46153086 GTATATGAATGAATCAAATCAGG + Intergenic
1127612191 15:60647810-60647832 GTATCTGGATGAACGTGACCAGG + Intronic
1127791481 15:62402472-62402494 GTATATGCAAGAATCTGAGCTGG - Intronic
1127961258 15:63892597-63892619 GTTAATGGATGACCCTGACCTGG + Intergenic
1128837971 15:70826608-70826630 GTATATGGATGAAAATTACTGGG + Intergenic
1131028977 15:89170390-89170412 GAAAAAGGATGAATCTGGCCGGG - Intronic
1134653594 16:15929720-15929742 GTATAAGGATGAATATAACAAGG + Intergenic
1145713454 17:26996925-26996947 GTATTTGGATGACTCTGCCTGGG + Intergenic
1151089581 17:71422499-71422521 TTATATTTATGAATCTGTCCTGG - Intergenic
1155171074 18:23267211-23267233 GAATGTGGCTGAATCTTACCAGG - Intronic
1156919860 18:42508518-42508540 GTATAAGGTTGTATCTGCCCTGG - Intergenic
1164998843 19:32744203-32744225 GTATATGGATGAATCTGACCGGG + Intronic
1167671088 19:50854184-50854206 GCATGAGGATGATTCTGACCTGG + Intergenic
927324042 2:21782550-21782572 GTGGATGGATAAATCTGATCAGG - Intergenic
928224678 2:29438311-29438333 GTATATGGAACAAGATGACCTGG - Intronic
928639723 2:33285336-33285358 TTATATAGAAGAATGTGACCCGG - Intronic
929083988 2:38149515-38149537 GCAGATATATGAATCTGACCAGG + Intergenic
931082354 2:58788668-58788690 GTAAAAGAATGAGTCTGACCAGG - Intergenic
939057588 2:137382873-137382895 GTATATGGATGGGTCTAGCCAGG + Intronic
939194059 2:138950702-138950724 TTATATGCATGCATCTGACTCGG - Intergenic
941394983 2:164963118-164963140 ATTTATGGACAAATCTGACCTGG + Intergenic
941655093 2:168134780-168134802 GCATATGAGTGAATCTGTCCTGG + Intronic
944487468 2:200221973-200221995 GTAAATGGATGCATCTGATTTGG - Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
948648347 2:239423134-239423156 GTGTAACGCTGAATCTGACCAGG + Intergenic
1177089226 21:16745767-16745789 GATTATGGTTAAATCTGACCAGG - Intergenic
1184682972 22:46081862-46081884 GAAAATGGAAGAATCAGACCCGG + Intronic
950357270 3:12422231-12422253 GTATGTGGGAGAATCTGTCCTGG + Intronic
953181175 3:40596706-40596728 GGAGATGGATGAATGTGAGCAGG - Intergenic
964143629 3:153432669-153432691 ATATATGGGTTAATCTGGCCTGG + Intergenic
964872188 3:161325418-161325440 GGAGATGGATGAATGTGAGCAGG - Intergenic
967262416 3:187656394-187656416 ATATATGGATGAATATGAATTGG + Intergenic
973180296 4:47259003-47259025 GCATATGGATGGACATGACCTGG - Intronic
973932686 4:55808854-55808876 GCTTATGCATGAATCTGGCCTGG - Intergenic
975162447 4:71139348-71139370 GTAAATGGATGAAGAGGACCAGG - Intergenic
975715990 4:77206280-77206302 GTATATGGATGAGTCTGCCTTGG + Intronic
979774221 4:124567455-124567477 GTGTGTGGAAGAATCTGACAGGG - Intergenic
986385554 5:7230287-7230309 GTATCTGGAAGAAGCTGACCAGG + Intergenic
992217242 5:74538122-74538144 GTATATACAGGAATTTGACCTGG + Intergenic
997214610 5:132100514-132100536 GTAAATGAATGAATTTGACAGGG + Intergenic
998888790 5:146723855-146723877 TTGTATGGATGAATTTGTCCTGG - Intronic
999861669 5:155654399-155654421 CTATGTGGATGAATCTGAAAGGG + Intergenic
1003789198 6:9523931-9523953 TTGTATAGATGAGTCTGACCAGG + Intergenic
1004553357 6:16671778-16671800 GAATATGGTTGAATATGACAAGG + Intronic
1006228127 6:32558100-32558122 GTTTATGGATGTATCTGTTCAGG + Intronic
1010779075 6:79922679-79922701 GTCTGTGAATGAATCTGACAGGG - Intronic
1014000300 6:116357765-116357787 ATATATGCATGAATCTCAACTGG - Intronic
1026192209 7:68139632-68139654 GGGTATCTATGAATCTGACCTGG + Intergenic
1027757340 7:82230930-82230952 CTATAAAGATGAATCTGACTTGG - Intronic
1032551853 7:132791700-132791722 GCATATGGAGGAATTTGCCCTGG - Intronic
1032574183 7:133035116-133035138 GGAGATGGATGAATGTGAGCAGG - Intronic
1034423742 7:151002205-151002227 GTGTATGGATGAGTATGACGTGG + Exonic
1035031305 7:155862930-155862952 GGAAATGGATGTATCTGAGCTGG - Intergenic
1036497872 8:9285869-9285891 TTATATGAATGAATTTCACCAGG + Intergenic
1037426026 8:18755516-18755538 GTCTATGGATGCATCTGAATAGG + Intronic
1037927301 8:22853769-22853791 GTCCATGGATGGTTCTGACCAGG + Intronic
1045039086 8:98203953-98203975 GTACATGCATGTATATGACCTGG - Intronic
1047559296 8:125969159-125969181 GCATCTGGCTGAATCTGACTAGG - Intergenic
1049327598 8:142031488-142031510 GGAGCTGGATGAACCTGACCTGG - Intergenic
1051417993 9:16862876-16862898 ATATATAGATGAATCTGCCGTGG - Intronic
1052131407 9:24852819-24852841 TTATATGGATAAATCAGGCCAGG - Intergenic
1052569360 9:30200279-30200301 GTATATGGATGGGTCTAGCCAGG + Intergenic
1055608889 9:78000725-78000747 GTTTATGGCTGAATCTGAGCAGG - Intronic
1058518970 9:105800917-105800939 GTATATGGAAGAATATCACAGGG + Intergenic
1059578305 9:115516065-115516087 GGATTAGGATGAATCTGACTGGG + Intergenic
1187252046 X:17607415-17607437 GTGGATGGGAGAATCTGACCAGG - Intronic
1194806340 X:98332990-98333012 GTTCATGGATGAATTTAACCAGG + Intergenic
1196439274 X:115703590-115703612 GGAGATGGATGAATGTGAGCAGG + Intergenic
1196642125 X:118074316-118074338 GCATATTTATGAGTCTGACCTGG + Intronic
1198475621 X:136994877-136994899 TTCTATGGAGGAATCTGACAGGG - Intergenic
1199552875 X:149077181-149077203 GTATATGGATGAATCCAGCCAGG + Intergenic