ID: 1165002868

View in Genome Browser
Species Human (GRCh38)
Location 19:32779344-32779366
Sequence AACCGCTTACTGGTACTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165002868_1165002870 -5 Left 1165002868 19:32779344-32779366 CCTGTAAGTACCAGTAAGCGGTT 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1165002870 19:32779362-32779384 CGGTTGTATTTCTTTCTCCTCGG 0: 1
1: 0
2: 2
3: 17
4: 190
1165002868_1165002871 -4 Left 1165002868 19:32779344-32779366 CCTGTAAGTACCAGTAAGCGGTT 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1165002871 19:32779363-32779385 GGTTGTATTTCTTTCTCCTCGGG 0: 1
1: 0
2: 1
3: 29
4: 306
1165002868_1165002874 22 Left 1165002868 19:32779344-32779366 CCTGTAAGTACCAGTAAGCGGTT 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1165002874 19:32779389-32779411 GTTCCTTCATATAACTCATTTGG 0: 1
1: 0
2: 0
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165002868 Original CRISPR AACCGCTTACTGGTACTTAC AGG (reversed) Intronic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
907098431 1:51803794-51803816 AACAGAGTACTTGTACTTACAGG + Exonic
1070935654 10:80292956-80292978 AACTGCTCAGTGGGACTTACAGG - Intergenic
1077259915 11:1611169-1611191 AGCCGCTGGCTGGTACTGACAGG - Intergenic
1081885238 11:46489743-46489765 GACAGCTTCCTGGTAATTACTGG - Intronic
1090742186 11:129674482-129674504 AAACGCTTACTTATATTTACTGG - Intergenic
1102635353 12:114318876-114318898 ACTCCCTTACTGGTGCTTACTGG + Intergenic
1112274376 13:98002589-98002611 AAATATTTACTGGTACTTACAGG - Exonic
1130056437 15:80530355-80530377 TACTGCTTGCTGGGACTTACTGG + Intronic
1140600799 16:76472780-76472802 CAACACTTACTGGGACTTACTGG + Intronic
1141087373 16:81105963-81105985 AAGTACTTACTGGTACTTATAGG - Intergenic
1142970263 17:3606590-3606612 AACCACTTACTGGCACCTCCTGG + Intergenic
1154138306 18:11800479-11800501 AACTGCTTCTTGGCACTTACAGG - Intronic
1165002868 19:32779344-32779366 AACCGCTTACTGGTACTTACAGG - Intronic
939150938 2:138472133-138472155 AGCCACTAACTGGTACTTACTGG + Intergenic
940044020 2:149390378-149390400 AAATGCTCACTGGTTCTTACTGG + Intronic
945158284 2:206862072-206862094 AACTGCTTACTAGAACTTTCTGG - Intergenic
1184274910 22:43404667-43404689 CACCGCTGATTGGTACTTGCTGG + Intergenic
953243418 3:41169433-41169455 AAGCCCTTACTGCTAGTTACTGG + Intergenic
972505988 4:39720619-39720641 AACCGGTAACTGATACTTACAGG + Intronic
981551145 4:145942537-145942559 AACAGCTTCCTGATACTTATAGG + Intergenic
994199891 5:96961245-96961267 AACCGCTTTCCCATACTTACAGG - Intronic
1005638528 6:27773443-27773465 AAGCTGTTAATGGTACTTACAGG - Intergenic
1027256652 7:76435032-76435054 AACCACTTACCAGTACTTCCCGG - Intronic
1027282244 7:76617286-76617308 AACCACTTACCAGTACTTCCTGG + Intronic
1033476211 7:141695819-141695841 GACCTATTACAGGTACTTACAGG + Intronic
1037969585 8:23162778-23162800 AACCGCTTCCTGCCACTTTCAGG + Intronic
1040638806 8:49306602-49306624 CACCTCTCACTGGTACTTGCTGG - Intergenic
1045719968 8:105097637-105097659 AACTGCTCACAGGTACTTTCGGG - Intronic
1047235916 8:123041959-123041981 TATCGCTTTCAGGTACTTACCGG - Exonic
1049482762 8:142834772-142834794 ACCCGCTTTCTGGAACTTTCGGG - Intronic
1050540315 9:6664202-6664224 AGACCCTTACTGCTACTTACAGG + Intergenic
1060139142 9:121190816-121190838 AATGGCTTACTAATACTTACAGG + Intronic
1198093525 X:133355603-133355625 TGCTGCTTACTGCTACTTACTGG - Intronic