ID: 1165002870

View in Genome Browser
Species Human (GRCh38)
Location 19:32779362-32779384
Sequence CGGTTGTATTTCTTTCTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165002865_1165002870 30 Left 1165002865 19:32779309-32779331 CCTGTCTTTTTGTCTCGCTGATG 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1165002870 19:32779362-32779384 CGGTTGTATTTCTTTCTCCTCGG 0: 1
1: 0
2: 2
3: 17
4: 190
1165002868_1165002870 -5 Left 1165002868 19:32779344-32779366 CCTGTAAGTACCAGTAAGCGGTT 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1165002870 19:32779362-32779384 CGGTTGTATTTCTTTCTCCTCGG 0: 1
1: 0
2: 2
3: 17
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165002870 Original CRISPR CGGTTGTATTTCTTTCTCCT CGG Intronic
901675277 1:10879864-10879886 AGGTTGTATTGGTTTCTCCCTGG + Intergenic
906079633 1:43076324-43076346 CGGTAGTCCTTCTTTCTCTTTGG + Intergenic
907178534 1:52549158-52549180 GTTTTGTATTTTTTTCTCCTTGG - Intronic
909174235 1:72335221-72335243 CTGTTTTCTTTTTTTCTCCTTGG - Intergenic
911937708 1:104001144-104001166 TGGTTGTTTCTCTTTGTCCTGGG + Intergenic
914977404 1:152378985-152379007 CGGTTTAATTTCTTTCACCAGGG - Intergenic
921100829 1:211928141-211928163 ATGTTTTATTTCTTTCCCCTGGG + Intergenic
921874997 1:220185741-220185763 CTGTTCAATATCTTTCTCCTAGG - Exonic
922113149 1:222582600-222582622 CGTTTGTTTTAATTTCTCCTGGG - Intronic
924957104 1:248940274-248940296 CAGGGGTCTTTCTTTCTCCTTGG - Intergenic
1063104396 10:2980377-2980399 AGTATGTTTTTCTTTCTCCTCGG - Intergenic
1063251524 10:4280284-4280306 AGCATGCATTTCTTTCTCCTGGG + Intergenic
1063290977 10:4748298-4748320 AGCCTGTATTTCTTTCTCATGGG - Intergenic
1066232497 10:33449876-33449898 CGGGTGTTTATCTTGCTCCTAGG + Intergenic
1068557520 10:58475794-58475816 CGGCTGTTTTTCTTTCTCCTGGG + Intergenic
1069562182 10:69438571-69438593 CCGTTGTTTTTCTTTCTCATGGG - Intergenic
1071400944 10:85270101-85270123 CAGTTGGGTTTTTTTCTCCTTGG + Intergenic
1076963011 10:133782120-133782142 CAGGGGTCTTTCTTTCTCCTTGG - Intergenic
1081198458 11:40189392-40189414 AGGTTATATTTTTTTGTCCTAGG - Intronic
1081632865 11:44701407-44701429 CGTTTTTATTTCTGTCTCCTTGG + Intergenic
1083245171 11:61421263-61421285 GGGTTGGATTTCTTTTTCCTGGG - Intronic
1086274432 11:85109055-85109077 CAGTTGAATTTTTTTTTCCTGGG - Intronic
1087202965 11:95364656-95364678 CCGCTGTATTTTTTTCTCCTGGG - Intergenic
1087736969 11:101845194-101845216 AGGTTCTCTTTGTTTCTCCTGGG + Intronic
1087915729 11:103808321-103808343 CGCTTGTTTTTCATTCCCCTTGG - Intergenic
1089088746 11:115848118-115848140 TGAATGTATTTCTTTCTCCTTGG - Intergenic
1089449555 11:118583386-118583408 TGTTTGTATGTCTTTCTCTTAGG + Intronic
1090498721 11:127240649-127240671 CAGTTGAATTTCTTCTTCCTTGG + Intergenic
1090515828 11:127425477-127425499 CTGTTTGATTTCTTTTTCCTTGG - Intergenic
1090633748 11:128674805-128674827 CATTTGCATTTCTTTCTCCCAGG + Intergenic
1091268330 11:134288043-134288065 CTGATGCATTTCCTTCTCCTTGG - Intronic
1092522382 12:9288180-9288202 ATGTTGTATTTATTTTTCCTAGG + Intergenic
1092544901 12:9443682-9443704 ATGTTGTATTTATTTTTCCTAGG - Intergenic
1094508049 12:31078368-31078390 ATGTTGTATTTATTTTTCCTAGG + Exonic
1097026130 12:56057009-56057031 CAGTTGTATTTGTTTCCTCTCGG + Intergenic
1099924104 12:88996496-88996518 CCATTTTATTGCTTTCTCCTTGG + Intergenic
1102143276 12:110634628-110634650 CTTTTGTATTTTTTTTTCCTTGG + Intronic
1104451628 12:128873754-128873776 CAGTTGTATTTCTTTTTCTATGG + Intronic
1104750426 12:131234907-131234929 CGTTGGAATTGCTTTCTCCTGGG + Intergenic
1104782294 12:131429555-131429577 CGTTGGAATTGCTTTCTCCTGGG - Intergenic
1105398504 13:20065210-20065232 CGGTTTTTTTTCTTTCTTTTGGG - Intronic
1106615925 13:31327578-31327600 CTACTGTATTTCTTTCTTCTGGG + Intronic
1107571517 13:41664336-41664358 CGGCTTTATTTCTTTATCCATGG + Intronic
1108480463 13:50865157-50865179 CTGTTGTCTTTCTGTTTCCTAGG - Intergenic
1109232259 13:59772304-59772326 CATTTGGATTTCTTTCTACTTGG + Intronic
1109383151 13:61591768-61591790 CCGATGTATTTTTTTCTTCTAGG + Intergenic
1110252842 13:73400112-73400134 CTCATGTATTTCTTTCTCCGTGG + Intergenic
1110951715 13:81501496-81501518 CTGTTGCTTTTCCTTCTCCTTGG + Intergenic
1113136826 13:107099998-107100020 AGGTCATATTTCTTTCTCCTGGG + Intergenic
1113989440 13:114348948-114348970 CAGGGGTCTTTCTTTCTCCTTGG - Intergenic
1114156682 14:20111428-20111450 TGGTTGTATGTATTTCTTCTTGG + Intergenic
1116409962 14:44609524-44609546 CCCTTGTATTTTTTTCTCCTGGG - Intergenic
1116468435 14:45259947-45259969 CAATTGTAATTCTTTGTCCTAGG + Intergenic
1116956807 14:50932379-50932401 CAATTGTATTTCCTTCTCCGTGG + Intronic
1117585314 14:57195985-57196007 TAGTTTTATTTCTTTTTCCTTGG + Intergenic
1119973678 14:79001532-79001554 CAGCTGTACTTCTTTCTCCCTGG + Intronic
1121364273 14:93292780-93292802 TGGTTGTAGTTCTATCTACTTGG - Intronic
1123834467 15:24174539-24174561 CGTTTGTATTTCATTATCATAGG + Intergenic
1126894806 15:53246724-53246746 TGGTTTTATATTTTTCTCCTAGG - Intergenic
1127306577 15:57711687-57711709 CATGTGTATTTCTTTCTACTGGG + Intronic
1127980518 15:64031573-64031595 TGCTTGTATTTCTTGCTGCTGGG - Intronic
1130224514 15:82046788-82046810 CGCCTGCATTTCTGTCTCCTTGG + Intergenic
1133063810 16:3192130-3192152 CGGTTGAAGCTCCTTCTCCTGGG + Intergenic
1137691393 16:50430442-50430464 CAGTTCTATTTCTTTCTCCCTGG + Intergenic
1138966178 16:62086632-62086654 TGGTTTTATTTCTGTCTACTTGG - Intergenic
1139160198 16:64496516-64496538 TGGTTTTATTTATTTCTCCTTGG + Intergenic
1140998470 16:80284582-80284604 AGGTTGTAACTTTTTCTCCTGGG - Intergenic
1143209459 17:5173661-5173683 AGGATGTTTTTCTTTCTACTGGG - Exonic
1143294540 17:5860852-5860874 ATGTTATATTTCTCTCTCCTTGG - Intronic
1144618943 17:16803117-16803139 AGGATGTTTTTCTTTCTACTGGG - Intronic
1144893764 17:18512578-18512600 AGGATGTTTTTCTTTCTACTGGG + Intergenic
1145094563 17:20014705-20014727 CAATTTTTTTTCTTTCTCCTTGG + Intronic
1145138461 17:20431696-20431718 AGGATGTTTTTCTTTCTACTGGG - Intergenic
1147913880 17:43875378-43875400 TGGTTTTCTTTCTTTTTCCTTGG - Intronic
1150024221 17:61654847-61654869 AGGTTTGATTTCTCTCTCCTTGG - Intergenic
1150099317 17:62408172-62408194 GGGTTGTATTTCTTTCACTAAGG + Intronic
1151771069 17:76162007-76162029 TGGCTACATTTCTTTCTCCTTGG - Intronic
1152952153 17:83244346-83244368 CAGGGGTCTTTCTTTCTCCTTGG - Intergenic
1153798014 18:8642494-8642516 TGGTTCTCTTTCTATCTCCTGGG + Intergenic
1155144052 18:23069001-23069023 GACTTGTATTTCTTTTTCCTGGG - Intergenic
1157155786 18:45264633-45264655 CGGTTGTCTCTCATTCTCCCAGG - Intronic
1158057624 18:53300852-53300874 AGGTTGGATTTCTATCTCCCTGG + Intronic
1158191916 18:54839576-54839598 CCCTTGTATTTATTTGTCCTTGG - Intronic
1158618638 18:59010964-59010986 CAGTTGGATTTCCTTCTCCAAGG + Intergenic
1158893259 18:61892955-61892977 CGCTTGGATTTCCTTCTCCGCGG - Exonic
1159475575 18:68916772-68916794 TCGTTGCATTGCTTTCTCCTGGG + Intronic
1160020891 18:75180245-75180267 TGGTTGTTTTTCTTTCTTCATGG + Intergenic
1160653986 19:251138-251160 CAGGGGTCTTTCTTTCTCCTTGG + Intergenic
1161730122 19:5954820-5954842 CGGCTGGCTTTGTTTCTCCTTGG - Intronic
1162255792 19:9488569-9488591 ATGTTGTATATCTTTCTCCCTGG - Intronic
1165002870 19:32779362-32779384 CGGTTGTATTTCTTTCTCCTCGG + Intronic
1166706431 19:44910492-44910514 CGGTTTCTTTTCTTTCTCCCCGG + Intergenic
1168728142 19:58602568-58602590 CAGGGGTCTTTCTTTCTCCTTGG - Intergenic
925710423 2:6733777-6733799 TGATTGGATTTCTTTCTCCTTGG - Intergenic
926821965 2:16861804-16861826 TGCTTGTGTTTCTTTCTCCCTGG - Intergenic
929589860 2:43137780-43137802 CGTTTTTTTTTCCTTCTCCTTGG + Intergenic
929612015 2:43277630-43277652 GTGTTGTATTTCTTTCTTCGAGG + Intronic
931421617 2:62133208-62133230 CCTTTGTACTTATTTCTCCTTGG + Intronic
931859002 2:66334118-66334140 CGGGTGTTCTTCTTTCCCCTGGG - Intergenic
931986814 2:67750230-67750252 GGGTTGTTTTTTTTTTTCCTAGG + Intergenic
933209541 2:79551190-79551212 AGGTTTTGTTTCTTTTTCCTGGG - Intronic
934739040 2:96705806-96705828 CCGTTGTTTTGCCTTCTCCTGGG - Intergenic
934927960 2:98395091-98395113 GACTTGTGTTTCTTTCTCCTAGG + Intronic
935374330 2:102379643-102379665 CTGTTATATTTCCTTTTCCTGGG + Intronic
936570410 2:113608440-113608462 CAGGGGTCTTTCTTTCTCCTTGG + Intergenic
937639156 2:124192164-124192186 CAGTTGTTTTTCTTTCTCTCTGG + Intronic
939822919 2:146979482-146979504 CTGTTGTTTTTTTTTCCCCTTGG + Intergenic
941031069 2:160512280-160512302 CTTTTGTATCACTTTCTCCTCGG + Intergenic
944425083 2:199572772-199572794 CCATTGTATTTATTTCTGCTGGG - Intergenic
945405531 2:209443214-209443236 AGGTTTTTTTTTTTTCTCCTTGG + Intronic
945438302 2:209845319-209845341 CGTTTGTAGATTTTTCTCCTTGG + Intronic
946379392 2:219334865-219334887 TGGTAGTCTTTCTTTCTTCTTGG - Intergenic
946482507 2:220070734-220070756 CGTATGTTTTTATTTCTCCTGGG + Intergenic
946620388 2:221555520-221555542 AGGGTCTATTTCTTTTTCCTGGG - Intronic
946992300 2:225348200-225348222 CATTTGTTTTTCTTTCTACTTGG + Intergenic
949088403 2:242178211-242178233 CAGGGGTCTTTCTTTCTCCTTGG - Intergenic
1170118983 20:12892108-12892130 CTGTTGTGTTTGTTTCACCTGGG + Intergenic
1170624501 20:18021058-18021080 CGGTTGATTTGCTTTCTCCTTGG - Intronic
1173143936 20:40509039-40509061 AGGCTATATTTCTTTCTACTGGG + Intergenic
1178071486 21:28972899-28972921 AGGTAGTTTATCTTTCTCCTTGG - Intronic
1179596978 21:42449479-42449501 GGGTGGTTGTTCTTTCTCCTCGG + Intergenic
1180263567 21:46694170-46694192 CAGGGGTCTTTCTTTCTCCTTGG - Intergenic
1181713245 22:24704968-24704990 CACCTGTACTTCTTTCTCCTGGG - Intergenic
1182181915 22:28358263-28358285 CAGTTGTACTTCCTTTTCCTTGG - Intronic
1182242801 22:28930500-28930522 CGGTTCTGTTGCTTTCTCCATGG + Intronic
1182298084 22:29321757-29321779 CAGATGTATTTTTTTCCCCTGGG - Intergenic
1184118305 22:42434598-42434620 CGGTTTTATTTCTATCCCCCTGG - Intergenic
1185429797 22:50802531-50802553 CAGGGGTCTTTCTTTCTCCTTGG - Intergenic
951343933 3:21522933-21522955 CGGTAGTATTTAGTTGTCCTTGG + Intronic
951345939 3:21547094-21547116 CCTTTTTATTCCTTTCTCCTCGG + Intronic
951866691 3:27316489-27316511 CTGTTGTATTTTTTTCACCTGGG - Intronic
956335302 3:68156414-68156436 TGGTTGTTTTATTTTCTCCTGGG + Intronic
956815604 3:72905411-72905433 CTGTTGTTTTTCATTCTCTTTGG + Intronic
959006142 3:101021860-101021882 AAGTTGTATTTTTTTTTCCTAGG - Intergenic
960145643 3:114198613-114198635 CAGTTTTATTTCTTTCTAATTGG + Intronic
963388036 3:144621488-144621510 CTGATGTGTTTCTTTCTCTTGGG - Intergenic
965476074 3:169156816-169156838 CTGCTGCTTTTCTTTCTCCTAGG - Intronic
966676110 3:182592263-182592285 GGTTTGTCTCTCTTTCTCCTTGG - Intergenic
967555415 3:190850965-190850987 CAGTGGTATTTTTTTTTCCTTGG - Intergenic
970218392 4:13782947-13782969 TGGTAGTATTTCTGTCTCTTGGG + Intergenic
977141795 4:93382860-93382882 AGATTGTACTTATTTCTCCTAGG + Intronic
981428272 4:144629256-144629278 AGGTGATCTTTCTTTCTCCTTGG - Intergenic
982633438 4:157862705-157862727 CAGTTGTATTTCTTTCACCTTGG + Intergenic
985011628 4:185588543-185588565 TGGCTGTTTTTCTTTTTCCTTGG + Intronic
985190124 4:187363632-187363654 CACTTGTCTTTCATTCTCCTTGG - Intergenic
985466232 4:190199415-190199437 CAGGGGTCTTTCTTTCTCCTTGG - Intergenic
986258890 5:6125322-6125344 AGGTTCTCTTTCTTTCTCATTGG - Intergenic
986323160 5:6650053-6650075 ATGTTGTCTTTCTTTCTTCTCGG + Intronic
987445557 5:18014569-18014591 AGTTTATATTTCTTTCTACTTGG + Intergenic
989714431 5:44444389-44444411 GGGTTCTATTTCTTTCTTGTTGG + Intergenic
991994842 5:72376780-72376802 TGGTTGTATTGCTGTTTCCTTGG + Intergenic
993516362 5:88840627-88840649 AGTTTGTTTTTTTTTCTCCTTGG + Intronic
993815374 5:92538230-92538252 TGTTTGTATTTCTTCATCCTTGG + Intergenic
995385817 5:111587617-111587639 CTGTTTTATTACTTTCTTCTGGG + Intergenic
995658886 5:114458865-114458887 CAGATGTATTTCCTTCTGCTGGG - Intronic
996133721 5:119812889-119812911 AGTTTTTATTTCTGTCTCCTCGG + Intergenic
997404863 5:133637584-133637606 TGGTTTTCTTTCTATCTCCTTGG + Intergenic
1002746183 5:181475749-181475771 CAGGGGTCTTTCTTTCTCCTTGG - Intergenic
1003292260 6:4789459-4789481 CGGTTTTATTTCTGTTTCCCTGG + Intronic
1003440532 6:6137226-6137248 CCGTTCTATTTTTTTCTTCTTGG - Intergenic
1003993566 6:11513985-11514007 GGGATGTGTTTCTTCCTCCTGGG - Intergenic
1004010781 6:11685211-11685233 TTGTTATATTTCATTCTCCTTGG + Intergenic
1007865440 6:44964137-44964159 CGTTTGAATTTCTAGCTCCTAGG + Intronic
1007973927 6:46081089-46081111 CGGTTTTATTTTTCTCTTCTGGG - Intergenic
1008896410 6:56561549-56561571 TAGTTGTTTTTCTTACTCCTAGG - Exonic
1010676402 6:78750140-78750162 GTGTTATATTTCTTTCTTCTGGG + Intergenic
1013742106 6:113299482-113299504 AGGTTGGATTTCTTTCTCCATGG + Intergenic
1014590408 6:123259662-123259684 TTGTTGTTTTTCTTTCCCCTAGG - Intronic
1015681903 6:135817932-135817954 GTGTGGTATTTCTTTCTCCTGGG + Intergenic
1015881211 6:137871535-137871557 CTGTTGTGTTTCTTTTGCCTGGG + Intronic
1016209288 6:141508280-141508302 GGCTTGTTTTTCTTTCTCCAAGG - Intergenic
1018189772 6:161300405-161300427 GGGTTGGATTTCTCTCTCCTTGG + Intergenic
1018568477 6:165182987-165183009 CGGTTTTATTTCCTTCTGTTTGG - Intergenic
1019115020 6:169752802-169752824 CGATTGTATTTAATTCTCCATGG + Intronic
1019235075 6:170605036-170605058 CAGGGGTCTTTCTTTCTCCTTGG - Intergenic
1020407442 7:7853616-7853638 CAGTTGTATTTCTATATACTTGG - Intronic
1021438175 7:20645859-20645881 CCTTTGAAGTTCTTTCTCCTGGG - Exonic
1021486228 7:21171234-21171256 GGGTTGTATTTTTTCCTCCAGGG - Intergenic
1022851156 7:34263778-34263800 CTGTTTTTTTTCTTTTTCCTTGG + Intergenic
1023659266 7:42456154-42456176 CAGTTTTCTTCCTTTCTCCTTGG - Intergenic
1023708916 7:42970953-42970975 GGCTTGTGTTTCTTTTTCCTGGG + Intergenic
1024351592 7:48371221-48371243 CAGTTTTGTTTCTTTCTCTTAGG + Intronic
1028167016 7:87548953-87548975 AGGTTGTATTTTTCTCTTCTTGG + Intronic
1034570005 7:151947890-151947912 TGGTTGCATTTCATTCTTCTAGG - Intergenic
1034730881 7:153386637-153386659 CAGGTGTGTGTCTTTCTCCTTGG - Intergenic
1035513518 8:210930-210952 CAGGGGTCTTTCTTTCTCCTTGG + Intergenic
1041650665 8:60299086-60299108 ATGTAGCATTTCTTTCTCCTGGG - Intergenic
1041700431 8:60782925-60782947 TGCTTTGATTTCTTTCTCCTTGG - Intronic
1043796741 8:84551752-84551774 TGGCTGTATTTCTATCTCCTAGG + Intronic
1044289964 8:90456460-90456482 TGTTTGTAATTCTTTCTCATTGG + Intergenic
1044339083 8:91026280-91026302 CAGTGGTAGTTCTTTCCCCTGGG + Intronic
1045733926 8:105273531-105273553 CTGTTATTTTTCTTTCTCCTTGG - Intronic
1046819500 8:118620674-118620696 TAGTTCAATTTCTTTCTCCTGGG + Intronic
1047390163 8:124444001-124444023 TGGTTGCTTGTCTTTCTCCTTGG - Intergenic
1048921018 8:139230237-139230259 GGGTTGAATCTCTGTCTCCTGGG - Intergenic
1051144960 9:14017048-14017070 GGGTTGTGTCTATTTCTCCTGGG - Intergenic
1051753094 9:20365235-20365257 CAGTTGTATTTATTTCCCTTAGG - Intronic
1052261918 9:26526688-26526710 GGGTTTTATTTCTTTCACTTTGG + Intergenic
1052658775 9:31401281-31401303 CACTTGTTTTTCTTTCTTCTTGG - Intergenic
1052885130 9:33638938-33638960 CGGATCTGTTTTTTTCTCCTGGG - Intergenic
1055877583 9:80961912-80961934 CTGTTGTAGGACTTTCTCCTTGG - Intergenic
1056130175 9:83576931-83576953 CGATTGTATTTCTCTATGCTAGG + Intergenic
1056286126 9:85089613-85089635 TGGTTTAATTTCTTTCACCTGGG + Intergenic
1058383918 9:104410448-104410470 CTGTTGTCTTTTTCTCTCCTAGG + Intergenic
1060202382 9:121659002-121659024 CTGTGCTATTTCTTTTTCCTTGG + Intronic
1203580653 Un_KI270745v1:41807-41829 CAGGGGTCTTTCTTTCTCCTTGG - Intergenic
1185919699 X:4077445-4077467 TGCTTTTAATTCTTTCTCCTGGG + Intergenic
1195977545 X:110543943-110543965 CTGATGGATTTTTTTCTCCTGGG + Intergenic
1199247142 X:145618820-145618842 GCATTGTATTTCTTTCTGCTTGG + Intergenic
1201686919 Y:16715032-16715054 ATGTCATATTTCTTTCTCCTGGG + Intergenic