ID: 1165002871

View in Genome Browser
Species Human (GRCh38)
Location 19:32779363-32779385
Sequence GGTTGTATTTCTTTCTCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 306}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165002868_1165002871 -4 Left 1165002868 19:32779344-32779366 CCTGTAAGTACCAGTAAGCGGTT 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1165002871 19:32779363-32779385 GGTTGTATTTCTTTCTCCTCGGG 0: 1
1: 0
2: 1
3: 29
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165002871 Original CRISPR GGTTGTATTTCTTTCTCCTC GGG Intronic
900267208 1:1763900-1763922 GGTTTTATTTTTTTTTCCTGTGG - Intronic
901247989 1:7748396-7748418 GGTTTTATTTTGTTTTCCTCTGG - Intronic
906656683 1:47553341-47553363 GTTTGTCTGGCTTTCTCCTCTGG + Intergenic
908046211 1:60171894-60171916 AGTTGTATTTATTTGTCCTTAGG + Intergenic
909483475 1:76150081-76150103 GGCTGCGTTTCCTTCTCCTCAGG + Intronic
910226726 1:84943475-84943497 GGTTCTGTTTGCTTCTCCTCTGG - Intronic
911637340 1:100249685-100249707 TGGTGTTTTACTTTCTCCTCCGG - Intronic
912524293 1:110269376-110269398 GGTTTTATTTTTCTCCCCTCTGG + Intronic
913479766 1:119276766-119276788 GGTGGAATTTCTTCCTCTTCAGG + Intergenic
914844836 1:151277039-151277061 GGTTACATTTTTTTCTCATCAGG - Intergenic
914859960 1:151377724-151377746 TGATGTAATTCTTTCTTCTCAGG - Intergenic
914964980 1:152248167-152248189 GGGTGAATTTTTTTCTTCTCTGG + Intergenic
915128951 1:153683974-153683996 CCTTCTCTTTCTTTCTCCTCTGG - Intronic
915217811 1:154351823-154351845 AGCTATACTTCTTTCTCCTCAGG - Intergenic
915328406 1:155093201-155093223 GGTTGTTTTTGTGTCTCCTGTGG - Intergenic
915983409 1:160438286-160438308 GGTATTTGTTCTTTCTCCTCTGG - Intergenic
916331450 1:163622165-163622187 GGTTATATCTTTTCCTCCTCTGG + Intergenic
917097616 1:171414911-171414933 GGAAGTATTCCTTTCTCCTCAGG - Intergenic
917136929 1:171796810-171796832 CGTTGTATTTCTTCATTCTCTGG - Exonic
917768926 1:178254688-178254710 TGTTGGAATTCTTTCTTCTCAGG + Intronic
918087763 1:181259946-181259968 GGCACAATTTCTTTCTCCTCAGG + Intergenic
921923853 1:220695624-220695646 GGATGAATTTCTCTCTCCCCCGG - Intronic
922128901 1:222757295-222757317 GGCAGAATTTCTTTCTCTTCAGG - Intergenic
922435542 1:225601604-225601626 GGATGTATTTCTTTGACCTAAGG - Intronic
1063640123 10:7820880-7820902 GCTTTTGTTTCTTTTTCCTCTGG + Intronic
1064540590 10:16401506-16401528 GGTTTTTTTTTTTTCTTCTCTGG - Intergenic
1067548133 10:47211211-47211233 CTGTCTATTTCTTTCTCCTCAGG + Intergenic
1069858750 10:71457061-71457083 GGATGAGTTTCTTCCTCCTCGGG - Intronic
1070794081 10:79206962-79206984 GGTTTTATTTCTTTCGCTTAAGG - Intronic
1072208444 10:93224860-93224882 GGTTTTCTTTCTCTCTCCTCTGG + Intergenic
1072245888 10:93543455-93543477 GGTGCTAACTCTTTCTCCTCGGG - Intergenic
1074682246 10:115919064-115919086 GGTGGTATTTCTTCTTCCTATGG - Intronic
1076476113 10:130752601-130752623 GCTTGCCTTTCATTCTCCTCAGG - Intergenic
1078865600 11:15294485-15294507 GGTTTATTTTGTTTCTCCTCTGG + Intergenic
1079947398 11:26761323-26761345 GTTTCTATTTCTTTCTTCCCAGG - Intergenic
1079987724 11:27216077-27216099 AGGTTTATTTCTGTCTCCTCTGG + Intergenic
1080887908 11:36383279-36383301 GGCTGTATTTCTTTTTCTTGAGG + Intronic
1081198457 11:40189391-40189413 GGTTATATTTTTTTGTCCTAGGG - Intronic
1081632866 11:44701408-44701430 GTTTTTATTTCTGTCTCCTTGGG + Intergenic
1082704423 11:56476232-56476254 GGCAGTTTTTCCTTCTCCTCTGG + Intergenic
1082722974 11:56701322-56701344 GGTCGTCTTTGTTTCTCCTCTGG - Intergenic
1084310666 11:68314312-68314334 AGCTATAATTCTTTCTCCTCAGG - Intronic
1085016365 11:73176816-73176838 GCTTGTATTCATTGCTCCTCAGG - Intergenic
1086246565 11:84760456-84760478 GGTTGTCTTTCTCTCCCCTAAGG - Intronic
1086402049 11:86469089-86469111 GGCTGGATTTCTTTCTCCATTGG + Intronic
1087613335 11:100460255-100460277 GGATGTGTTTCTTTTTCCTAAGG + Intergenic
1088291261 11:108240209-108240231 GGTCATATTTTTTTTTCCTCTGG + Intronic
1089890813 11:121878972-121878994 GGTGATTTTTTTTTCTCCTCAGG + Intergenic
1089939481 11:122400414-122400436 CCTTTTATTTCTTTCTCTTCAGG - Intergenic
1090477487 11:127036756-127036778 TGTTGAATGTCTTTCTCCTCCGG + Intergenic
1092988672 12:13873701-13873723 GGAGATATTTCTTTCTCCACTGG - Intronic
1093674795 12:21925860-21925882 GGTTATTTTTCTTTTTCCTCAGG - Intronic
1096128573 12:49138710-49138732 GGTTGCATTTATTTGTCCCCGGG - Intergenic
1096843373 12:54391940-54391962 GCTTCTATTTCCATCTCCTCAGG - Intergenic
1098330861 12:69351708-69351730 ATTTGTATTTTTTTCTCATCTGG - Intronic
1099928326 12:89044623-89044645 AGTTGTAGTTGTTTGTCCTCAGG - Intergenic
1100178818 12:92061299-92061321 AGTTTTATTTCTGTGTCCTCTGG + Intronic
1101014751 12:100488304-100488326 TGTTGTTTTTCTTTCTGATCTGG + Intronic
1101061086 12:100972726-100972748 GGTTTTCTTTCTTTCTCTTTCGG - Intronic
1101061694 12:100979088-100979110 TGTTCTTTTTCATTCTCCTCAGG - Intronic
1101582731 12:106057995-106058017 AAATGTATTTCTTTCTCTTCTGG + Intergenic
1101707741 12:107236283-107236305 GGTTACATTTCTTTCTTCCCAGG - Intergenic
1103885309 12:124196020-124196042 GGGTTTTTTTTTTTCTCCTCAGG + Intronic
1104098370 12:125582580-125582602 GGTTGACTCTCTTTCTCTTCAGG + Intronic
1104164073 12:126209468-126209490 AGTAGTATTTCTTTCTTCTAAGG - Intergenic
1104273447 12:127303778-127303800 TTTTTTATTTCTTTTTCCTCTGG + Intergenic
1104816765 12:131650742-131650764 GGCTGTATTTCTAGCTACTCAGG + Intergenic
1105588747 13:21771006-21771028 GGTTTTTTTTCTTTCCCCTGTGG + Intergenic
1106323236 13:28661845-28661867 TGTTGTTTTTCCTTGTCCTCAGG + Intronic
1107551801 13:41483471-41483493 AATTTTATTTATTTCTCCTCTGG + Intergenic
1108039546 13:46326743-46326765 GGTGGAATTTCTTCTTCCTCAGG - Intergenic
1110004515 13:70249575-70249597 GGTTTTGTTTCTCTCTCCCCTGG + Intergenic
1111808314 13:93066016-93066038 TGTAGAATTTCTTCCTCCTCAGG + Intergenic
1112712306 13:102143530-102143552 GTGTGTATTTTTTTCCCCTCAGG - Intronic
1112762299 13:102705072-102705094 GCTTTTATTTCTTTCTTCTTTGG - Intergenic
1113063556 13:106351035-106351057 GGTTGTATCTCTTTGTCTTTTGG + Intergenic
1113136827 13:107099999-107100021 GGTCATATTTCTTTCTCCTGGGG + Intergenic
1114466774 14:22928854-22928876 AGTAGAATTTTTTTCTCCTCAGG + Intronic
1116022935 14:39483645-39483667 AGTTTTCTTTTTTTCTCCTCCGG + Intergenic
1116408493 14:44595210-44595232 GATTGTATCTAATTCTCCTCTGG - Intergenic
1117267574 14:54105937-54105959 GGTAGTATTGCCTTCTGCTCAGG - Intergenic
1118468438 14:66052999-66053021 GGTGGTTTTTCTTTCTCTTAAGG + Intergenic
1119697920 14:76728662-76728684 TTTTCTATTTCTCTCTCCTCTGG - Intergenic
1119775629 14:77246608-77246630 GTTTGGATGTCTTTCTCCGCTGG + Exonic
1121364272 14:93292779-93292801 GGTTGTAGTTCTATCTACTTGGG - Intronic
1122243914 14:100387731-100387753 GGTGGTAGCTCTTTCTGCTCAGG - Intronic
1124133925 15:27017325-27017347 GGGTGTGTTGCTTTCTACTCAGG + Intronic
1124885269 15:33679381-33679403 GATTTTATTTCTTCATCCTCAGG + Intronic
1125139017 15:36381273-36381295 GTTTGCATTTTTTTCTACTCTGG + Intergenic
1125372527 15:38993751-38993773 GATTGGATTTCTTGCTTCTCTGG - Intergenic
1125892228 15:43275369-43275391 TTTTGTATTTCTTTCTCCTGTGG - Intergenic
1126743720 15:51803821-51803843 GTTTATATTTCTTTTTTCTCAGG - Intronic
1127214766 15:56812738-56812760 GGTTTTATCTCTTTCGACTCAGG + Intronic
1128501681 15:68231125-68231147 GGATTTATTTCTTTCCCCTTTGG + Intronic
1128604053 15:69022395-69022417 AATTGTATTTCTTTCTCAACTGG - Intronic
1128773288 15:70300067-70300089 GGTGGAGTTTCTTCCTCCTCAGG + Intergenic
1130823860 15:87523331-87523353 GGTTTCATTTCTTTTTCTTCTGG - Intergenic
1131056124 15:89376195-89376217 CTTTTTATTTCTTTCACCTCAGG + Intergenic
1131884377 15:96895606-96895628 CTTTGTCTTTTTTTCTCCTCAGG + Intergenic
1133880910 16:9780824-9780846 GTTTGTATTTTTCTCTCCTCTGG - Intronic
1134101300 16:11453648-11453670 TGTTCTATTTCTTTGTCCTTTGG - Intronic
1134791041 16:16989524-16989546 GATTGTATTTCCTTCTCTCCTGG - Intergenic
1135904415 16:26498020-26498042 GTTTGTAGTTCTTGTTCCTCCGG - Intergenic
1137921711 16:52495524-52495546 GGGAGTATTACTTTCTCCTCTGG + Intronic
1138137791 16:54538511-54538533 AGGGGTATTTTTTTCTCCTCTGG + Intergenic
1140939020 16:79703490-79703512 GGCTGTATTCCTTGCTACTCAGG - Intergenic
1142210082 16:88804601-88804623 GGGTGGATTTCTTTATCTTCTGG - Exonic
1146439467 17:32881254-32881276 GGCTGTGTTTATTTCTCCCCTGG + Intergenic
1146969624 17:37062195-37062217 GGATTTATTTCTTGCTCCCCAGG + Intergenic
1147181938 17:38691973-38691995 TGTTGTCATTCTTTCCCCTCGGG - Intergenic
1149961976 17:61119925-61119947 GGTTCTATATCTTTCTTCTTAGG - Intronic
1149970677 17:61214952-61214974 GGCTGTATTTCTTTTTCTTGAGG - Intronic
1150074732 17:62182793-62182815 ATTTGTATTTCTTGCTCATCTGG + Intergenic
1150716845 17:67579390-67579412 AGCTGTATTTTTCTCTCCTCTGG - Intronic
1151355624 17:73556393-73556415 CATTGTATTTCTTTCCCATCTGG - Intronic
1152018050 17:77764952-77764974 GGGTGTCTTTCCTGCTCCTCTGG - Intergenic
1152556390 17:81055224-81055246 GGTTGGAGTGCTTTCTCCCCAGG - Intronic
1153533076 18:6069429-6069451 TGTTGTTTTTTTTTTTCCTCAGG + Intronic
1153716206 18:7851448-7851470 GGTGGAATGTCTTTCTTCTCTGG - Intronic
1153798015 18:8642495-8642517 GGTTCTCTTTCTATCTCCTGGGG + Intergenic
1155009688 18:21764391-21764413 GTTTGTTTTTCTTTCTTATCGGG + Intronic
1155488761 18:26376633-26376655 AGTTGTATTTCTTTCACTTCTGG + Intronic
1155749774 18:29407047-29407069 GGTTGGATTTTTTTCCCCTTTGG - Intergenic
1155767104 18:29649604-29649626 GGTTGTGTTTCTCTCTGCTCTGG + Intergenic
1156075374 18:33270776-33270798 GGTTGTCTTTATTTCTTCTGTGG - Intronic
1157061678 18:44299493-44299515 GGATGTTTTTCCCTCTCCTCTGG - Intergenic
1157724865 18:49956565-49956587 GATTTTTTTTCTTTCTCCTGTGG - Intronic
1158281968 18:55838359-55838381 TGTAGTATTTCTGTTTCCTCAGG - Intergenic
1158649816 18:59274415-59274437 GCTTGCAGTTCTTTCTCCTTTGG + Intergenic
1159312272 18:66724620-66724642 AGTTTGATTTCTTTCTCATCTGG - Intergenic
1162788641 19:13051800-13051822 GGTTGTGTTTCTTTAACCCCTGG - Intronic
1163193376 19:15696484-15696506 GCTTTTATTCCTTTCTCCGCAGG + Exonic
1163394467 19:17051222-17051244 TGTGGCATTTCTTTCTCCTGTGG - Intronic
1165002871 19:32779363-32779385 GGTTGTATTTCTTTCTCCTCGGG + Intronic
1165426126 19:35746397-35746419 GTTTGTTTTTCTTTCTCCCTAGG + Exonic
1165863315 19:38920436-38920458 CGTGGTGTTTCCTTCTCCTCTGG - Intronic
1166039212 19:40191870-40191892 GGTTTTTTTTCTTGCTCCTGCGG + Exonic
1166843062 19:45710857-45710879 GGTTGTTTTTCCTTCCACTCTGG - Exonic
1167058770 19:47130488-47130510 GTTTATATTTATTTCTCTTCGGG + Intronic
1168507935 19:56951914-56951936 GGTGGAATTTATTTTTCCTCAGG - Intergenic
928482822 2:31699939-31699961 GGTTTTATTTCTTCCTCATTTGG - Intergenic
928634164 2:33226190-33226212 GGATTTTTTTCTTTCACCTCTGG + Intronic
928739459 2:34332906-34332928 GGTTTTTTTTTTTTCCCCTCTGG + Intergenic
929292078 2:40204466-40204488 GGTTGTTTTTCTTTCAGCTAAGG - Intronic
931226144 2:60333826-60333848 GGTGGTATTTCTTCTTTCTCAGG - Intergenic
931967889 2:67553668-67553690 GGTGGAATTTCTTTCCCCTGAGG + Intergenic
931986815 2:67750231-67750253 GGTTGTTTTTTTTTTTCCTAGGG + Intergenic
932724275 2:74164691-74164713 TGTTGTATATCTTTTTCCCCGGG - Intronic
932852782 2:75202125-75202147 GGTTGTTTTTCTTTCTACTCCGG + Intergenic
933402509 2:81817042-81817064 GGTTCAATTTTTTTTTCCTCTGG - Intergenic
935083737 2:99824573-99824595 GTGTGTATTTCTCTCTCCCCTGG - Intronic
935397667 2:102624953-102624975 GTCTGTTTTTCTTTGTCCTCTGG + Intronic
938247670 2:129791626-129791648 GGTTCTTTTTCTTTTGCCTCAGG - Intergenic
939435917 2:142177666-142177688 TGTTGTACTTCTTACTCCTTTGG - Intergenic
940104833 2:150087311-150087333 GGTTTTGTTTCTTACTCCACAGG - Intergenic
941022846 2:160427819-160427841 AGTTGAATTTCATTCTCTTCAGG + Intronic
942177022 2:173344117-173344139 GCTTGTAGTTCTTGCTACTCGGG + Intergenic
942855201 2:180537440-180537462 ATTTGTTTTTCTTTTTCCTCTGG - Intergenic
942863735 2:180647422-180647444 GGTTGTAAATCTTTTTCCTGAGG - Intergenic
942966271 2:181896119-181896141 AGTTCTACTTCTTTGTCCTCTGG + Intronic
943569333 2:189554811-189554833 GATTACATTTCTTTCTCCTGAGG - Intergenic
944509289 2:200448576-200448598 GGCTCTATCTCTTTCTGCTCTGG + Intronic
945903453 2:215564654-215564676 GGTAGAATTTCTTTTTGCTCGGG + Intergenic
946379391 2:219334864-219334886 GGTAGTCTTTCTTTCTTCTTGGG - Intergenic
1168995821 20:2132482-2132504 GGATGAAGTTCATTCTCCTCAGG - Intronic
1169696498 20:8393283-8393305 TATTGTATTTTTTTTTCCTCAGG + Intronic
1169884826 20:10387524-10387546 GGGTGAATTACTTTCTCTTCAGG + Intergenic
1169909641 20:10636980-10637002 GGATGTTTTTCTTTGTTCTCGGG - Intergenic
1171404126 20:24898328-24898350 GTTTGTTTTTCTTTCTCTACTGG - Intergenic
1171880533 20:30614986-30615008 GGTTGGGCTGCTTTCTCCTCTGG - Intergenic
1172090602 20:32429448-32429470 GGTTGTGATGCTTTTTCCTCAGG + Intronic
1172879074 20:38186636-38186658 GGTTTTATTTCTTTCCCATCTGG + Intergenic
1173315176 20:41936699-41936721 GACTGTATTTTTTTTTCCTCAGG + Intergenic
1175301428 20:57945972-57945994 GGTTGTGTGTCCTTCTCCCCAGG - Intergenic
1176213116 20:63935080-63935102 GGTTGTAAATCATTCTCCTGTGG + Exonic
1177083480 21:16672172-16672194 GGTTGTTTTTCTCTGTCCCCTGG + Intergenic
1177810237 21:25917821-25917843 GGTTGTTTTTCTTTTTTTTCTGG - Intronic
1178022380 21:28423986-28424008 GGTTTTATTTATGCCTCCTCAGG + Intergenic
1178071485 21:28972898-28972920 GGTAGTTTATCTTTCTCCTTGGG - Intronic
1181810946 22:25403714-25403736 AGCTGTAGTTCTTTCTCCTTAGG + Intronic
1184164956 22:42721496-42721518 GCTTTTAGTTCTTACTCCTCTGG + Intergenic
1184211613 22:43039234-43039256 GGTAGTATTTCTCCCACCTCAGG - Intergenic
949327564 3:2883696-2883718 CTTTGGATTTCCTTCTCCTCTGG + Intronic
949378821 3:3421627-3421649 GGTTTGATTTCTTTGTTCTCTGG + Intergenic
949678344 3:6484201-6484223 GGTAATATTTCATTATCCTCTGG + Intergenic
952198697 3:31102689-31102711 GCTTGTATTACTCACTCCTCAGG - Intergenic
953528155 3:43712799-43712821 GCTTTTATTTCTTTTTGCTCAGG - Intronic
955066613 3:55538647-55538669 GTTTTTCTTTCTGTCTCCTCAGG + Intronic
955568326 3:60274039-60274061 AGTTCTAGTTCTTTCTCCTTAGG + Intronic
955894020 3:63679807-63679829 GGTTTTATTTCTCCCCCCTCAGG - Intergenic
956979325 3:74617137-74617159 TGTTCTATTTCTTTTTCCTTTGG - Intergenic
957322833 3:78653973-78653995 TGTTGTATTTCTTTCTAGTTTGG - Intronic
957487672 3:80883572-80883594 ACCTGAATTTCTTTCTCCTCAGG - Intergenic
958616138 3:96494998-96495020 GGTTCTAGTTCATGCTCCTCAGG + Intergenic
958967668 3:100576903-100576925 AGATGCTTTTCTTTCTCCTCAGG + Exonic
959282464 3:104362403-104362425 AGATGAATTTTTTTCTCCTCAGG - Intergenic
959379909 3:105629380-105629402 GGTGGAATTTCTTCTTCCTCGGG + Intergenic
959508426 3:107180298-107180320 AGTTTTATTTCTTTCTAATCTGG - Intergenic
960674051 3:120177792-120177814 TGTTTTTTTTTTTTCTCCTCTGG - Intronic
961996645 3:131252356-131252378 GTCTGTTTTTCTTTCTTCTCTGG - Intronic
962005544 3:131345689-131345711 GGTGGTATTTTCTTCTCCTTTGG - Intronic
962682288 3:137812933-137812955 TGTTCTTTTTCTTTCTGCTCTGG + Intergenic
963035714 3:141026363-141026385 GCTTCATTTTCTTTCTCCTCTGG + Intergenic
964504130 3:157380021-157380043 GGTTTTATTTGTTTTTGCTCTGG - Intronic
966526168 3:180921823-180921845 TGTTGTATTTTTTTTTCCCCTGG + Intronic
967055822 3:185827120-185827142 GGATTCATTACTTTCTCCTCTGG - Intergenic
967589364 3:191254924-191254946 GGGTGAATTTCTCTCTTCTCAGG + Intronic
967914041 3:194564956-194564978 GGTGGAATTTCTTTTTCCTCAGG + Intergenic
968650409 4:1758121-1758143 GCCTGTATTTCCTTCTCCCCGGG - Intergenic
969469211 4:7377164-7377186 GTTTGTCTTTTTTTTTCCTCCGG + Intronic
970437180 4:16047114-16047136 GGCAGGATTTCTTCCTCCTCAGG + Intronic
971967213 4:33575750-33575772 GGTTTATTTTCTTTCTCTTCTGG + Intergenic
972387137 4:38578119-38578141 GGTAGAATTTCTTCTTCCTCAGG + Intergenic
972533866 4:39983570-39983592 GGTTTTATTTTTTTCTCTTCTGG - Intergenic
972695639 4:41443282-41443304 TGTTTTTTTTCTTTCTGCTCTGG + Intronic
974596202 4:64016821-64016843 GATTTTGTTCCTTTCTCCTCTGG - Intergenic
974803377 4:66847942-66847964 GTTTTTTTTTCTTTTTCCTCTGG + Intergenic
975586719 4:75957387-75957409 GGGTGAATTACTTTCTCTTCGGG - Exonic
975696916 4:77022778-77022800 AGTTGTGTTTCTTTCAACTCAGG + Intronic
978976596 4:114882845-114882867 GGTAATGTTTCTTTTTCCTCTGG - Intronic
980673390 4:136041322-136041344 GTTTCTATTTCTATGTCCTCAGG + Intergenic
980953757 4:139407774-139407796 GGATGCATTTCTTTCTGCCCTGG + Intronic
981959569 4:150520384-150520406 GGTTTTATTTTTTTTTCCTTAGG + Intronic
982376732 4:154699313-154699335 AGTTGCAAGTCTTTCTCCTCGGG + Intronic
985250025 4:188014556-188014578 GGTTGTTTTTCTGTCTTCTTTGG - Intergenic
986258889 5:6125321-6125343 GGTTCTCTTTCTTTCTCATTGGG - Intergenic
986323161 5:6650054-6650076 TGTTGTCTTTCTTTCTTCTCGGG + Intronic
987238700 5:15970209-15970231 TGTTGTCTTCCTTTATCCTCAGG + Intergenic
987445558 5:18014570-18014592 GTTTATATTTCTTTCTACTTGGG + Intergenic
989360764 5:40598852-40598874 AATTTTCTTTCTTTCTCCTCTGG - Intergenic
989420856 5:41238517-41238539 GGTTTTATTACTTTCGCTTCTGG - Intronic
989432736 5:41374702-41374724 CCTTGTTGTTCTTTCTCCTCAGG + Intronic
990878368 5:60512632-60512654 GGTTGAATTTCCTTTTCCTTAGG - Intronic
991198729 5:63963888-63963910 GATTGCATTCCTTTCACCTCAGG - Intergenic
991994843 5:72376781-72376803 GGTTGTATTGCTGTTTCCTTGGG + Intergenic
992141924 5:73807126-73807148 GGAGGGATTTCTTTCTCCTTAGG + Intronic
992962600 5:81971563-81971585 AGTTTTTTTTTTTTCTCCTCTGG + Intergenic
993011852 5:82492191-82492213 GGTGGTATTTCTCACACCTCTGG - Intergenic
993563785 5:89446921-89446943 TCTTGTTTTTCTTTCTCCTCTGG + Intergenic
993617765 5:90134793-90134815 GGTTCTAATTATTTCTCCACTGG + Intergenic
993666460 5:90704437-90704459 TGGTATACTTCTTTCTCCTCAGG - Exonic
993815375 5:92538231-92538253 GTTTGTATTTCTTCATCCTTGGG + Intergenic
993907033 5:93634433-93634455 GCTTGTCTTTTTTTCTCCTGTGG - Intronic
995460523 5:112398700-112398722 GGTTTTCTTTCTTTCACCTGAGG + Intronic
996133722 5:119812890-119812912 GTTTTTATTTCTGTCTCCTCGGG + Intergenic
996253663 5:121370682-121370704 CATTGTAATTCTTTTTCCTCAGG + Intergenic
997664476 5:135618621-135618643 AGTTATTGTTCTTTCTCCTCTGG + Intergenic
997727676 5:136135113-136135135 TGTTGGATTTCTTTCCCCTCTGG + Intronic
1000392709 5:160741973-160741995 AGCTGTATTTCTTCCTCATCGGG - Intronic
1000785038 5:165532613-165532635 GGTAGTATTGGTTTCTCCTAAGG - Intergenic
1001849911 5:174954598-174954620 GGATGAATTTCTTGCTTCTCTGG - Intergenic
1003767219 6:9252628-9252650 TGTTGTTTTTTTTTTTCCTCCGG - Intergenic
1004422494 6:15484197-15484219 TGTTGTATTTCTTTTTGCTCAGG + Intronic
1004843019 6:19608465-19608487 GGCAGAATTTCTTCCTCCTCGGG + Intergenic
1005009280 6:21320931-21320953 GGCTGTGTTTCTTTCTCTGCAGG - Intergenic
1007207703 6:40165886-40165908 TGTTTTTTCTCTTTCTCCTCTGG - Intergenic
1007334569 6:41144462-41144484 GGTTTTCTTTCTTTCTAATCTGG + Intergenic
1008000063 6:46350963-46350985 GTCTGTGTTTCTGTCTCCTCTGG + Intronic
1008109790 6:47478917-47478939 CCTTGTATTTTTCTCTCCTCCGG - Intronic
1008622340 6:53282862-53282884 GGTTGTTTTTCTTTCCCTTCAGG - Intronic
1009510996 6:64549585-64549607 ATTTTTATTTCCTTCTCCTCTGG + Intronic
1010797089 6:80129755-80129777 GGCTGAATTTCTTTTTGCTCGGG + Intronic
1011396342 6:86913059-86913081 TGTTGGTTTTCTTTCTCCTTAGG + Intergenic
1011437565 6:87354999-87355021 GGTTTTATTCCTTTCTATTCTGG + Intronic
1011728355 6:90233874-90233896 GGTCCTCTTTCTTTCTGCTCAGG - Intronic
1012447443 6:99321260-99321282 GGTTGTATATCTGACTCATCAGG - Intronic
1013669215 6:112380609-112380631 GGCTTTCTTTCTTTCTCCACTGG + Intergenic
1014538559 6:122647185-122647207 GGTAGAATTTCTTTTTCCTCAGG + Intronic
1014861894 6:126479101-126479123 GGTTTTATCTCTTTCTTCTCTGG + Intergenic
1016209287 6:141508279-141508301 GCTTGTTTTTCTTTCTCCAAGGG - Intergenic
1016433544 6:144012145-144012167 GGTTGTACTTTTTTCTTCTTTGG + Intronic
1016622871 6:146132974-146132996 AGTTGTCTTTCTATGTCCTCTGG + Intronic
1018818063 6:167350752-167350774 GGTTGTGGTTCTTTCTCATTTGG + Intronic
1023161521 7:37301270-37301292 GCTTATTTTTCTTTCTCCTCTGG - Intronic
1023504132 7:40882349-40882371 GGTTGGATTTCTTTATGGTCAGG + Intergenic
1024054189 7:45649024-45649046 GGCTGTATTTCTTTGTCCACAGG + Intronic
1026164523 7:67898182-67898204 GGTTTTTCATCTTTCTCCTCTGG - Intergenic
1026431028 7:70347484-70347506 GATGTTTTTTCTTTCTCCTCTGG + Intronic
1026505220 7:70976785-70976807 GGTGGTATTTATGTCTCCTTTGG - Intergenic
1027025693 7:74850603-74850625 GGTTGGAGTTTCTTCTCCTCGGG + Intronic
1028035892 7:85981614-85981636 GGATATATTTCTTGCTCTTCAGG - Intergenic
1028528800 7:91815367-91815389 GTATGTATTTCATTCTACTCTGG + Intronic
1029575709 7:101402022-101402044 GGGTTTATTTCATTCTCCCCTGG + Intronic
1030302920 7:107992349-107992371 GCAAGTATATCTTTCTCCTCTGG + Intronic
1030950809 7:115789105-115789127 GGTTGTCTTTCTTCCTTCTTAGG - Intergenic
1031140347 7:117935951-117935973 GGTGGAATTTCTTCCTCCTCAGG - Intergenic
1033024197 7:137757012-137757034 TTTTGTATTTGTTTCTTCTCTGG + Intronic
1033770193 7:144541965-144541987 GGTTGTCTTTTTTTTTCCTGTGG - Intronic
1036040217 8:5070353-5070375 AGTTGTATTTCTTCCTTTTCAGG - Intergenic
1036122959 8:6037898-6037920 GGATGTATTTCGTTCTCATTAGG + Intergenic
1036744465 8:11394668-11394690 GGGTGAATTCCTTTCTTCTCAGG + Intronic
1037335271 8:17785799-17785821 TGGTGTATTTCTTTCTCTCCTGG - Intronic
1037725206 8:21477624-21477646 GATGGGATTTCTTTCTCATCAGG + Intergenic
1038303667 8:26379657-26379679 GGGTGAATTACTTTCTCTTCCGG - Intergenic
1039404463 8:37300770-37300792 GGTAGAGTTTATTTCTCCTCTGG + Intergenic
1041498508 8:58513825-58513847 AGTAATATTTTTTTCTCCTCTGG + Intergenic
1041700430 8:60782924-60782946 GCTTTGATTTCTTTCTCCTTGGG - Intronic
1042804760 8:72759288-72759310 GGTGGTATTCTTTTCTCCACAGG - Intronic
1046381974 8:113463345-113463367 GGTTGTCTTTCTTCCCCCACTGG - Intergenic
1046597528 8:116278626-116278648 GATTTTATTTTTTTTTCCTCTGG - Intergenic
1046819501 8:118620675-118620697 AGTTCAATTTCTTTCTCCTGGGG + Intronic
1047390162 8:124444000-124444022 GGTTGCTTGTCTTTCTCCTTGGG - Intergenic
1048000133 8:130372563-130372585 GGTTTTCCTTCTTTCTCATCAGG + Intronic
1048439314 8:134448216-134448238 AGTAGTGTCTCTTTCTCCTCAGG + Intergenic
1051453805 9:17229559-17229581 GGTAGAATTTCTTCCTCCTCTGG + Intronic
1051544671 9:18260567-18260589 GCTGGATTTTCTTTCTCCTCAGG - Intergenic
1051576095 9:18617273-18617295 GGTGATCTTTCTTTCTCCTGTGG + Intronic
1051668156 9:19484587-19484609 TGTTGGAGGTCTTTCTCCTCTGG - Intergenic
1051725309 9:20082815-20082837 GTTTGTTTTTCTTTTTCCTGTGG - Intergenic
1051994567 9:23199886-23199908 GGTTTTATTTTCTTCTCCCCAGG + Intergenic
1055865433 9:80808056-80808078 TTTTGTATTTCTCTCTCCTTCGG - Intergenic
1056675684 9:88675139-88675161 GGCAGAATTTCTTCCTCCTCAGG - Intergenic
1056896740 9:90558526-90558548 AGTTTTATTTCATTCTACTCTGG + Intergenic
1057083265 9:92188417-92188439 GGGGTTATGTCTTTCTCCTCTGG - Intergenic
1058467263 9:105242015-105242037 GGTTGTTTTTCTTTTTCTTTTGG - Intergenic
1058974818 9:110115927-110115949 GATGGTTTTTCTTTCTCCTCTGG + Intronic
1059861658 9:118470309-118470331 GGTTCTAGGACTTTCTCCTCTGG - Intergenic
1185919700 X:4077446-4077468 GCTTTTAATTCTTTCTCCTGGGG + Intergenic
1187981810 X:24765223-24765245 GGTTGTATTTTTCTCTCTTCAGG + Intronic
1188635664 X:32427794-32427816 GATTAAATTTCTGTCTCCTCAGG + Intronic
1188887011 X:35562892-35562914 GATTTTGTTTCTTTCTTCTCAGG - Intergenic
1192443273 X:71190928-71190950 AGTTGACTTTCTTTCTCCCCAGG + Intergenic
1192671470 X:73147277-73147299 GATTCTATTTATTTCTGCTCTGG + Intergenic
1193643955 X:84044421-84044443 GGTTTTATTGCCTGCTCCTCTGG + Intergenic
1194607059 X:95993706-95993728 AATTTTATTTCTTTCTTCTCAGG - Intergenic
1196795427 X:119498402-119498424 AATTGTATTTATTTCTGCTCTGG - Intergenic
1196819419 X:119691200-119691222 GGTTGTGTGTGTTTCACCTCAGG - Intronic
1197024688 X:121734668-121734690 GGTTAGATGACTTTCTCCTCTGG + Intergenic
1197678838 X:129360628-129360650 AGTTCAATTTCTATCTCCTCTGG - Intergenic
1197991433 X:132322376-132322398 GTTTGTATTTCTGTATCCTCAGG - Intergenic
1198445821 X:136713075-136713097 GCTTGGCTTTCTTTCTCTTCTGG - Intronic
1198978243 X:142361900-142361922 GGCAGAATTTCTTTTTCCTCAGG + Intergenic
1199219812 X:145305351-145305373 TGCTGAATTTTTTTCTCCTCTGG + Intergenic
1199605095 X:149571402-149571424 GGGTGAATTTCTCTCTTCTCGGG + Intergenic
1200138733 X:153886884-153886906 TGTCTTATTTCTTTGTCCTCGGG + Intronic
1200378132 X:155806026-155806048 GCTTTTATTTTTTTCTCCTTTGG + Intergenic
1201969561 Y:19776526-19776548 GGTAGTCTTTCCTTATCCTCAGG - Intergenic