ID: 1165005478

View in Genome Browser
Species Human (GRCh38)
Location 19:32802908-32802930
Sequence AGGAGAACCCTGAAAATTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165005478_1165005486 23 Left 1165005478 19:32802908-32802930 CCCCCAATTTTCAGGGTTCTCCT 0: 1
1: 0
2: 2
3: 23
4: 205
Right 1165005486 19:32802954-32802976 CAAATCTGTCTTGCTGCTGACGG 0: 1
1: 0
2: 1
3: 21
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165005478 Original CRISPR AGGAGAACCCTGAAAATTGG GGG (reversed) Intronic
900805400 1:4764070-4764092 TGGAGAACCAGGAAAGTTGGTGG - Intronic
903836601 1:26207447-26207469 AGGCTAACTCAGAAAATTGGAGG - Intergenic
904983397 1:34525150-34525172 AGGAGAACCCTGCAAAGAGATGG - Intergenic
907251970 1:53145688-53145710 TGGAGAATCCTCAAAGTTGGAGG + Intergenic
907855864 1:58303074-58303096 AGGAAGACGCTGGAAATTGGAGG + Intronic
908387423 1:63655559-63655581 AGGACAACCCCCAAAAATGGAGG + Intronic
908992955 1:70115917-70115939 AAGAGCCCCCTGAAAATTAGGGG + Intronic
909398491 1:75197752-75197774 AGGAAACCCCTGAAAACTGCAGG - Intergenic
910437856 1:87223632-87223654 AAGAGAACCCATAAAATAGGAGG - Intergenic
911290240 1:96048774-96048796 TGGAGAACCAGGAAAGTTGGTGG + Intergenic
913172305 1:116243886-116243908 AGGAAAACCCCAACAATTGGAGG - Intergenic
915304174 1:154968559-154968581 AGGAGTAACCTGAAATTTGCTGG - Exonic
916179750 1:162073017-162073039 TGCAGAACCCTGAAAATGAGTGG - Intronic
916845367 1:168644905-168644927 TGGAGAACCAGGAAAGTTGGTGG + Intergenic
917442930 1:175082789-175082811 AGGGGAAGCCTGAGAATTGGAGG + Intronic
917637563 1:176951587-176951609 AGGAGAACTCTGAAAAAAGCGGG - Intronic
919317223 1:195987134-195987156 AGAAGAACCAGGAAAATGGGTGG - Intergenic
919484190 1:198126992-198127014 AGGAGATACCTGAACATTGGTGG - Intergenic
921373094 1:214445758-214445780 AGGGGAAGCCAGAAAATTGCTGG - Intronic
921567455 1:216737215-216737237 AGCAAAAGCCTTAAAATTGGTGG + Intronic
921781207 1:219166965-219166987 AGTAGACCCCTTGAAATTGGTGG - Intergenic
923915366 1:238497338-238497360 AGGAGAATTCTGAAGATTTGGGG - Intergenic
1063064379 10:2593914-2593936 AGGAGAACTCTGCAAAATCGTGG + Intergenic
1064360515 10:14660128-14660150 GGGAGAATCCTGTAAGTTGGAGG - Intronic
1064711246 10:18128235-18128257 AGGAGCACTGTGAGAATTGGTGG + Intergenic
1066463945 10:35637483-35637505 AGGAAAACGCTTTAAATTGGGGG + Intergenic
1067786455 10:49252942-49252964 AGGTGAACATTGAAAAGTGGTGG - Intergenic
1069359178 10:67622435-67622457 TGGAGAACCCTGAAAAAGAGGGG + Intronic
1069372022 10:67758177-67758199 TGGAGAACCAGGAAAACTGGTGG - Intergenic
1071532860 10:86402242-86402264 AGGGGATCCCTGAGAAATGGGGG + Intergenic
1073586535 10:104715985-104716007 AGGAGACTCCTGTAAATGGGTGG - Intronic
1075328022 10:121550258-121550280 AGGAGAACTCTGGCAATGGGAGG - Intronic
1078318570 11:10312341-10312363 TGGAGAACCAGGAAAACTGGGGG - Intronic
1078581208 11:12540993-12541015 AGGACAGCCCTGAAAAGTGAGGG + Intergenic
1078604192 11:12760704-12760726 AGGAGAACCCTAAAAATGTGTGG - Intronic
1081068148 11:38574749-38574771 AGGAAAGCCCTGAGAATTTGAGG - Intergenic
1082031675 11:47609031-47609053 AGGAGAATCCTTGAACTTGGGGG + Intergenic
1085366712 11:75954184-75954206 TGGATAACACTGAAGATTGGAGG + Intronic
1085878249 11:80434552-80434574 AGGAGAACCCAGGAAATTAAAGG - Intergenic
1090125845 11:124083050-124083072 AGCAGCACCCTGAACATTGATGG + Intergenic
1090132757 11:124161925-124161947 AGAAGAACCCTGAAAACAGAAGG - Intergenic
1091581604 12:1793798-1793820 AGGAGGACCCTCAAAAAGGGAGG + Intronic
1093269327 12:17039571-17039593 AGTAGTACCCAGAAAAGTGGTGG + Intergenic
1093797825 12:23334868-23334890 AAGAGAAACCTGAAAATCTGGGG + Intergenic
1098856038 12:75654313-75654335 AGGACAGCCCTGCAAACTGGAGG + Intergenic
1100814586 12:98374039-98374061 AGGAGAACCAGAAACATTGGTGG - Intergenic
1101508724 12:105373447-105373469 AGGATGAACCTGAAAATTAGTGG - Intronic
1103336108 12:120190995-120191017 ATGAGAAAACTGAAGATTGGGGG - Intronic
1104377667 12:128279091-128279113 AGGAGAACCCTGAGTAATAGAGG + Intronic
1104899055 12:132178372-132178394 ATGAGACCCCTGAAAAGTGTTGG + Intergenic
1105034480 12:132908816-132908838 TGGAGAACGCTGAAAGCTGGTGG - Intronic
1107618575 13:42199655-42199677 AGGAGCACCCTGAAAAATGCAGG + Exonic
1108743198 13:53360389-53360411 AGGAGAACTCAGAAAAATGATGG - Intergenic
1108784898 13:53886830-53886852 ATCAGAACCATGAAAATTAGAGG + Intergenic
1109920221 13:69047424-69047446 TGGAGAACCGTGAAAATCAGTGG + Intergenic
1112926871 13:104687288-104687310 AGGAGAGGCCTGAAACTGGGAGG - Intergenic
1113035902 13:106048406-106048428 GGGAGAAGCCTGAATCTTGGTGG + Intergenic
1116051719 14:39811839-39811861 AAGAGAACCCTGGGATTTGGAGG - Intergenic
1116334325 14:43638484-43638506 AGTAGAACCCTTAAAATTATGGG - Intergenic
1117670315 14:58099623-58099645 AGGAGAACAGAGAAAATAGGGGG + Intronic
1118151300 14:63193914-63193936 AGAAGTACCCTGAAAAAAGGGGG - Intergenic
1120272677 14:82334522-82334544 AGTACAACCCTGAAAATCTGCGG - Intergenic
1123628283 15:22242855-22242877 AGGAGAATCCTGAATCTGGGAGG - Intergenic
1127839763 15:62820942-62820964 AAGAGAAACCAGAAAATTGGAGG - Intronic
1129009076 15:72398493-72398515 AAGATCACCCTGAAAATTGTGGG + Intronic
1130834450 15:87635502-87635524 TGGAGAATCCTGAAGATTGCTGG - Intergenic
1131669877 15:94608382-94608404 TGGAGAACCAGGAAAGTTGGTGG + Intergenic
1132590077 16:722725-722747 AGGGGACCCCTGGAAAGTGGGGG - Exonic
1133200974 16:4204353-4204375 AGGAGAGCCCTGAAGGTGGGAGG - Intronic
1133897775 16:9945606-9945628 GGGAGAAACCTGGAATTTGGGGG + Intronic
1136080199 16:27847319-27847341 TGGAGAACACTGGAAATGGGGGG + Intronic
1140378291 16:74463185-74463207 AGGAGCATCCAGAAAAATGGAGG - Intronic
1143019466 17:3909392-3909414 CGGAGAACAGTGAAAATGGGAGG - Intronic
1143763734 17:9123735-9123757 ATGAGAACCCCCAAAATGGGGGG - Intronic
1145305676 17:21673831-21673853 AGCAGAACCCTGAAAATTCAGGG - Intergenic
1145370977 17:22305650-22305672 AGTAGAACCCGGAAAATTCAGGG + Intergenic
1146949636 17:36896933-36896955 AGGAGACCCCTGAAAAATAAGGG - Intergenic
1147973030 17:44230037-44230059 AGGAGTAACCTGAAATTTGCTGG - Intergenic
1148069475 17:44899649-44899671 GGGACCACCCTGAAAATGGGGGG + Exonic
1149011204 17:51858410-51858432 AGGAAAACACTGAAAATTGGTGG - Intronic
1149979911 17:61302177-61302199 AGGAGAACCCTGGGAGTCGGGGG - Intronic
1150284720 17:63948343-63948365 AGGAGACCCCTGGGAACTGGGGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153236192 18:2990871-2990893 AGGAGGACCCAGAAGACTGGAGG - Intronic
1153686233 18:7548535-7548557 ACGAGACCCCTGATAATTGTAGG + Intergenic
1153807854 18:8725114-8725136 AATAGAACTCTAAAAATTGGGGG - Intronic
1156041288 18:32825844-32825866 ATAACAGCCCTGAAAATTGGTGG - Intergenic
1156612962 18:38749425-38749447 AACAAAACCCTGAAAATTTGGGG + Intergenic
1158401470 18:57125353-57125375 AGGAGAAGCCTGAAAGTATGAGG - Intergenic
1158823526 18:61188492-61188514 AGGAGAACTCTGGGAATTGAGGG - Intergenic
1159664013 18:71134677-71134699 AGGAGAACCAGGAAAGCTGGTGG - Intergenic
1159665510 18:71154614-71154636 AGAAGGGCACTGAAAATTGGGGG - Intergenic
1160309727 18:77778294-77778316 TGGAGGACCCTGAAGCTTGGAGG + Intergenic
1163449259 19:17366016-17366038 AGGAGACCCAGGAAGATTGGGGG + Intronic
1164786490 19:30935259-30935281 AGGAGAAGCCTGCACATTGCAGG + Intergenic
1165005478 19:32802908-32802930 AGGAGAACCCTGAAAATTGGGGG - Intronic
1165269409 19:34692241-34692263 AGGAGAACTATGAAAAATGGTGG - Intergenic
1165850688 19:38848890-38848912 TGGAAAACCCTGCAAATAGGCGG + Intronic
1166549488 19:43655816-43655838 AGGAGAACCCTTACAAAAGGAGG + Intronic
1168506983 19:56944122-56944144 AGGGGAACCCAGAAAATGAGGGG - Intergenic
925477011 2:4228534-4228556 AACACAACCCTGAAAATTAGTGG - Intergenic
929862956 2:45694827-45694849 AGGACAAACCTGAAATGTGGAGG + Intronic
929970524 2:46570734-46570756 AGAATATCCCTGAAAAGTGGTGG - Intronic
934518400 2:95003962-95003984 TGAGGAAACCTGAAAATTGGTGG + Intergenic
935796417 2:106645478-106645500 AGGAGAACACAGAGAATTGCTGG + Intergenic
935827438 2:106965372-106965394 AGGAGTACCTGGAAACTTGGGGG - Intergenic
936973084 2:118193267-118193289 AGGGGAACCCTGCAGATTGGAGG + Intergenic
941230867 2:162911070-162911092 AGAAGAACCATGAAAATAGATGG - Intergenic
942141303 2:172979924-172979946 AGGAGAATCCTTAAACTCGGGGG + Intronic
944176488 2:196834264-196834286 ATGAGAACTCTGAAAATTAAGGG + Exonic
944951762 2:204758548-204758570 AGGGGAACACTGAAAACTGCAGG + Intronic
945035367 2:205699724-205699746 AAGATAACCCTGTAAATTGCTGG - Intronic
945592273 2:211748412-211748434 AGGAGAAATCTGAAAGGTGGTGG + Intronic
948041241 2:234903338-234903360 CAGAGAACCCTGAACATTGCAGG + Intergenic
1170801297 20:19592710-19592732 AGGAGCACCATGAAAATTACTGG + Intronic
1171523189 20:25791319-25791341 AGCAGAACCCTGAAAATTCAGGG - Intronic
1171530932 20:25853299-25853321 AGCAGAACCCTGAAAATTCAGGG - Intronic
1171553637 20:26064564-26064586 AGCAGAACCCTGAAAATTCAGGG + Intergenic
1175133302 20:56805734-56805756 AGGAAAACCTTGTAAATTGATGG + Intergenic
1175651879 20:60732049-60732071 AGGAGAAGACTGAAAGTTTGAGG + Intergenic
1176263482 20:64195906-64195928 AGGAAAACCATGAAAACTGTGGG - Intronic
1177579318 21:22999092-22999114 AGGAGTACCCAGACATTTGGTGG + Intergenic
1179600414 21:42474068-42474090 AGGAGGCCCCAGAAACTTGGTGG - Intronic
1179669707 21:42938051-42938073 ACGGGAACCTTGAAAATTTGAGG - Intergenic
1180133393 21:45843142-45843164 AAGAGAACCCTGAAAGCTGGAGG - Intronic
1180254968 21:46620538-46620560 AGGAAAACCCGAAAAATTGCTGG - Intergenic
950764109 3:15260589-15260611 ATGAAAATCCTGAAATTTGGGGG + Intronic
957008240 3:74975222-74975244 AGGAGAATCAGGAAAATTTGTGG - Intergenic
957211613 3:77266328-77266350 AGGAGAGCCCTGAAACTTAAAGG - Intronic
959746417 3:109780539-109780561 TAGAGAACCCTGAAAAATAGAGG - Intergenic
960567314 3:119147356-119147378 AGTACAACCCTGCAAATTTGAGG + Exonic
961200406 3:125041031-125041053 AGGTTAACCCAGAAAATAGGTGG + Intronic
962096481 3:132297865-132297887 AGGGGAACCCTAAAAATTGATGG - Intergenic
964493600 3:157264351-157264373 TGGAGAACCAGGAAAACTGGTGG - Intronic
970568274 4:17353578-17353600 AGGAGAATCCTGAACCCTGGAGG + Intergenic
972918313 4:43906295-43906317 AGGAGTACCCTGGGAATTTGGGG - Intergenic
973030095 4:45326823-45326845 TGGAGAACCATGAAAGATGGTGG + Intergenic
974223021 4:59001483-59001505 AGGAAAATCCTGGAAATTAGAGG - Intergenic
974384540 4:61188027-61188049 AAAAGAACTCTGAAAACTGGTGG - Intergenic
975126352 4:70786849-70786871 AGGAGGAGCCTGAAAATAAGGGG + Intronic
975318148 4:72978852-72978874 AGGAGAAGCCAGAAATCTGGTGG - Intergenic
975434224 4:74332667-74332689 AGGAGAATGTTGAAAAATGGAGG + Intergenic
976690304 4:87861654-87861676 TGGAGAACCAGGAAAACTGGTGG - Intergenic
977802075 4:101246882-101246904 AGGAGAAGCCTGCAAATTCAAGG - Intronic
977982142 4:103336811-103336833 AGGAGAACCCTCATAAAGGGAGG + Intergenic
978789917 4:112651456-112651478 AGGAGACAGCTGAAAATTGAGGG + Intronic
979773168 4:124555147-124555169 AGGAGTACCTGGAAAATTGGAGG - Intergenic
981110080 4:140925265-140925287 AGGTGAAGCCTGCAAACTGGTGG - Intronic
982741522 4:159061848-159061870 AGGAGCACCATGGAAACTGGAGG + Intergenic
982932739 4:161429113-161429135 AGGAGAAGAGTGAAAATGGGAGG + Intronic
983042083 4:162941961-162941983 AGGAGAACGATGGAAATTTGAGG - Intergenic
983085856 4:163443115-163443137 AGGAGAAACCATAAAATTCGGGG + Intergenic
983281014 4:165680914-165680936 AGCAGAAACCTGAAAGTTGTAGG + Intergenic
983609316 4:169625439-169625461 AGGAAAACCATGGAAATGGGTGG - Intronic
984251752 4:177344488-177344510 AGTAGAAACTGGAAAATTGGGGG - Intronic
984902560 4:184598151-184598173 ACTAGAATCCTGAAAATAGGTGG + Intergenic
985063335 4:186099098-186099120 AGGAGAAGCCTGAACCTGGGAGG - Intergenic
985921787 5:2983360-2983382 AGAAGAACCCAGAAACTTGCTGG - Intergenic
986704095 5:10441277-10441299 AGGAGAAACCTCGAATTTGGTGG - Intergenic
987543002 5:19278926-19278948 TGGAGAACCAGGAAAACTGGTGG + Intergenic
988032894 5:25788067-25788089 AGGAGACACATGAAAATAGGGGG + Intergenic
988248620 5:28723950-28723972 TGAAGAACACTGAAAATTAGTGG - Intergenic
988248716 5:28725758-28725780 TGAAGAACACTGAAAATTAGTGG + Intergenic
988248794 5:28726678-28726700 GGAAGAACCATGAAAAGTGGGGG - Intergenic
988789448 5:34593914-34593936 TGGAGAACCAGGAAAGTTGGTGG + Intergenic
989465262 5:41747544-41747566 AGAAGCACCCAGAAAATTTGGGG + Intronic
991133397 5:63152990-63153012 AGGAGAACCCTGAGACTGAGAGG - Intergenic
994333601 5:98537895-98537917 AAGAGAAGACTGAAAACTGGAGG + Intergenic
994572841 5:101535994-101536016 AGAAGAAACCTGAAAATAGGTGG + Intergenic
996367110 5:122714918-122714940 AGGAGAACACTGTATATTTGAGG - Intergenic
1000161212 5:158599396-158599418 AGGTGAACCATGAAAAATGCTGG - Intergenic
1001832786 5:174803510-174803532 TGGAGAACCATGAAAACTTGTGG - Intergenic
1002965547 6:1962836-1962858 AAGACAACCCTGATAATGGGAGG - Intronic
1005596663 6:27384924-27384946 AGGAGAAGCCTGAACACGGGAGG + Intronic
1006101026 6:31686526-31686548 AGGTGAGCAATGAAAATTGGGGG + Intergenic
1006613528 6:35310081-35310103 TGGAGAACCCTGGAAGCTGGAGG - Intronic
1009660631 6:66606494-66606516 AGGACATCCCTGAAAAATAGTGG - Intergenic
1010255382 6:73751297-73751319 AGGAGGACCCTTAAGATTGTGGG + Intronic
1011482509 6:87809287-87809309 TGGAACACCCTGATAATTGGAGG + Intergenic
1015313322 6:131789281-131789303 AAGGGAACCCATAAAATTGGTGG + Intergenic
1016691814 6:146946788-146946810 AGGATAGCACTGAAAATTGGAGG - Intergenic
1017505466 6:155065043-155065065 AGGAGAACCTTGAAACCGGGAGG - Intronic
1017566905 6:155696714-155696736 AAGAGAACCCAGAGAAGTGGGGG + Intergenic
1018841468 6:167520329-167520351 AGTAGAACCATGAATATTGGAGG - Intergenic
1019749110 7:2717769-2717791 ATGAGAACCCGGAAGAATGGAGG + Intronic
1021153983 7:17186662-17186684 AGCAGTACCCTGAAAACTGCTGG + Intergenic
1021231177 7:18087252-18087274 AGGAAAGCCCTGGGAATTGGGGG + Intronic
1023626299 7:42118480-42118502 AGAAAAACACTGAAAATTGGGGG - Intronic
1024336792 7:48216526-48216548 AAGATAACCCAGAAAATGGGGGG - Intronic
1024625525 7:51206065-51206087 AGGAAAACCTTGAACATTGCTGG + Intronic
1024792319 7:52980492-52980514 TGGAGATCCAGGAAAATTGGTGG - Intergenic
1024835836 7:53517302-53517324 AAGAGAAGCCTGGAACTTGGAGG + Intergenic
1024921624 7:54563091-54563113 AGGAGAACAATATAAATTGGTGG - Intronic
1025283628 7:57646228-57646250 AGCAGAACCCTGAAAATTCAGGG - Intergenic
1026260559 7:68751626-68751648 AAGAGAACCCTGTACATTGTTGG - Intergenic
1027553410 7:79631335-79631357 AGGAAAACATTGAATATTGGGGG - Intergenic
1031759701 7:125697420-125697442 TGGAGACCCAGGAAAATTGGTGG + Intergenic
1032789716 7:135233433-135233455 AGGACAACCCTGTAAGCTGGTGG + Intronic
1039022021 8:33218436-33218458 AGGAGAACCCTGGCAAAGGGAGG - Intergenic
1041448833 8:57985304-57985326 TGGAGAACCAAGAAAGTTGGTGG - Intergenic
1042011592 8:64251756-64251778 AGTAGAACACTGGATATTGGGGG - Intergenic
1046601766 8:116325414-116325436 CGGAGAATTCTGAAACTTGGAGG + Intergenic
1046759744 8:118009045-118009067 TGGAGGTCCCAGAAAATTGGGGG + Intronic
1048074541 8:131055168-131055190 AGGAGACTCCTGAACATTGGGGG + Intergenic
1051107361 9:13595363-13595385 AGGAGAACCAGCAAATTTGGGGG - Intergenic
1051924019 9:22301126-22301148 AGAAGAAACATGAAAATTGGGGG + Intergenic
1054721447 9:68608130-68608152 TGGTGAACCCTGCAATTTGGAGG + Intergenic
1055621754 9:78133258-78133280 AGGATAACATTGAAAATTTGAGG + Intergenic
1056462878 9:86825209-86825231 TGGAGAACCAGGAAAGTTGGTGG + Intergenic
1058220447 9:102293711-102293733 TGCAGAACTCTGAAAAATGGTGG - Intergenic
1059110186 9:111550360-111550382 ATCAGAACCCTGATATTTGGAGG + Intronic
1060313250 9:122484088-122484110 AAGAGAACCTTGGAAATTGATGG - Intergenic
1060935498 9:127512748-127512770 CTGTGAACCCTGAAAATTTGAGG - Intronic
1061226651 9:129284527-129284549 AGGAGACCCCTGAAGCCTGGGGG - Intergenic
1062207957 9:135347507-135347529 AGGAGAACCGTGCACCTTGGTGG - Intergenic
1062321149 9:135991042-135991064 AGGGGCACCCTGAAAATGGCAGG - Intergenic
1186702169 X:12103100-12103122 AGTAGAACCCAGAAAATCTGGGG - Intergenic
1187954288 X:24500820-24500842 AGAAGAGCCCGGAAGATTGGAGG + Intronic
1188790234 X:34399839-34399861 TGGAAAACCTTGAAAATTGTTGG - Intergenic
1189229654 X:39442424-39442446 AGGGCAACCCTGAAACATGGGGG - Intergenic
1189804004 X:44717576-44717598 TGGAGAACCATGAAAGCTGGTGG + Intergenic
1190043089 X:47087706-47087728 AGGAGACCTCTTAAAATTGCAGG + Intronic
1192810784 X:74545461-74545483 GGGAAAACCCTCAGAATTGGTGG + Intergenic
1193414560 X:81206150-81206172 AGGAGAAACCTAAAAATGGGAGG - Intronic
1193480524 X:82022071-82022093 AGGAGAAGGCTAAACATTGGAGG + Intergenic
1194431506 X:93812707-93812729 AGGAGTACCATGTAAGTTGGTGG + Intergenic
1194604320 X:95961427-95961449 AGGACATCCCTGAAGAATGGTGG - Intergenic
1197238777 X:124099430-124099452 AGGAGAACCCTGAAGCATGCGGG + Intronic
1197253910 X:124242764-124242786 GGGAAAACCCTGAAATTTGGAGG - Intronic
1197706602 X:129638920-129638942 TGGAGGACCCGGAGAATTGGAGG + Intergenic
1199313915 X:146354606-146354628 AAGAGAACACTGAAAATTGGAGG + Intergenic