ID: 1165002476

View in Genome Browser
Species Human (GRCh38)
Location 19:32776365-32776387
Sequence CAGCAACAGCAACAGCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 661
Summary {0: 1, 1: 0, 2: 4, 3: 89, 4: 567}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165002476_1165002487 20 Left 1165002476 19:32776365-32776387 CCACACTGCTGTTGCTGTTGCTG 0: 1
1: 0
2: 4
3: 89
4: 567
Right 1165002487 19:32776408-32776430 GCTGGCCTTGGGGCCCGGTGAGG No data
1165002476_1165002482 8 Left 1165002476 19:32776365-32776387 CCACACTGCTGTTGCTGTTGCTG 0: 1
1: 0
2: 4
3: 89
4: 567
Right 1165002482 19:32776396-32776418 CCCAAGATCAGAGCTGGCCTTGG 0: 1
1: 0
2: 7
3: 30
4: 236
1165002476_1165002479 2 Left 1165002476 19:32776365-32776387 CCACACTGCTGTTGCTGTTGCTG 0: 1
1: 0
2: 4
3: 89
4: 567
Right 1165002479 19:32776390-32776412 TGCAGCCCCAAGATCAGAGCTGG 0: 1
1: 0
2: 1
3: 24
4: 259
1165002476_1165002486 15 Left 1165002476 19:32776365-32776387 CCACACTGCTGTTGCTGTTGCTG 0: 1
1: 0
2: 4
3: 89
4: 567
Right 1165002486 19:32776403-32776425 TCAGAGCTGGCCTTGGGGCCCGG 0: 1
1: 0
2: 4
3: 49
4: 547
1165002476_1165002485 10 Left 1165002476 19:32776365-32776387 CCACACTGCTGTTGCTGTTGCTG 0: 1
1: 0
2: 4
3: 89
4: 567
Right 1165002485 19:32776398-32776420 CAAGATCAGAGCTGGCCTTGGGG 0: 1
1: 0
2: 2
3: 26
4: 304
1165002476_1165002484 9 Left 1165002476 19:32776365-32776387 CCACACTGCTGTTGCTGTTGCTG 0: 1
1: 0
2: 4
3: 89
4: 567
Right 1165002484 19:32776397-32776419 CCAAGATCAGAGCTGGCCTTGGG 0: 1
1: 0
2: 1
3: 36
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165002476 Original CRISPR CAGCAACAGCAACAGCAGTG TGG (reversed) Intronic
900237557 1:1599986-1600008 CAGCAGCAGCAGCAGCGGCGGGG + Exonic
901630895 1:10647694-10647716 CAGCAGCACCATCCGCAGTGAGG + Intronic
901780674 1:11592527-11592549 CAACAACAACAACAACAGAGCGG + Intergenic
902088905 1:13886736-13886758 CAGCAACAGCAATAGGAGATTGG - Intergenic
902609949 1:17591179-17591201 CAGCACCATCAGCACCAGTGAGG - Intronic
902644431 1:17788637-17788659 AAGAAACAGCAAGAGGAGTGGGG + Intronic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
904383012 1:30124238-30124260 CAGCAGCATCCACATCAGTGGGG + Intergenic
904863190 1:33555933-33555955 CAGCAACATTAACAGGAGTTTGG + Intronic
904945551 1:34196405-34196427 CATGTACAGCACCAGCAGTGGGG - Intronic
905202555 1:36323811-36323833 CACTAACAGCAACAACAGAGAGG + Exonic
905387112 1:37612792-37612814 CAGCAACAGCAGCAGCAGCAAGG - Exonic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
906209680 1:44005595-44005617 CAGCAACAGCAGCACCAGACGGG + Intronic
906223919 1:44105482-44105504 GAGGGACAGAAACAGCAGTGTGG + Intergenic
906539026 1:46570639-46570661 CAACATCCGCAACAGCAGAGGGG + Intronic
906964084 1:50439613-50439635 CAGGAACAGCAGCAGGGGTGTGG - Exonic
907288353 1:53396512-53396534 CCGCAAGCGCCACAGCAGTGAGG - Intergenic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
907534500 1:55137544-55137566 CTCCAGCAGCAGCAGCAGTGGGG - Exonic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
908854110 1:68405321-68405343 CAGCAGCAGCAGCAGCAATACGG + Intergenic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
910364021 1:86444872-86444894 CAACAACAACAACAAAAGTGGGG - Intronic
911660769 1:100499118-100499140 CAGAAGCAGCAACAGCAACGGGG + Exonic
911729297 1:101276300-101276322 TAGTAACAGCAAAAGAAGTGGGG + Intergenic
912152365 1:106875963-106875985 CAGCAACAGAAACATCTGTTAGG + Intergenic
912174480 1:107140140-107140162 CAGCAACAGCAACAGCGAGCGGG + Intronic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
912716530 1:111987696-111987718 CTGCAACAGGCACAACAGTGCGG + Intronic
912805973 1:112757409-112757431 CAGAACCATTAACAGCAGTGAGG - Intergenic
914406399 1:147378121-147378143 TAACAATAGCAACATCAGTGTGG + Intergenic
915837909 1:159192627-159192649 CAGCATCAGCATCAGCAATGTGG + Exonic
916087084 1:161278809-161278831 CAGCCTCAGCAACAAGAGTGAGG - Intronic
916203626 1:162294960-162294982 CAGCAGCAGCAGCAGTGGTGAGG - Intronic
916584251 1:166136479-166136501 CAGAGACAGCAGCAGCTGTGAGG - Intronic
916875373 1:168963182-168963204 CAGCAACATCAACAACATTTGGG - Intergenic
916885241 1:169060955-169060977 CAGCAGCAACAACAGCAATAGGG + Intergenic
917402007 1:174660181-174660203 CAGGGACAGAAATAGCAGTGGGG + Intronic
918248530 1:182681564-182681586 CGGCCACAGCAACAGCAGCAGGG + Intronic
919398949 1:197084753-197084775 CAGCAACAGCAACATCTATGTGG + Intronic
919436160 1:197563844-197563866 CAGCAACATTAACAGGAGTTTGG + Intronic
919444788 1:197689481-197689503 CAGCACCAGCAGCAACAGTAAGG - Intronic
919477035 1:198041822-198041844 CAGCAACAGCAACACAGGTGTGG + Intergenic
920034453 1:203056811-203056833 CAGCAGCAGCAACAGCAGCCAGG + Exonic
920115710 1:203619652-203619674 CAGCAATAGCAGCAGCAGGCTGG - Intergenic
920600780 1:207321821-207321843 CAGCACCAGCAGCAGCAGCCGGG - Exonic
920798499 1:209163756-209163778 CAGAAACAGCAAAAGTGGTGGGG - Intergenic
920845240 1:209588139-209588161 CAGCACCAGCAAAAGGAGGGTGG + Intronic
920876244 1:209838877-209838899 CAGCAACAGCAGCCTTAGTGGGG - Intronic
921070482 1:211654247-211654269 CAGCCACAGCGACAGCTCTGGGG - Intergenic
921395132 1:214661105-214661127 CAGCAGATTCAACAGCAGTGAGG - Intronic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
922727840 1:227932475-227932497 CAGCAACATGAACAGGAGTTTGG - Intronic
922823311 1:228499603-228499625 CAGCAACATGAACAGGAGTTTGG - Intergenic
922872322 1:228912842-228912864 CAGCAGCAGCAGCAGCTATGTGG - Intergenic
922909815 1:229206089-229206111 CAGCAACAGTGACAGAAGTGTGG - Intergenic
923256583 1:232226640-232226662 CAGCAACAGCAGCAGCAGCCTGG + Intergenic
924302292 1:242652007-242652029 AAGCATCAGCTATAGCAGTGTGG + Intergenic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
1063366660 10:5494830-5494852 CAGAAAAAGGAACAGAAGTGTGG + Intergenic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1064940687 10:20731857-20731879 CAGTACCTGCAACACCAGTGGGG - Intergenic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1067017451 10:42768793-42768815 CAGCAACAACAGCAGCAGAAAGG - Intergenic
1067286583 10:44911736-44911758 GAGCAGCAGCAAGTGCAGTGGGG + Intronic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067724481 10:48759539-48759561 CAGCAACAGCAGCAGCAGCCAGG - Intronic
1068905456 10:62317107-62317129 AAGGAACAGCCCCAGCAGTGGGG - Intergenic
1069900662 10:71704994-71705016 CATCAACAGCAGCAGCGGCGTGG + Intronic
1069916563 10:71790397-71790419 CATCAACAGCAGCACCGGTGAGG + Intronic
1069921388 10:71817883-71817905 CAGCAGCAGAACCAGCTGTGGGG + Intronic
1070081055 10:73188090-73188112 CAACAACAACAAAAACAGTGTGG + Intronic
1071033719 10:81216546-81216568 CAGCAACAGCCTCAGAAGTAAGG - Intergenic
1071432881 10:85619922-85619944 CGGCAACAGCATCAGCAGCAAGG - Exonic
1071691633 10:87826160-87826182 CAGCAACAACAACAACAAAGGGG + Intronic
1072436557 10:95419293-95419315 CAGCAACAGCAAAAGCTTTCAGG + Intronic
1072540170 10:96392529-96392551 CACCAGCAGCACCAGCAGTAAGG + Intronic
1073204739 10:101762917-101762939 CTGCAGCAGCCACAGCACTGTGG - Intergenic
1073676746 10:105655782-105655804 CTGCAACAGCAAAAGCAGAATGG + Intergenic
1073860358 10:107731911-107731933 CAGTAACAGCAACAGGGGTGGGG + Intergenic
1073874919 10:107911817-107911839 CAGCAAAAGGAACAGGAGAGAGG + Intergenic
1074357965 10:112802602-112802624 CAGCAACATCCACTGCAGTGAGG - Intronic
1074769273 10:116722989-116723011 CAGCAAGGGCAAAAGCAGAGCGG + Intronic
1075818107 10:125281969-125281991 AAGCAGCAGCAACAGCCTTGTGG - Intergenic
1075969693 10:126642050-126642072 CAGCAGCAGCTCCATCAGTGGGG - Intronic
1076120413 10:127932582-127932604 CAGCAACAGAGACAGGAGGGTGG + Intronic
1076549717 10:131270619-131270641 CAGCAACGGCAGCAGCCATGCGG - Intronic
1077174680 11:1183455-1183477 CAACAACATCATCAGGAGTGGGG + Intronic
1077174897 11:1184574-1184596 CAACAACATCATCAGGAGTGGGG + Intronic
1077175466 11:1187892-1187914 CAACAACATCATCAGGAGTGGGG + Intronic
1077175624 11:1188786-1188808 CAACAACATCATCAGGAGTGGGG + Intronic
1077175854 11:1190085-1190107 CAACAACATCATCAGGAGTGGGG + Intronic
1077176218 11:1192107-1192129 CAACAACATCATCAGGAGTGGGG + Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078514114 11:12008544-12008566 CAGCAGCAGGCACAGCAGGGTGG + Exonic
1080540201 11:33257672-33257694 CAGCAGCAGCAGCAGCGGTCGGG + Exonic
1080648683 11:34205758-34205780 CAGCAACAGGTACAGCAGACAGG + Intronic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081812823 11:45922917-45922939 CAGCAGCAGCAACAGCGCGGCGG - Exonic
1081812824 11:45922920-45922942 CAGCAGCAGCAGCAACAGCGCGG - Exonic
1081816730 11:45948840-45948862 AAGCAAAAGCAACAGCAGCAAGG + Intronic
1083564888 11:63705488-63705510 CACCAACAGCAACAAAATTGTGG + Intronic
1084222853 11:67695248-67695270 AAGCAACACCAGCTGCAGTGAGG + Intergenic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1085117210 11:73940111-73940133 CAGTAGTAGTAACAGCAGTGAGG + Intergenic
1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG + Intronic
1085282613 11:75340918-75340940 CAGGGCCAGCAGCAGCAGTGTGG - Intronic
1085334488 11:75680814-75680836 CAGCCATAGCAAAAGCACTGAGG - Intergenic
1085450711 11:76630416-76630438 CAGGAACAGCAAATGCAGAGAGG - Intergenic
1086550430 11:88046831-88046853 AAGCAACAGAAAGAGGAGTGGGG - Intergenic
1086847379 11:91768313-91768335 CAGCAAAACTAACAGGAGTGAGG + Intergenic
1086917253 11:92545117-92545139 CAGGAACAGCAACAGCCTTGGGG - Intronic
1086980079 11:93186939-93186961 CAGCAACATCAGCAGCACTGGGG - Intronic
1087144649 11:94799803-94799825 CAGCAGCAGCAACAGCAGCAGGG + Exonic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1087448829 11:98291616-98291638 CAGCAATAGCAGCAGTAGTTTGG + Intergenic
1087546809 11:99594717-99594739 CAGCACCATTAACAGCGGTGTGG - Intronic
1088478913 11:110273769-110273791 CAGAAACAGCAAATGAAGTGTGG - Intronic
1088652232 11:111967921-111967943 GAAGAACAGCAAGAGCAGTGTGG - Intronic
1088669765 11:112129661-112129683 GAGCAACAGCAAGACCGGTGTGG + Intronic
1089278517 11:117356011-117356033 CAGCAGCAGCAACAGCAACCTGG + Intronic
1089678418 11:120105924-120105946 CAGCAACAAAAGCAGCAGTCAGG + Intergenic
1089796891 11:120987966-120987988 TTGCAACAGCAACAAAAGTGAGG - Exonic
1090930272 11:131291409-131291431 CAACAACAACAACAACAGAGAGG - Intergenic
1091071355 11:132566949-132566971 CAACAACATCAACATCAGTTAGG + Intronic
1091097694 11:132839621-132839643 CAGCGTCAACAACAGCAGTGTGG - Intronic
1091111352 11:132971927-132971949 CAGCAGCAGTAGCAGCAGGGTGG - Intronic
1091960596 12:4690929-4690951 CAGCATGAGCAATTGCAGTGGGG + Exonic
1092311014 12:7352816-7352838 CAGCAACAACAACTGCCCTGGGG + Intronic
1093136833 12:15461997-15462019 AAGCAACAGAAACAGCCTTGGGG - Intronic
1093987786 12:25556439-25556461 CAGAAACAGCAAGTACAGTGAGG - Intronic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1095891562 12:47239591-47239613 CAGCAAGAGCAAGAGCTCTGTGG - Intergenic
1096068547 12:48760502-48760524 CAACAACAGCAAAACCAATGAGG - Intergenic
1096112854 12:49039519-49039541 CAGCAGCTGCAGGAGCAGTGGGG - Exonic
1098893277 12:76031125-76031147 CAGCAGCAGCAACAACAGCCCGG - Exonic
1099277628 12:80597830-80597852 CAGCAGCATCAACATCACTGGGG - Intronic
1100089630 12:90954375-90954397 GAGCAGCAGCAAAAGCAGAGAGG + Exonic
1100293374 12:93237757-93237779 CAACAACAGCAACAAAAATGTGG - Intergenic
1101233978 12:102769631-102769653 CAGTAAGAGCAACAGCTGCGGGG + Intergenic
1101510590 12:105389291-105389313 CGGCAGCAGCAGCAACAGTGGGG - Intronic
1102044018 12:109818358-109818380 CAACAACATCAACAGCGCTGAGG + Intronic
1102441532 12:112967467-112967489 CATCCACAGCTACAGCAATGCGG + Exonic
1102997705 12:117362432-117362454 GAGCAGCAGCAACAGCAACGGGG - Intronic
1103005404 12:117416642-117416664 CAGCATCAGCATCAGCAGTCAGG + Intronic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1104578959 12:129995180-129995202 CAACAACAACAACAACAGGGTGG - Intergenic
1104743783 12:131197525-131197547 CAGCCAGAGCATCACCAGTGAGG + Intergenic
1104759617 12:131289159-131289181 CAGCAACAGCAGCAGCCGATGGG + Intergenic
1106109287 13:26762187-26762209 CAGCAGCAGCAGCATCACTGGGG - Intergenic
1106175758 13:27329838-27329860 CACCAACAGCAACACAAATGAGG - Intergenic
1106250162 13:27976917-27976939 CAGCAGCAGCAACAGCAGCAAGG - Intergenic
1106587491 13:31069985-31070007 CAGCAGCAGCAACAGAAGACAGG + Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107404432 13:40099312-40099334 CAGCAGCAACAGCAGCAGTTTGG + Intergenic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1107920012 13:45196783-45196805 CTCCAACAGCAACAGCATTGGGG - Intronic
1109122177 13:58471207-58471229 AAGGAACAGCAACAGCAGAGGGG + Intergenic
1110123510 13:71912610-71912632 CTGAAACAGAAACAGCACTGAGG - Intergenic
1111392687 13:87618580-87618602 CAACAACAACAACAACAGGGAGG - Intergenic
1111853762 13:93609600-93609622 CAGCAAAACCAAAAACAGTGGGG - Intronic
1112394464 13:99016032-99016054 CAGCAGCATCTGCAGCAGTGTGG - Intronic
1112558479 13:100491051-100491073 CAGCAGCAGCAGCAGCATTCAGG - Intronic
1112686909 13:101839688-101839710 CAGCAACAAAAAGAGCAGTTGGG - Intronic
1112731161 13:102364414-102364436 CAGTAACTCCAACAGTAGTGGGG + Intronic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1113514891 13:110886676-110886698 CAGCAATGGCAACAGGTGTGGGG - Intronic
1114842058 14:26275837-26275859 CAGCAACAGGAACAGAAGGAGGG + Intergenic
1115058561 14:29162304-29162326 CAGCAGCAGCACCAGCAGAAGGG - Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1116773228 14:49150920-49150942 CAGCAATAGCAATAGCAGTTGGG - Intergenic
1116789476 14:49325226-49325248 CAGCAACTGCACCCACAGTGTGG + Intergenic
1117638825 14:57775300-57775322 CAGCAGTGGCAGCAGCAGTGTGG - Intronic
1118038797 14:61895662-61895684 CAGCAGCAGCATCAGTGGTGTGG - Intergenic
1118757466 14:68855386-68855408 CACAAAGAGCAACAACAGTGAGG + Intergenic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119537321 14:75413129-75413151 CAGCAACTCTAACAGCAGTTGGG + Intergenic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121678520 14:95773784-95773806 CAGCAAGAGCAAACGCAGGGAGG - Intergenic
1122188009 14:100016691-100016713 CAGAAACAGAAACATAAGTGAGG - Intronic
1122521728 14:102348854-102348876 CAGAATCAGCAACAGCACTGAGG + Intronic
1123048609 14:105530201-105530223 CAGGAACAGGCAAAGCAGTGCGG - Exonic
1123171154 14:106373931-106373953 CAGGTGCAGCTACAGCAGTGGGG - Intergenic
1123995310 15:25713998-25714020 CAGCAACGGCTACAGCAGCCAGG - Exonic
1124801621 15:32838493-32838515 CACAAACAGCAGCAGCCGTGGGG + Intronic
1124962716 15:34410364-34410386 CAGCATCACCAGCACCAGTGAGG + Intronic
1124979342 15:34556586-34556608 CAGCATCACCAGCACCAGTGAGG + Intronic
1125703624 15:41711188-41711210 CAGCAGCAGCAACAGCAACAGGG + Exonic
1125882160 15:43204324-43204346 CAGCAGCAGCAGCAGCATTTAGG - Intronic
1125918739 15:43511712-43511734 CAGCCACAGGCACAGCACTGGGG - Intronic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126506081 15:49406239-49406261 CAGCAGCAGCAATAGAAATGTGG + Intronic
1126915557 15:53462235-53462257 CTGAGGCAGCAACAGCAGTGGGG - Intergenic
1127281444 15:57496930-57496952 CAGGCACAGCAACAGCTCTGTGG + Intronic
1127474076 15:59315772-59315794 CAGCAACAGCAGCAGCATTGGGG - Intronic
1127840194 15:62825024-62825046 CACCAACAGCAACATCAGAGAGG + Intronic
1128695718 15:69760969-69760991 CTGAAACAGGAACAGCATTGAGG + Intergenic
1129009505 15:72402509-72402531 TAGCAACAGCCACAACAGAGAGG - Intronic
1129181438 15:73879866-73879888 CAACAACAACAACAGGAGTGAGG - Intronic
1129479795 15:75814523-75814545 CAGCCACACCACCAGCACTGGGG + Intergenic
1129679849 15:77652618-77652640 CAGCAGGAGCAACAGCTGAGAGG - Intronic
1130017977 15:80202018-80202040 CAGAGACAGCCACAGCAGTGGGG + Intergenic
1130844896 15:87735310-87735332 CAACAGCAGTAACAGCAGAGTGG - Intergenic
1130858212 15:87860986-87861008 CAGCAGCAACAACAACAGTGTGG - Intronic
1130978433 15:88795028-88795050 CTGCAACAGCAACAGGAAAGTGG - Intergenic
1131179486 15:90230294-90230316 GAGCAATGACAACAGCAGTGAGG + Exonic
1131347465 15:91663916-91663938 CAGCAAAAGCAAAAGAAATGTGG + Intergenic
1131902241 15:97100379-97100401 CAGCAACAGTAGCAGCACTTTGG - Intergenic
1132026094 15:98405537-98405559 GAGCAGCAGCAACAGCAGCCTGG - Intergenic
1132163429 15:99564297-99564319 CAGCAAAAGGAACTGCAGGGAGG - Intergenic
1132712744 16:1276712-1276734 CAGCAGCAGCAGCAGCTGCGGGG + Intergenic
1133138458 16:3728397-3728419 CAGCAACAGCAGCAGCAGCAAGG - Exonic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133382133 16:5340026-5340048 CAGCACCAGCAAAATCAGTATGG + Intergenic
1134762321 16:16725155-16725177 AAGCAACAGCAGCAGCAGGATGG + Intergenic
1134769218 16:16791534-16791556 AAGCAGCAGAAACAGCAATGTGG + Intergenic
1134983738 16:18634015-18634037 AAGCAACAGCAGCAGCAGGATGG - Intergenic
1135724501 16:24844428-24844450 CAGCACCAGGAAAGGCAGTGGGG - Intergenic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1136550464 16:30979920-30979942 CAGCAGCAGCAGCAGCGATGGGG + Exonic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1137723686 16:50642680-50642702 CAGCAACAGTAGCTGCAGTTAGG + Intergenic
1138112599 16:54336860-54336882 CAGCAGCTGCCACAGCAGTAAGG + Intergenic
1138920483 16:61522532-61522554 CAGAAACAGAAACTCCAGTGAGG + Intergenic
1139295357 16:65895714-65895736 CAGGATGTGCAACAGCAGTGTGG - Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1140544338 16:75791802-75791824 CAGCAACATCGACATCACTGGGG - Intergenic
1140619842 16:76716708-76716730 CAGCATCAGCTATAGCAGTGTGG - Intergenic
1141196111 16:81862534-81862556 AAGGAAAAGCAACACCAGTGGGG - Intronic
1141989612 16:87602573-87602595 CGGCAGCAGCAGCAGCAATGCGG - Intronic
1142127664 16:88418238-88418260 GACCAACAGCAACAGCTCTGTGG + Intergenic
1143098715 17:4492864-4492886 TGGCAACAGCAAGAGCAGAGAGG + Intergenic
1143516204 17:7420432-7420454 CTGCAACAGCAACAGCTGCCAGG + Exonic
1143550953 17:7630198-7630220 CAGCAACAGCAGCAGGCGCGAGG - Exonic
1144066858 17:11632231-11632253 CATCAACAGCCCCAGCAATGGGG - Intronic
1144701998 17:17346291-17346313 CATCACCAGCAGCACCAGTGTGG + Intronic
1145415996 17:22714589-22714611 TAGCAGCATCAACACCAGTGAGG + Intergenic
1146707357 17:35010941-35010963 CAGGAACTTCAACAGCAGTCTGG + Exonic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147753373 17:42751217-42751239 AGGCCACAGCATCAGCAGTGTGG - Intergenic
1147861487 17:43526508-43526530 CAGCTACAGCAACCACAGGGAGG - Intronic
1148521098 17:48275731-48275753 CAGCAACAACAACAATAGTTGGG - Intronic
1148684681 17:49494999-49495021 GAGGAACAGGAACCGCAGTGGGG + Intergenic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1150113200 17:62520317-62520339 CAGCCTCAGCAACAGAAGTCAGG + Intronic
1150318310 17:64188335-64188357 CAGCAGCAGCAAAGGCAGTGTGG - Exonic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151522775 17:74642326-74642348 CAGGACTAGCAACAGCAGTAGGG + Intergenic
1151557945 17:74856108-74856130 GACCAAGAGCCACAGCAGTGAGG + Intronic
1151692809 17:75697281-75697303 CAGCAACAACAAAAGCAAGGAGG - Intronic
1152060487 17:78070506-78070528 CAGCTACAGAAAGAGCAGTGGGG - Intronic
1152698804 17:81809044-81809066 CAGCAGCAGCAACAGCAGCAGGG - Exonic
1152743283 17:82027929-82027951 CAGCAACAGTGAAAGCAGCGAGG + Intronic
1152748429 17:82051686-82051708 CAGCGGCAGTAACAGCAGCGCGG + Exonic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1155384213 18:25259575-25259597 CAAAAACAGCAACAGGAGGGTGG + Intronic
1156112676 18:33746281-33746303 CAGCAACAACAGCAGCTCTGTGG + Exonic
1156448302 18:37252947-37252969 CTGCAAGAGCCACAGCACTGGGG + Intronic
1156791198 18:40976602-40976624 TGGCAACAGCAGCAGCTGTGGGG + Intergenic
1157568119 18:48693793-48693815 CAAAAACAGCTACAGAAGTGTGG - Intronic
1158122034 18:54059091-54059113 CAGAAACAGCCACAGCAGAATGG + Intergenic
1158493139 18:57928498-57928520 CTGCAACAGAAACAGGACTGGGG + Intergenic
1159228849 18:65578187-65578209 CAGGAACAGATATAGCAGTGGGG - Intergenic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1160377369 18:78423185-78423207 CAGCAGCAGCAATAGCAGGGGGG - Intergenic
1160629923 18:80239672-80239694 CAGCAACAGAAATAGCTATGTGG + Intronic
1160800941 19:968454-968476 CAGCAACAGCATCAGCATGTCGG + Exonic
1160818448 19:1046999-1047021 GAGCACCAGAACCAGCAGTGCGG - Exonic
1160866178 19:1257143-1257165 CAGCGACAGCAGTAGCAGCGGGG + Exonic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161474512 19:4476862-4476884 CAGAAACCTCAAAAGCAGTGTGG - Intronic
1161645803 19:5452671-5452693 CAGCATCAGCACCTGCACTGCGG - Intergenic
1161708265 19:5832493-5832515 CAGCAGCTGAAACAGCAGCGTGG + Exonic
1161710490 19:5844765-5844787 CAGCAGCTGAAATAGCAGTGCGG + Exonic
1162395438 19:10415883-10415905 CAGAAACAGCTAGACCAGTGTGG + Intronic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1163592534 19:18202641-18202663 CATCATCGGCAACAGCAGCGTGG - Exonic
1163700114 19:18782667-18782689 CAGCAGCAGCTGCAGCACTGAGG + Intergenic
1164711779 19:30362011-30362033 TAGGACCAGCAGCAGCAGTGAGG - Intronic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1166105737 19:40597266-40597288 CAGCAACAGCACCAGCAGGAGGG - Exonic
1166305022 19:41932597-41932619 CCCCAACATCCACAGCAGTGTGG - Intergenic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167621709 19:50564413-50564435 CAGGAACAGCAGCAGAGGTGAGG + Intronic
1168431982 19:56288513-56288535 CAGCAAAAGCATCAAAAGTGGGG - Intronic
1168447243 19:56430703-56430725 CAGAAACAGCAACAGTAGTCAGG + Intronic
925132876 2:1505579-1505601 CAACAACAACAAAAGGAGTGGGG - Intronic
925377810 2:3400683-3400705 CAGCCACCGAAACAGCACTGAGG + Intronic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926192088 2:10735969-10735991 CAGCAACACCAGCATCACTGGGG - Intronic
926222677 2:10946527-10946549 CAGCCACAGCCACAGCCGTGAGG + Intergenic
926379703 2:12274631-12274653 CAGCAACAATAAGAGCAGTAGGG - Intergenic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
927269001 2:21185513-21185535 CTTCAACTGCAATAGCAGTGGGG - Intergenic
927400342 2:22703697-22703719 CAGCAGCAGCAGTGGCAGTGGGG - Intergenic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928401622 2:30983096-30983118 CAGTAACACCAAGGGCAGTGTGG - Intronic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
928985894 2:37181365-37181387 AAACAAGAGCAACAGCAGGGAGG - Intronic
929465863 2:42143202-42143224 CAGAAAAAGCAGCAGCAATGAGG - Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
931046811 2:58363076-58363098 CAGCAAAAGCAGCAGCAATTGGG - Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
934770425 2:96904199-96904221 CAGCAGCAGCAACAGCACAGTGG + Intronic
934819034 2:97356073-97356095 CAACTCCAGCGACAGCAGTGAGG - Intergenic
936370186 2:111897340-111897362 CAGCAAAAGCAAAATCAGTGTGG - Intergenic
936743494 2:115544789-115544811 CACCACCACCAGCAGCAGTGAGG - Intronic
936919801 2:117676263-117676285 GAGCAGAAGCAAGAGCAGTGGGG + Intergenic
937022525 2:118671364-118671386 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937355308 2:121194744-121194766 TAGGAGCAGCCACAGCAGTGAGG + Intergenic
937509615 2:122579370-122579392 CAGCAACATCAAACTCAGTGTGG + Intergenic
937630165 2:124092365-124092387 CAGCAGCAACAACAGTAATGGGG - Intronic
937958050 2:127434093-127434115 CAGCTACAGCAACACCAGGAGGG + Intergenic
937992771 2:127673683-127673705 CAGCCCCAGCAGCAGCATTGAGG - Intronic
937993609 2:127677514-127677536 CAGCAAGTGCAACAGCCCTGAGG + Intronic
939244934 2:139610726-139610748 CCCCAGCAGCAGCAGCAGTGTGG - Intergenic
939973489 2:148689080-148689102 TAGAAACAGCAACATCAGTGTGG + Intronic
940962208 2:159798157-159798179 CAGCAACGGCAGCAGGAGCGCGG + Exonic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
941317336 2:164009591-164009613 CAACAACAGCAACAGCAATACGG + Intergenic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
942160657 2:173182885-173182907 CATTAACAGTAACAGAAGTGAGG + Exonic
942461169 2:176169844-176169866 CAGCAACAGCACCAGCAGCCTGG - Intronic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
943093747 2:183404535-183404557 CAGCAGCAGCAGCAGCCATGTGG + Intergenic
944386615 2:199172050-199172072 AAGCAACAACAACAACAATGTGG + Intergenic
945443198 2:209904917-209904939 AAGCAGCAACATCAGCAGTGTGG + Exonic
946050640 2:216859600-216859622 CAGCAACAAGAACAGCAGAAGGG - Exonic
946411627 2:219518001-219518023 AAGCAAGAGCAGCAGCAGAGGGG - Intronic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
948482754 2:238260848-238260870 CAGCGACAGCAACGGCCATGAGG - Exonic
948731116 2:239964294-239964316 AAGCAACAGCCACAGTAATGTGG + Intronic
948922637 2:241072959-241072981 AAGCAACCGCATCAGCCGTGAGG + Intronic
949063157 2:241973291-241973313 CAGCACCATCCACAGCCGTGAGG + Intergenic
1168958889 20:1854770-1854792 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1169060737 20:2658845-2658867 CACCACCGGCAACAGCCGTGGGG + Intronic
1169111295 20:3035892-3035914 CAGAAGCAGCAGCAGCAGTCAGG + Exonic
1169460104 20:5786948-5786970 CAACAGCAGAAATAGCAGTGTGG - Intronic
1169553666 20:6727071-6727093 GAGCATCAGAAACACCAGTGAGG + Intergenic
1170634902 20:18095653-18095675 CAGCAGCAGCAACAGCACCTGGG - Intergenic
1170853224 20:20022963-20022985 CGGCAGCAGAAACAGCAGAGGGG + Intronic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172223137 20:33287255-33287277 CAGAAACACCTACAGGAGTGTGG + Intronic
1172520508 20:35562654-35562676 CAGCAACAGGAGCTGCAGTCAGG + Intergenic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1174298853 20:49568063-49568085 TAGCAGCAGCAGCAACAGTGCGG + Exonic
1174387229 20:50194335-50194357 CAGTAGCAGCGACAGCAATGTGG + Intergenic
1174639588 20:52032001-52032023 CAGCAAGAAAAACAGCAGAGGGG - Intergenic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175241436 20:57552421-57552443 CAGTAACAGCATCAGAAGTAAGG - Intergenic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1176084017 20:63287777-63287799 CAGCAACAGCGACGGCGGGGAGG + Exonic
1176383090 21:6123108-6123130 CAGCAGCAGCAGCAGGAATGGGG - Exonic
1177079873 21:16626124-16626146 CAGCAACATGAACACCAGTTGGG - Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1177653101 21:23983181-23983203 CAGCAGCAGACACAGCAGTAAGG - Intergenic
1178471627 21:32898737-32898759 CAGAAACATCATCAGCAGTTGGG + Intergenic
1178728060 21:35072770-35072792 GGCCAACAGCAGCAGCAGTGTGG + Intronic
1179740379 21:43415131-43415153 CAGCAGCAGCAGCAGGAATGGGG + Exonic
1179831524 21:44000110-44000132 CACCAACAGCATCAGCAATAAGG - Intergenic
1180018158 21:45101011-45101033 CAGCAGCAGCAGCGCCAGTGCGG + Intronic
1180232021 21:46432356-46432378 AAGCTACAGTAACAGCAGTGTGG - Intronic
1180614979 22:17120962-17120984 CAGCACCAGCACCAGCCGCGGGG - Exonic
1180818153 22:18806040-18806062 CACCAACAGCAAAAGCACTTGGG + Intergenic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1180962701 22:19769349-19769371 CAGCAGCAACAGCAGCAGTGTGG - Intronic
1181078182 22:20395167-20395189 CACCAACAGAAACAGCATCGAGG - Intronic
1181355958 22:22295824-22295846 CACCACCAGCAACCACAGTGAGG + Intergenic
1181412894 22:22737268-22737290 CAGCATCAGCAACATCTGTGAGG - Intronic
1181416247 22:22761586-22761608 AAGCACCAGCAACATCTGTGAGG - Intronic
1181430386 22:22877945-22877967 CAGAAACACAGACAGCAGTGGGG + Intronic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181991334 22:26839207-26839229 CAGCAACGGCAAAGGCTGTGAGG + Intergenic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1184301546 22:43563659-43563681 CACCAGCAGCAGCAGCAGCGCGG - Intronic
1184901411 22:47448682-47448704 GAGCAGCAGCGAGAGCAGTGAGG + Intergenic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1185379621 22:50502462-50502484 CAGCAGCAGAGACAGCAGTCAGG - Intergenic
1203222549 22_KI270731v1_random:54920-54942 CACCAACAGCAAAAGCACTTGGG - Intergenic
1203268280 22_KI270734v1_random:31894-31916 CACCAACAGCAAAAGCACTTGGG + Intergenic
950131591 3:10550935-10550957 CAGCCACAGGAACAGCAGGCCGG - Intronic
950568039 3:13782887-13782909 CAGCAACAACCACAACTGTGAGG - Intergenic
950705267 3:14775549-14775571 CAGCAACAGCTACAGCAAAATGG + Intergenic
950719173 3:14870375-14870397 CAGCACCAGCGACAGCAGTAAGG - Intronic
952055118 3:29434811-29434833 CAGCAGCAACAACAGCAGCGGGG + Exonic
952320974 3:32277310-32277332 CAGCAGCAGCAACCACCGTGGGG - Intronic
952627508 3:35424763-35424785 CAGCAAAAGCAGCAGCAATTGGG + Intergenic
952695204 3:36257408-36257430 CAGCATCAGCAATTGCAGTTTGG - Intergenic
952898923 3:38096991-38097013 CAGCCACAGGCACTGCAGTGTGG + Intronic
953801817 3:46030716-46030738 CAGCTGCAGGAGCAGCAGTGGGG + Intergenic
954000371 3:47552068-47552090 CAACAACAGCAACAGCAAAATGG - Intergenic
954040664 3:47884912-47884934 CATCACCAGCAACTGCAGGGAGG - Intronic
954532335 3:51332087-51332109 CAGCAGCATTAACAGCAGTCAGG + Intronic
955865355 3:63376548-63376570 CAGCAACTGCAAAGGCACTGGGG - Intronic
956609144 3:71104392-71104414 CAGCAACAGCAGCAGAAGGGCGG - Intronic
956681381 3:71785011-71785033 CAGCAAGAGGAGCAGGAGTGGGG + Exonic
957759201 3:84533092-84533114 CAGCCACAGCAAGAGCAGCTAGG - Intergenic
958678599 3:97296618-97296640 CAGCAGCAGCAGTGGCAGTGAGG + Intronic
958787515 3:98613563-98613585 AAGCAACAGGAAGAGCACTGTGG - Intergenic
958988966 3:100819533-100819555 CAGCCACATCAACAACTGTGAGG - Intronic
959034386 3:101343715-101343737 CAGCAACAGCAACACCAGCAGGG + Exonic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959944989 3:112116750-112116772 AAGCACCAGCAACACCAGAGGGG + Exonic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
961133455 3:124489724-124489746 CAGCAGCAGCAACAGCACCTGGG + Intronic
961376391 3:126468864-126468886 CAGGACCAGCAACAGCACAGTGG - Intronic
962015467 3:131434802-131434824 CAGCAACAACAAAAACAGAGTGG + Intergenic
962289584 3:134122943-134122965 ACCCAACAGCAGCAGCAGTGGGG + Intronic
963000616 3:140678410-140678432 CAGCAACACCAATGGCAGTTGGG - Exonic
963542283 3:146607910-146607932 CAGCAATAGCAACAGGAGAGAGG - Intergenic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
964051872 3:152403740-152403762 CTGCAACAGCATAAGCAGTAAGG - Intronic
964562474 3:158012870-158012892 CAACAACAACAACAACAATGAGG + Intergenic
964650935 3:159010385-159010407 CAGCAGCAGCAACACCAGGTAGG - Intronic
965419137 3:168435513-168435535 CAGTAACAGCAGCAGCAGCAGGG + Intergenic
965997463 3:174902097-174902119 CAGCATCAGCAACACCTGGGCGG - Intronic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
968907704 4:3462362-3462384 CAGATACGGGAACAGCAGTGGGG - Intergenic
969184307 4:5464088-5464110 CAGGAGCAGGAACAGCAGTGGGG + Intronic
969222162 4:5768074-5768096 TTGCAGCAGCAGCAGCAGTGAGG + Intronic
969425342 4:7120963-7120985 CAGGAAAAGCCACCGCAGTGAGG - Intergenic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
969658892 4:8514844-8514866 TAGTAAGAGCAGCAGCAGTGTGG + Intergenic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
971304432 4:25467324-25467346 CAGCCCCAGCCCCAGCAGTGGGG + Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
972903393 4:43713189-43713211 CAGCAATAGCCACAGCATTTAGG + Intergenic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
974165582 4:58197316-58197338 CAGCAGCAACAATAACAGTGTGG + Intergenic
974714612 4:65651105-65651127 CAGCAACATCAAAGGCAGTCAGG - Intronic
975444821 4:74450503-74450525 TAATAACAGCAACAGCTGTGAGG - Exonic
976183956 4:82427243-82427265 CAGCAACAGCAACAACAAAAAGG - Exonic
976505249 4:85838680-85838702 CAGTTTCAGCAACAGAAGTGGGG - Intronic
977447529 4:97149624-97149646 CAGAAACAGAAACAGTAGTGAGG - Intergenic
978205547 4:106076396-106076418 CAGCAACAGCAGCAGTATTGTGG + Intronic
978224307 4:106315991-106316013 CAGCCACAGCGACAGCGCTGGGG - Intronic
978923777 4:114217731-114217753 CAGCAGCAGCATAGGCAGTGTGG - Intergenic
979055447 4:115987492-115987514 CAGGAACAGAACCAGTAGTGAGG + Intergenic
979076331 4:116275320-116275342 CAGCAGAAGTAGCAGCAGTGTGG - Intergenic
979471889 4:121108705-121108727 CAGCAGCAGCAACATCAGCTGGG - Intergenic
979856566 4:125639883-125639905 TAGCAAAAGCAACAACTGTGTGG - Intergenic
980505332 4:133711893-133711915 CAGGAACAGCTACAGGAGTTAGG - Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
980856192 4:138443249-138443271 CTGCAATAGCAACAGGAGTGAGG - Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981354705 4:143774723-143774745 GAGCAACAGCAGCAGAAGTTTGG + Intergenic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
982009817 4:151095929-151095951 CAGCAACAACGATGGCAGTGTGG + Intergenic
982390541 4:154858436-154858458 GAGCAGCAGCAAGAGCAGTGAGG - Intergenic
982873278 4:160611727-160611749 CAGCAACATCAACAGCACCTGGG - Intergenic
983333053 4:166356181-166356203 CATCAACATTAACAGGAGTGTGG - Intergenic
983523679 4:168737922-168737944 CAGAGACAGCAGCAGCTGTGAGG + Intronic
984820518 4:183877660-183877682 CAGCAGCAGCAGCGGAAGTGCGG - Intronic
985054955 4:186028014-186028036 GAGCAAGAGAAAGAGCAGTGAGG - Intergenic
986165120 5:5266417-5266439 AAGCAAAAGCAACGGCAGAGTGG + Intronic
986688415 5:10294113-10294135 GAGGAACAGCAAGACCAGTGTGG + Intronic
986844650 5:11738327-11738349 CAATAACAGCAAAAGCAGTTAGG + Intronic
987016293 5:13823141-13823163 CAGCAAAAATAACAACAGTGAGG - Intronic
987768731 5:22271461-22271483 TATCAACATTAACAGCAGTGTGG - Intronic
989341976 5:40386378-40386400 CAGCAACAGCAGCAGCAGCTGGG - Intergenic
990626383 5:57616855-57616877 CAGCAACAGCCACACAAGTGCGG + Intergenic
990714147 5:58617720-58617742 CATCATCGGCAATAGCAGTGTGG + Exonic
991027982 5:62051831-62051853 CAGCAGCAGAAACAGCACAGTGG + Intergenic
992245783 5:74820901-74820923 CAGAAATAGTAAGAGCAGTGTGG - Intronic
994657129 5:102607786-102607808 CAGCAACATCAGCACCACTGGGG - Intergenic
994665255 5:102697132-102697154 CAGCAAAAGCAAAAGCATGGAGG - Intergenic
994760999 5:103854078-103854100 AAGCAAAAGCAATAGCTGTGAGG + Intergenic
995087811 5:108135354-108135376 CAGGAACAGAAACAGCACTTGGG - Intronic
995245984 5:109936452-109936474 CAGCAAATGGAACAGCAGGGAGG - Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
996555917 5:124778684-124778706 CAGCAACATCAACATCAGCTGGG + Intergenic
996974534 5:129414631-129414653 CAGAAACAGATACAGCAGTCTGG + Intergenic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998987924 5:147782675-147782697 CAGCAGCAGCATCACCAGTTGGG + Exonic
999363620 5:151006824-151006846 CAGCAGCAGCACAATCAGTGGGG - Intergenic
999714488 5:154349193-154349215 CAGCATAAGCAAAAGCACTGAGG + Intronic
999794994 5:154980979-154981001 AAGGAACAGGAACAGCTGTGTGG + Intergenic
1000286783 5:159833705-159833727 CAGCAAGAGCAAAGGCACTGAGG + Intergenic
1001064880 5:168528704-168528726 CAGGGACAGCGACAGCAGTTGGG - Intergenic
1002209884 5:177592285-177592307 CAGCCACAGCACCAGCAGGAGGG - Exonic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002778808 6:351065-351087 CAGAAACCTCCACAGCAGTGGGG - Exonic
1004320349 6:14627000-14627022 CATCTGCAGCAGCAGCAGTGTGG + Intergenic
1004346906 6:14857294-14857316 CTTCAGCAACAACAGCAGTGAGG - Intergenic
1004678290 6:17865905-17865927 CCACCACAGCAACAGCACTGGGG + Intronic
1006738663 6:36292515-36292537 CAGCAGCAGGCAAAGCAGTGTGG - Intronic
1007221460 6:40282243-40282265 GAGCAGCAGCAGCAGCACTGGGG - Intergenic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007415914 6:41691074-41691096 CAGCAACAGCAGCAGCTCGGAGG - Exonic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1008220189 6:48845219-48845241 AGGCAAAAGCAACAGGAGTGAGG + Intergenic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1009369966 6:62887216-62887238 CCAGAACAGAAACAGCAGTGTGG + Intergenic
1009494711 6:64332507-64332529 CTGCAACTTCAACAGCAGTGAGG - Intronic
1009516909 6:64631474-64631496 CAGTATCAGCAACAATAGTGAGG - Intronic
1009582682 6:65557357-65557379 CAGCTACTGCTACTGCAGTGGGG + Intronic
1009730972 6:67606024-67606046 CAGCAACAACAACAACAAAGTGG + Intergenic
1009803908 6:68577332-68577354 CAGCAGCAGCAGCAGCATTTGGG + Intergenic
1010855030 6:80827154-80827176 AAACAACAGCAAAAGCATTGAGG - Intergenic
1011889455 6:92138918-92138940 CAACAACAACAACAACAGTGAGG + Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012743248 6:103047709-103047731 CAACAACACCAACAGTGGTGAGG - Intergenic
1012944849 6:105454529-105454551 AAACAACAACAACAACAGTGAGG + Intergenic
1013804770 6:113985045-113985067 CAGCAACAGCAGCAGCAAATGGG - Intronic
1014199094 6:118588999-118589021 CAACAGCAGCAGCGGCAGTGAGG - Intronic
1016185132 6:141189410-141189432 CAGCAACAAATACAGGAGTGCGG + Intergenic
1016527100 6:145014206-145014228 CAGCAAGTGCAACAGCGTTGGGG + Intergenic
1016951612 6:149586277-149586299 AAGCAAGAGGAACAGCAGGGGGG + Intronic
1017011249 6:150065155-150065177 GAGCAAAAGCAAGTGCAGTGAGG + Intronic
1017846583 6:158263764-158263786 CAACAACAGCAACAACAGGCTGG + Intronic
1017973097 6:159329915-159329937 CAGCAGTGGCAGCAGCAGTGAGG + Intergenic
1018025870 6:159805230-159805252 CAGCGAGAGCAACAGCATTGTGG + Intronic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018812038 6:167305372-167305394 CAGCCACAGCCACATCAGGGGGG - Intronic
1018865327 6:167742835-167742857 CAGCAAGAGAAAGGGCAGTGGGG + Intergenic
1018870218 6:167776990-167777012 CAGCAAAAGCACCAGCTCTGAGG + Intergenic
1019427164 7:983216-983238 CAGGAACAGCAAGAGCAGCAGGG - Exonic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019691735 7:2418772-2418794 CAGCAACAGAAACAACAGCTTGG - Intronic
1020049471 7:5072387-5072409 CAGCAGCAGCAGCAACAGCGGGG - Exonic
1020478102 7:8623013-8623035 CAGAAAGAGCAAAAGCAGAGTGG + Intronic
1021082988 7:16385789-16385811 CAGGACCTGCAACAGGAGTGTGG + Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1023473585 7:40552335-40552357 ATGCAACAGGAACAGCAGTCAGG - Intronic
1023767096 7:43521882-43521904 CAACAACAGAAAAAGAAGTGAGG + Intronic
1024096212 7:45984861-45984883 AAACAACAGCAACAGGAATGAGG - Intergenic
1025036327 7:55594487-55594509 CACCACCAACAACTGCAGTGAGG + Intergenic
1026590490 7:71690682-71690704 TAGCAACATGAACAGGAGTGTGG + Intronic
1026644044 7:72152569-72152591 CAGCAATAGGAACAACACTGAGG + Intronic
1026764986 7:73154820-73154842 CAGCAGCAGCAGCAGCACCGGGG + Intergenic
1027041458 7:74964575-74964597 CAACAGCAGCAACAGCACCGGGG + Intergenic
1027632109 7:80619798-80619820 TAGCAACATCAACAGGAGTTTGG + Intronic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1028032997 7:85941645-85941667 CAGCAACTGGAACAGCAATATGG - Intergenic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1029528246 7:101108615-101108637 CAGAAACAGCAACAGGTGGGGGG + Intergenic
1030075457 7:105732859-105732881 CAGCAGGTGCAACAGCACTGAGG - Intronic
1030084602 7:105805767-105805789 CAGCAAGAGCAAATGCAGTGTGG + Intronic
1030393782 7:108960399-108960421 AAGCCACAGAAACAGCATTGGGG + Intergenic
1030766648 7:113418798-113418820 GAGAAACAGAAACACCAGTGTGG + Intergenic
1030769733 7:113459106-113459128 CAGCAAGAGAAGCAGCAATGTGG - Intergenic
1030789799 7:113709839-113709861 TAGCATCTGAAACAGCAGTGGGG + Intergenic
1030861052 7:114629967-114629989 CAGCAGCAGCAACAGCATCCTGG + Exonic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1032333235 7:130999743-130999765 CAGCATGGGCAACAGGAGTGAGG - Intergenic
1033089520 7:138372150-138372172 TATCAACAGCCACAGTAGTGAGG + Intergenic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033980338 7:147156510-147156532 CAGCAAAAGCAAGAGAAGTCAGG - Intronic
1034284831 7:149877990-149878012 CAGAAACAGACAAAGCAGTGTGG + Intronic
1034426346 7:151016201-151016223 CAGCAGCAGCAGGAGCCGTGGGG - Exonic
1034440035 7:151081666-151081688 CAGCAACAGCAGGAGCAGCAGGG + Exonic
1034595160 7:152182494-152182516 CAGCAGCAACAACAGCAATTTGG - Exonic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1035467886 7:159091621-159091643 CCCCATCAGCAATAGCAGTGGGG + Intronic
1036505423 8:9350462-9350484 AAGCACTAACAACAGCAGTGTGG - Intergenic
1036581676 8:10081140-10081162 CATCCACAGCAACAGCAGGAAGG + Intronic
1038230478 8:25694750-25694772 AGGCAACAGTAACTGCAGTGAGG + Intergenic
1038379835 8:27082261-27082283 CTGCAACAGCAACAGGAGTGAGG + Intergenic
1039513802 8:38113565-38113587 GAGCCACAGTCACAGCAGTGGGG + Intronic
1040083858 8:43318509-43318531 CAGCAGCAGCACCATCAGTCAGG - Intergenic
1040605604 8:48928205-48928227 CAGCAACTGCAACATCATTCTGG - Intergenic
1040766277 8:50914952-50914974 CAGGAACATGAACAGCAGTCGGG - Intergenic
1041167442 8:55103172-55103194 CAGCGGCAGCAACAGCAGCGGGG + Exonic
1042764745 8:72308755-72308777 CATTCACAGCAGCAGCAGTGGGG + Intergenic
1043849579 8:85200552-85200574 CAGCCATAGCAACAGCACTCTGG - Intronic
1044622746 8:94206519-94206541 CATTAACAGCAACAGCTCTGAGG - Intronic
1045599544 8:103697147-103697169 CAGCAACAGCAAGAACAGAAGGG + Intronic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1046847219 8:118931160-118931182 CAGCAACAGCAACAACAAAACGG + Intronic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048765329 8:137837545-137837567 AAGCAGCAGCAGCAGCAGTTTGG + Intergenic
1048912871 8:139152854-139152876 CAGAAACAGCAGCAGCACAGAGG - Intergenic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1049030278 8:140031194-140031216 CATCAGAAGAAACAGCAGTGAGG + Intronic
1049214964 8:141403293-141403315 CAGCATCAGCAACACCAGGGAGG - Intronic
1049223615 8:141439305-141439327 CTCCAACAGCAACAGAAATGGGG + Intergenic
1049227557 8:141464401-141464423 GAGCAACATGAACAGCAGTTTGG + Intergenic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1049587856 8:143440290-143440312 CAGCCACGGCAGCCGCAGTGAGG + Exonic
1049802581 8:144524936-144524958 CAGCAGCAGCGGCAGCAGTGCGG + Exonic
1050052773 9:1620547-1620569 CAGCAGCAGCAGCAGCTGTTTGG + Intergenic
1050928471 9:11296460-11296482 TAGCAGCAGCAACAGCAGCACGG + Intergenic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1052437223 9:28444375-28444397 ATGCAACAGAAGCAGCAGTGGGG + Intronic
1052560431 9:30077698-30077720 CAACAACAACAACAACAGAGAGG - Intergenic
1052937840 9:34108105-34108127 CAGCAAGAGCAAAGGCAGGGAGG - Intronic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1055231761 9:74074812-74074834 CACCAACAGCTGCAGCAGTGTGG + Intergenic
1055606943 9:77980047-77980069 CAGAAAGAGCAACGGCTGTGGGG + Intronic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1056180198 9:84075622-84075644 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
1056795708 9:89657360-89657382 CAGGCACAGCATCACCAGTGTGG - Intergenic
1057112494 9:92486591-92486613 CTGCAACAGGAAGAGCTGTGAGG - Intronic
1057470999 9:95356144-95356166 CAGAGAAAGCAACAGCAGAGAGG - Intergenic
1057941430 9:99288697-99288719 CAGCATCAGATACAGAAGTGGGG + Intergenic
1058267255 9:102918159-102918181 CAGGAACAGATAAAGCAGTGAGG - Intergenic
1059380419 9:113919298-113919320 CAGCTACAGACACACCAGTGGGG - Intronic
1059386645 9:113969775-113969797 CAGCAACAGCAGCGGCAGCATGG - Intronic
1060040335 9:120294841-120294863 CATCAACAGCAGCAGCATTCTGG + Intergenic
1060140031 9:121201688-121201710 CAGGACCAGGAACAGGAGTGCGG + Exonic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062402933 9:136380334-136380356 GAGGAGCAGGAACAGCAGTGGGG - Intronic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1062720764 9:138042733-138042755 CAGCGAAGGCCACAGCAGTGGGG - Intronic
1186443205 X:9603832-9603854 CAGCAACACCAAAAGCAGCAAGG - Intronic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1186536574 X:10356091-10356113 CAACAGTAGCAACAGAAGTGAGG + Intergenic
1186758728 X:12700935-12700957 CAGCCACAGCAGCTGCAGGGAGG - Intronic
1187577594 X:20574947-20574969 CAGGAACAGCAAGATCAGTGTGG + Intergenic
1187917327 X:24166940-24166962 CACCAACATCAAAAGCAGGGAGG + Intronic
1188437121 X:30173694-30173716 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1188707882 X:33357715-33357737 CAGCAGCAGCAGTAGCAGTATGG - Intergenic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1189617425 X:42798268-42798290 CAGCAACAGCAACATCACCTGGG - Intergenic
1189926468 X:45960095-45960117 CAGTAACAGCAGCAGGGGTGGGG - Intergenic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190244450 X:48681961-48681983 CAGATACAGGAACAGCAGTTTGG - Intronic
1190287696 X:48971755-48971777 CAGGAGCAGCAACAGCGGTGGGG + Intergenic
1190309496 X:49106751-49106773 CAGATACAGGAACAGCAGTTTGG - Intergenic
1191208717 X:57862203-57862225 CAGCCACTGCAAAAGCAGTTTGG + Intergenic
1191225741 X:58040910-58040932 CAGCAACAGTAGCAGCATGGTGG - Intergenic
1191642436 X:63441868-63441890 TAGCAGCAGCTGCAGCAGTGTGG - Intergenic
1191741786 X:64443934-64443956 CAGCATCAGAAAAGGCAGTGGGG + Intergenic
1193251804 X:79299401-79299423 CAGCAACAACAACAAAATTGTGG + Intergenic
1193569695 X:83127560-83127582 CAGCAACAGCTCCAGCAATAAGG + Intergenic
1195051569 X:101101796-101101818 CAGCGATAGCAACTTCAGTGAGG - Intronic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1197553266 X:127921218-127921240 CAGCACTAGCAAGAGCAGTTAGG + Intergenic
1197841566 X:130753284-130753306 GAGGAACAGAGACAGCAGTGAGG - Intronic
1199769389 X:150964693-150964715 CAGCAACAGCAAGGCCACTGTGG + Intergenic
1199930967 X:152521128-152521150 CAGCAACAGCAAGCCCAGGGAGG + Intergenic
1200052230 X:153440359-153440381 CAGGAACAGTATCAGCATTGTGG - Intergenic
1201237352 Y:11923925-11923947 CAGCAACACCAAAATCAATGAGG + Intergenic
1201385989 Y:13439962-13439984 CAGCAACCTTAACAGCAGTGGGG - Intronic
1201896790 Y:19000291-19000313 CTGCAACTTTAACAGCAGTGGGG - Intergenic