ID: 1165006970

View in Genome Browser
Species Human (GRCh38)
Location 19:32815191-32815213
Sequence GGGGGTGGCAAGAGCAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 1, 1: 0, 2: 5, 3: 187, 4: 518}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165006970_1165006983 9 Left 1165006970 19:32815191-32815213 CCAGATTTGCTCTTGCCACCCCC 0: 1
1: 0
2: 5
3: 187
4: 518
Right 1165006983 19:32815223-32815245 GCCCATATTTCTGTGGCATGGGG 0: 1
1: 0
2: 1
3: 6
4: 153
1165006970_1165006978 2 Left 1165006970 19:32815191-32815213 CCAGATTTGCTCTTGCCACCCCC 0: 1
1: 0
2: 5
3: 187
4: 518
Right 1165006978 19:32815216-32815238 ACCACCTGCCCATATTTCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 172
1165006970_1165006981 7 Left 1165006970 19:32815191-32815213 CCAGATTTGCTCTTGCCACCCCC 0: 1
1: 0
2: 5
3: 187
4: 518
Right 1165006981 19:32815221-32815243 CTGCCCATATTTCTGTGGCATGG 0: 1
1: 0
2: 2
3: 13
4: 170
1165006970_1165006982 8 Left 1165006970 19:32815191-32815213 CCAGATTTGCTCTTGCCACCCCC 0: 1
1: 0
2: 5
3: 187
4: 518
Right 1165006982 19:32815222-32815244 TGCCCATATTTCTGTGGCATGGG 0: 1
1: 0
2: 1
3: 11
4: 182
1165006970_1165006986 14 Left 1165006970 19:32815191-32815213 CCAGATTTGCTCTTGCCACCCCC 0: 1
1: 0
2: 5
3: 187
4: 518
Right 1165006986 19:32815228-32815250 TATTTCTGTGGCATGGGGTGAGG 0: 1
1: 0
2: 5
3: 59
4: 433
1165006970_1165006987 19 Left 1165006970 19:32815191-32815213 CCAGATTTGCTCTTGCCACCCCC 0: 1
1: 0
2: 5
3: 187
4: 518
Right 1165006987 19:32815233-32815255 CTGTGGCATGGGGTGAGGCCTGG 0: 1
1: 0
2: 3
3: 59
4: 499
1165006970_1165006988 28 Left 1165006970 19:32815191-32815213 CCAGATTTGCTCTTGCCACCCCC 0: 1
1: 0
2: 5
3: 187
4: 518
Right 1165006988 19:32815242-32815264 GGGGTGAGGCCTGGATGATTTGG 0: 1
1: 0
2: 1
3: 23
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165006970 Original CRISPR GGGGGTGGCAAGAGCAAATC TGG (reversed) Intronic
900141842 1:1141970-1141992 GGGGGTGGCAAGAGCCTGTGGGG - Intergenic
900771938 1:4552277-4552299 GGGGGTGGCAAGAGAGAATAAGG + Intergenic
901167301 1:7229659-7229681 GGAGGAGGCAAGAGCCAGTCTGG + Intronic
901586966 1:10303947-10303969 GGATGAGGCAAGAGCAAATTCGG + Intronic
902044668 1:13515261-13515283 GGGGATGGCAATGGCAAATTGGG - Intergenic
902271095 1:15305736-15305758 GGCGGCGGCAAGAGAAAATGCGG - Intronic
902570744 1:17345664-17345686 GGCGGTGGCAAGAGAAAATGAGG - Intronic
903054928 1:20629295-20629317 GGTGGCGGCAAGAGAAAATGAGG + Intergenic
904427197 1:30436408-30436430 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
904712395 1:32440174-32440196 GGGATTGGCTAGAGTAAATCAGG + Intergenic
904896954 1:33824685-33824707 GAGGGTGGGAGGAGCAAGTCAGG + Intronic
906020659 1:42626765-42626787 GGCAGTGGCAAGAGAAAATGGGG - Intronic
906020932 1:42628681-42628703 GGCAGTGGCAAGAGAAAATGGGG - Intronic
906216148 1:44041608-44041630 CTGGGTGACAAGAGCAAAACTGG + Intergenic
906760338 1:48371839-48371861 GGTGGTGGCAAGAGAGAATGAGG + Intronic
906931841 1:50177644-50177666 GGAGGTGGCAGGGCCAAATCAGG + Intronic
907353252 1:53850867-53850889 GGTGGTGGCAAGAGATAATGAGG - Intergenic
907392389 1:54166744-54166766 AGTGGTGGCAAGAGAAAATGAGG + Intronic
907522177 1:55031147-55031169 GGCGGAGGCAAGAGAAAATGAGG - Intergenic
907707653 1:56846700-56846722 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
907810150 1:57861081-57861103 GGGGGAGGCAAGAGAATATAGGG + Intronic
907914532 1:58856522-58856544 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
907941179 1:59089112-59089134 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
908729061 1:67207615-67207637 AGTGGTGGCAAGAGAAAATGAGG - Intronic
908937034 1:69388576-69388598 TGGGGTGGCAAGAGCAAGATGGG + Intergenic
909065424 1:70930634-70930656 GGCAGTGGCAAGAGAAAATGAGG + Intronic
909065702 1:70932559-70932581 GGTGGCGGCAAGAGAAAATGAGG + Intronic
909646071 1:77919100-77919122 AGCGGTGGCAAGAGAAAATGAGG + Intronic
909956645 1:81787077-81787099 GGTGGTGGCAAGAAAAAATGAGG - Intronic
910674103 1:89800027-89800049 GGGGGTGTGAAGAGCAAATAAGG + Intronic
910850097 1:91641638-91641660 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
912099078 1:106183937-106183959 GGAAGTGGCAAGAGAAAATGAGG - Intergenic
912279323 1:108296860-108296882 GGTGGTGGCAAGACAAAATGAGG + Intergenic
912288903 1:108397497-108397519 GGTGGTGGCAAGACAAAATGAGG - Intronic
913425522 1:118724645-118724667 GGTGGTGGCAAGAGAAAATGGGG + Intergenic
913431803 1:118803354-118803376 GATGGTGGCAAGAGAAAATGAGG - Intergenic
913559214 1:120001077-120001099 GGTGGTGGCAAGAGAAAATTAGG - Intronic
913638649 1:120789465-120789487 GGTGGTGGCAAGAGAAAATTAGG + Intergenic
914279809 1:146160520-146160542 GGTGGTGGCAAGAGAAAATTAGG - Intronic
914540847 1:148611438-148611460 GGTGGTGGCAAGAGAAAATTAGG - Intronic
914625793 1:149459808-149459830 GGTGGTGGCAAGAGAAAATTAGG + Intergenic
916650688 1:166831722-166831744 GGTGGTGGCAAGAGAAAAATTGG - Intergenic
916686425 1:167151527-167151549 GTGGGTGGCAGAAGCAAAGCAGG - Intergenic
917377053 1:174359980-174360002 GGGAGAGGTAAAAGCAAATCAGG - Intronic
917445481 1:175102809-175102831 GGAGGTGCCAAGAGCAAGTGAGG + Intronic
917446437 1:175108966-175108988 GGAGGTGCCAAGAGCAAGTGAGG + Intronic
919175305 1:194011363-194011385 GGGGGTGGCAAGAGAAAATGAGG - Intergenic
919194211 1:194263202-194263224 GGTGGTGGCAACAGAAAATGAGG - Intergenic
919288757 1:195601070-195601092 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
919362377 1:196611277-196611299 GGCGGTGGCAAGAGAAAATGAGG - Intergenic
919554445 1:199032653-199032675 GGTGGTAGCAAGAGGAAATGAGG + Intergenic
920252267 1:204629597-204629619 GGTGGCGGCAAGAGAAAATGAGG - Intronic
920384911 1:205564242-205564264 GGGAGTGACAAGACAAAATCTGG + Intergenic
921424539 1:214986117-214986139 GACGGTGGCAAGAGAAAATGAGG - Intergenic
921584507 1:216931480-216931502 GGGGAAGGAAAGAGCAAGTCAGG - Intronic
922530996 1:226345128-226345150 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
922546777 1:226464048-226464070 GGAGGTGCCAAGAGCAAACGAGG - Intergenic
923301405 1:232644051-232644073 GGTGGAGGCAAGAGAAAATGAGG + Intergenic
923324888 1:232871952-232871974 GGAGGTGCCAAGAGCAAGTGAGG + Intergenic
923330842 1:232923216-232923238 AGTGGTGGCAAGAGAAAATGAGG + Intergenic
923465646 1:234246007-234246029 GAGGGTGGCAAGATCATCTCGGG + Intronic
924543311 1:245001552-245001574 GGTGGTGTCAAGAGCAAGGCAGG + Intronic
924806405 1:247365200-247365222 GGCGGCGGCAAGAGAAAATGAGG - Intergenic
1063172066 10:3517822-3517844 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1063608545 10:7543811-7543833 GGTGGCGGCAAGAGAAAATGAGG + Intergenic
1064048932 10:12043299-12043321 GGGGGTGGGAAGCGCGAATGGGG + Intergenic
1064909197 10:20382180-20382202 GGCGGCGGCAAGAGAAAATGAGG + Intergenic
1065220271 10:23489306-23489328 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1065347875 10:24765992-24766014 GGTGGTGACAAGAGAAAATGAGG + Intergenic
1065852488 10:29802392-29802414 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
1066599736 10:37092331-37092353 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1066600018 10:37094265-37094287 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
1066650257 10:37648282-37648304 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1067033189 10:42894073-42894095 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1067767503 10:49098149-49098171 GGGGGTGGCACAAGGAAAACGGG - Intronic
1068553082 10:58427456-58427478 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
1069058978 10:63873560-63873582 GGTGGTGGCAAGGGAAAATGAGG + Intergenic
1069804009 10:71106360-71106382 AGTGGTGGCAAGAGAAAATGAGG - Intergenic
1070306764 10:75244404-75244426 GAGGATGGCAAGAGGAAATACGG + Intergenic
1071281348 10:84106859-84106881 GAGGGTGGCAAGAGGAAAGAGGG + Intergenic
1071443005 10:85719516-85719538 GGTGGTGGCAAGAGAAAATGAGG + Intronic
1072635546 10:97175669-97175691 GGGATTGGCAAGAGCAAGGCAGG - Intronic
1073153303 10:101326843-101326865 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1073880682 10:107976096-107976118 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1074024605 10:109621405-109621427 GGCGGAGGCAAGAGAAAATGAGG + Intergenic
1074041555 10:109794324-109794346 GGCGGTGGCAAGAGAAAATGAGG + Intergenic
1074463130 10:113657005-113657027 GGAGGTGGGAAGAGTAAGTCAGG + Intronic
1075360888 10:121832613-121832635 GGCGGTGGCAAGAGAAAATGAGG - Intronic
1075974732 10:126685577-126685599 GAGGGAGGCAGGAGCAAATATGG - Intergenic
1076090205 10:127679067-127679089 GGCAGTGGCAAGAGAAAATAAGG + Intergenic
1076992913 11:284907-284929 GGGGGTGGCAAAAGGGTATCGGG - Intronic
1078553777 11:12301073-12301095 GGCAGTGGCAAGAGAAAATGAGG + Intronic
1078909396 11:15717062-15717084 GGGGTTGGCAGGAGCAAAGCAGG - Intergenic
1079213278 11:18483172-18483194 GGTGGTGGCAAGAGGAAATGAGG - Intronic
1080153238 11:29077721-29077743 AGTGGTGGCAAGAGAAAATGAGG - Intergenic
1080428586 11:32178344-32178366 GGGGGTGGCATGAGCAACAGAGG - Intergenic
1080644155 11:34175963-34175985 GGGGGTGGGGAGAGAGAATCTGG - Intronic
1080817584 11:35773112-35773134 GGTGGTAGCAAGAGAAAATGAGG - Intronic
1080882857 11:36339007-36339029 GGTGGTGGCAAGAGAGAATGAGG - Intronic
1081145439 11:39557681-39557703 GGTGGTGGCAAGAAAAAATGAGG - Intergenic
1081277045 11:41163098-41163120 GGTGGCGGCAAGAGAAAATGAGG - Intronic
1081294632 11:41370541-41370563 GGTGGCGGCAAGAGAAAATGAGG - Intronic
1081425252 11:42919481-42919503 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1081892406 11:46554626-46554648 GTGGCTGGTAAGAGCATATCAGG - Intronic
1081939588 11:46929240-46929262 GGTGGTGGCAAAAGAAAATGAGG - Intergenic
1082742446 11:56925749-56925771 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
1083184514 11:61009396-61009418 AGGGTTGGCCAGAGCAAATGGGG + Intronic
1083713394 11:64562196-64562218 GGGGGTGGCAGGAGAGAATGGGG + Intronic
1083941119 11:65896504-65896526 GGGGGTGGCAGGAGCAAGGATGG - Intronic
1085485812 11:76861470-76861492 GGTGGTGGCAACAGCAGAGCAGG - Intronic
1085756560 11:79206693-79206715 GGCAGTGGCAAGAGAAAATGAGG - Intronic
1085890059 11:80567899-80567921 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
1086078157 11:82876650-82876672 GGTGGCGGCAAGAGAAAATGAGG - Intronic
1086324697 11:85686291-85686313 GGGGGAGTCCAGAGCCAATCTGG + Intergenic
1086995585 11:93352715-93352737 GGGGGAGGCAAGAGAAAATGAGG + Intronic
1087550072 11:99638168-99638190 GGTGGTGGCAAGAGAAAATGAGG + Intronic
1087723225 11:101690394-101690416 GGTGGTGGCAAGAAAAAATGAGG + Intronic
1088033472 11:105281124-105281146 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1088254704 11:107892290-107892312 GGGTGTGGGAAGAGAAAATGGGG - Intronic
1088398421 11:109394470-109394492 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
1088435110 11:109803997-109804019 GGTGGTGGCAAGAGAAACTGAGG + Intergenic
1089404967 11:118190405-118190427 GGGGGCAGCAAGAGAAAATGAGG - Intergenic
1089405350 11:118192943-118192965 GGCGGTGGCAAGAGAAAATGAGG - Intergenic
1090727509 11:129541001-129541023 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
1090771104 11:129920578-129920600 GGGTGTGGCAAGAGGAAGCCAGG - Intronic
1091065573 11:132508702-132508724 GGTGGTGACAAGAGAAAATGAGG - Intronic
1091506893 12:1080685-1080707 GGCGGCAGCAAGAGAAAATCAGG - Intronic
1092164592 12:6335225-6335247 GGGGTTGGCAAGGACAAATGGGG + Intronic
1092310175 12:7343806-7343828 TGGGAGGGCATGAGCAAATCTGG - Intergenic
1093230401 12:16536693-16536715 GGTGGTGGCAAGAGAAAATGAGG + Intronic
1093324622 12:17759129-17759151 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
1093324884 12:17761042-17761064 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1093536503 12:20230007-20230029 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1093962760 12:25293152-25293174 GGTGGTGGGAAGAGAAAATGAGG - Intergenic
1094297729 12:28926846-28926868 GACGGTGGCAAGAGAAAATGAGG - Intergenic
1094393693 12:29981336-29981358 GACGGTGGCAAGAGAAAATGAGG + Intergenic
1094814793 12:34172189-34172211 GGGAGTGGCTAGAGCTAATAGGG - Intergenic
1095135742 12:38600279-38600301 GGCTGTGGCAAGAGAAAATGAGG - Intergenic
1095773345 12:45986816-45986838 GTTGGTGGCAAGAGAAAATGAGG - Intronic
1097998918 12:65920664-65920686 GGCAGTGGCAAGAGAAAATGAGG - Intronic
1097999252 12:65922904-65922926 GGTGGTGGCAAGAGAAAATGAGG - Intronic
1098238764 12:68444053-68444075 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
1099003969 12:77215575-77215597 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
1099004241 12:77217500-77217522 GGAGGCGGCAAGAGAAAATGAGG - Intergenic
1099846023 12:88030239-88030261 TGCGGTGGCAAGAGAAAATGAGG + Intronic
1100276642 12:93077503-93077525 GGTGGCGGCAAGAGAAAATGGGG + Intergenic
1100404831 12:94263826-94263848 GGAGGTGGCAAGAGGAAGCCCGG + Intronic
1101113132 12:101505791-101505813 CGTGGTGGCAAGAGAAAATAAGG - Intergenic
1103521898 12:121541642-121541664 GGGGGTGGCAGGAGGAACTGGGG - Intronic
1104413976 12:128582654-128582676 GGCGGTGGCAAGAGAAAATGAGG - Intronic
1104885954 12:132108389-132108411 AGGGCTGGAAAGAACAAATCTGG - Intronic
1105530120 13:21211518-21211540 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
1106791669 13:33161859-33161881 GGTGGTGACAAGAGAAAATGAGG + Intronic
1106791832 13:33163072-33163094 GGTGGTGGCAAGAGAAAATGAGG + Intronic
1106917491 13:34530640-34530662 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1108342745 13:49514026-49514048 GGGGGTGGCCATAACTAATCAGG + Intronic
1109285849 13:60408007-60408029 GGCGGCGGCAAGAGAAAATGAGG - Intronic
1109475526 13:62876328-62876350 GGTGGTGGCGAGAGAAAATGAGG + Intergenic
1109482309 13:62972927-62972949 GGTGGTGGCAAAAGAAAATGAGG + Intergenic
1109526144 13:63579540-63579562 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1109823747 13:67691464-67691486 GGTTGTGGCAAGAGAAAATGAGG + Intergenic
1110453121 13:75659510-75659532 GGCAGTGGCAAGAGAAAATGAGG + Intronic
1110488895 13:76079434-76079456 GGTGGCAGCAAGAGAAAATCAGG - Intergenic
1111067157 13:83108095-83108117 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
1111612606 13:90623203-90623225 GGGGGTGGCAATAGCATCTATGG + Intergenic
1111621732 13:90732852-90732874 GGCGGTGGCAAGAGAAAATGAGG - Intergenic
1111972325 13:94929755-94929777 GGGGGCGGCAAGAGAAAATGAGG + Intergenic
1112887750 13:104194479-104194501 GGTGGTGGTAAGAGAAAATGAGG - Intergenic
1113102399 13:106734791-106734813 GGTGGAGGCAAGAGAAAATGAGG + Intergenic
1113470877 13:110545007-110545029 GGTGGCGGCAAGAGAAAATGAGG - Intronic
1114056076 14:18967816-18967838 GGGAGCGGCAAGAGCAAAGTGGG + Exonic
1114106474 14:19433937-19433959 GGGAGCGGCAAGAGCAAAGTGGG - Exonic
1114818852 14:25991956-25991978 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
1115007004 14:28498328-28498350 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
1115021414 14:28685116-28685138 GGTGGTGGCAAAGGAAAATCAGG - Intergenic
1115903445 14:38180226-38180248 GGTGGTGGCAAGAGAAAAATGGG - Intergenic
1115962695 14:38853438-38853460 GGTGGTGGCAAGAGAGAATGAGG - Intergenic
1116103827 14:40474900-40474922 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1116725276 14:48554803-48554825 AGGGGTGGCATCAGCAATTCAGG + Intergenic
1116992138 14:51287671-51287693 GGGGGTGTCAAAAGCAGGTCAGG + Intergenic
1117198358 14:53363337-53363359 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1118064022 14:62171110-62171132 GTGGGAGGCAAGAGAAAATGAGG + Intergenic
1119486696 14:74994006-74994028 GGAGGTGCCAAGAGCAAGTGAGG - Intergenic
1120023876 14:79560421-79560443 GGGGGTGGGAGGAGCATTTCTGG + Intronic
1120166786 14:81209301-81209323 GGCAGTGGCAAGAGAAAATGAGG - Intronic
1120392951 14:83930754-83930776 GGTGGTGGCGAGAGAAAATAAGG - Intergenic
1121483688 14:94297452-94297474 GGTGGCGGCAAGAGAAAATGAGG + Intergenic
1121483965 14:94299364-94299386 AGTGGTGGCAAGAGAAAATGAGG + Intergenic
1121825533 14:97007242-97007264 GGTGGCGGCAAGAGAAAATGGGG - Intergenic
1122047137 14:99032241-99032263 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1122050559 14:99056765-99056787 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1122880677 14:104689356-104689378 GGGGGTGGGACGCGCAGATCGGG - Intergenic
1123140736 14:106075295-106075317 GGTGGTGGCAAGAGGAAATGAGG + Intergenic
1123158527 14:106254163-106254185 GTGGGTGGCAAGAGAAAATGAGG + Intergenic
1123769896 15:23518710-23518732 CGGGGAGGCTATAGCAAATCTGG - Intergenic
1125881250 15:43197966-43197988 GGTGGTGGCAAGAGAAAATGAGG - Intronic
1125881536 15:43199868-43199890 GGTGGTGGCAAGAGAAAATGAGG - Intronic
1126126216 15:45296823-45296845 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1126162960 15:45631147-45631169 GGTGGCGGCAAGAGAAAATGAGG - Intronic
1126337394 15:47602003-47602025 GGGGGTAGCAATAGTAAATCTGG - Intronic
1127955076 15:63846239-63846261 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
1128177225 15:65566473-65566495 GGCGGTGGCAAGAGAGAATGAGG + Intronic
1130181783 15:81637112-81637134 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
1130961588 15:88663126-88663148 GGGGATGGCACCAGCAACTCAGG - Intergenic
1131307820 15:91260803-91260825 GGTGGTGGCAAGAGAAAATGAGG + Intronic
1131590073 15:93739713-93739735 GGTGGTGGCAAGAGAAAATAAGG + Intergenic
1131618170 15:94038413-94038435 GGTGGTGGCAAGAGAGAATGAGG + Intergenic
1132987244 16:2773899-2773921 GGGAGTGCCAAGAGCATATCTGG - Intronic
1134349271 16:13421401-13421423 GGCTGTGGCAAGAGAAAATGAGG + Intergenic
1134542307 16:15077451-15077473 GGTGGCGGCAAGAGAAAATGAGG - Intronic
1134768435 16:16782900-16782922 GATGGTGGCAAGAGAAAATGGGG - Intergenic
1135275892 16:21112480-21112502 GGCAGTGGCAAGAGAAAATGAGG + Intronic
1135359884 16:21803533-21803555 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
1135513018 16:23104424-23104446 GGTGGTGTCCAGGGCAAATCTGG - Intronic
1136262916 16:29093407-29093429 GGTGGCGGCAAGAGAAAATGAGG + Intergenic
1136728637 16:32384791-32384813 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1138055927 16:53833158-53833180 GGCAGTGGCAAGAGAAAATGAGG - Intronic
1139274454 16:65714499-65714521 GAGGGTGGAAAGAGCACACCAGG + Intergenic
1140332533 16:74071803-74071825 TGGGGAGGCAAGAACAAATTGGG + Intergenic
1140759050 16:78094888-78094910 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1140777921 16:78267049-78267071 GCTGGTGGCAAGAGAAAATGAGG - Intronic
1140824350 16:78691995-78692017 GGCAGTGGCAAGAGAAAATGAGG - Intronic
1141037946 16:80644600-80644622 GGCAGTGGCAAGAGAAAATGAGG + Intronic
1141801242 16:86310901-86310923 GAGGGAGGGAAGAGCAAAACTGG - Intergenic
1141994114 16:87626119-87626141 GGGGGTGCCAAGAGCAACAGCGG + Intronic
1142274264 16:89108018-89108040 GGCGGTGGCAAGAGAAAATGAGG + Intronic
1142394775 16:89825933-89825955 GCGGGTGGCAGGGACAAATCAGG + Intronic
1202997800 16_KI270728v1_random:132952-132974 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1203024487 16_KI270728v1_random:445294-445316 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1143210698 17:5185306-5185328 GGTGGTGGCAAGAGAAAATGAGG + Intronic
1143210983 17:5187231-5187253 TGTGGTGGCAAGAGAAAATGAGG + Intronic
1143524037 17:7462301-7462323 GGCGGTGGCAGGGGAAAATCTGG - Exonic
1144028840 17:11301979-11302001 GGCGGCGGCAAGAGAAAATGAGG + Intronic
1144207250 17:12987953-12987975 AGGGGTGGCCAAAGCAAACCAGG + Intronic
1144213503 17:13034733-13034755 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1144299360 17:13909199-13909221 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
1144775994 17:17784885-17784907 GGGGCTGCAAAGAGCAAATGGGG - Intronic
1145124499 17:20289104-20289126 GGTGGTGGCAAGAGAAAAAGAGG + Intronic
1145849414 17:28077312-28077334 GGTGGCGGCAAGAGAAAATGAGG + Intronic
1146775748 17:35614133-35614155 GGGGCTGTCAAGAGCATCTCTGG - Intronic
1149064536 17:52464747-52464769 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
1149110086 17:53018463-53018485 GGCGGTCGCAAGAGAAAATGAGG + Intergenic
1149110348 17:53020393-53020415 GGCGGTGGCAAGAGAAAATGAGG + Intergenic
1149456827 17:56794893-56794915 GGGGGTGGCAAGAGTGAGGCAGG - Intronic
1149737371 17:59008808-59008830 GGGGGTGGGAATAGCATATGTGG - Intronic
1150092453 17:62339839-62339861 GGCAGTGGCAAGAGAAAATAAGG - Intergenic
1151197147 17:72439715-72439737 GGTGGTGGCTAGAGAAAATGAGG - Intergenic
1153022868 18:647157-647179 GGGGATGGCATGGGCAAATACGG + Intronic
1153099509 18:1450881-1450903 AGGGGTGGCATCAGCAACTCAGG - Intergenic
1153101073 18:1470323-1470345 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
1153199191 18:2632215-2632237 GGTGGTGGCAAGAGAAAACGAGG - Intergenic
1153199501 18:2634170-2634192 GGCGGTGGCAAGAGAAAATGAGG - Intergenic
1153888558 18:9490875-9490897 GGTAGTGGCAAGAGAAAATGAGG - Intronic
1154066521 18:11111615-11111637 GGGGGTGGCAGGAGAAGAACTGG - Intronic
1155143206 18:23062148-23062170 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1155278909 18:24218025-24218047 GGGGGAGGGAAGAGGAAACCTGG + Intronic
1155988252 18:32253421-32253443 GGCAGTGGCAAGAGAAAATGAGG + Intronic
1156516695 18:37686173-37686195 GGGGGTGCCAAGGGCACTTCTGG + Intergenic
1156940841 18:42765939-42765961 GGTGGTGGCAAGAGAAAATGAGG - Intronic
1156941124 18:42767868-42767890 GGTGGTGGCAAGAGAAAATGTGG - Intronic
1157234419 18:45950462-45950484 GGTGGTGGCAAGAGAGAATGAGG - Intronic
1157340177 18:46771362-46771384 AGGGGTGGGAAGAGCGATTCAGG - Intergenic
1158705833 18:59790959-59790981 GGAGGTGCCAAGAGCAAGCCAGG + Intergenic
1159306058 18:66643754-66643776 GGTGGCGACAAGAGCAAATGAGG + Intergenic
1159410730 18:68072106-68072128 GGTGGTGTCAAGAGAAAATGAGG - Intergenic
1159617359 18:70597371-70597393 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1159735952 18:72098272-72098294 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1159959790 18:74546538-74546560 GGGGGTGGCACGAGAGAATACGG - Intronic
1160109769 18:76015478-76015500 GGGCCTGGCAAGAGCACTTCCGG - Intergenic
1161386127 19:3994276-3994298 GTGGGGGGCAAAAGCCAATCTGG - Intergenic
1162596359 19:11632612-11632634 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1163539571 19:17899537-17899559 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
1163837189 19:19582102-19582124 GGAGGTGCCAGGAGCAAATGAGG - Intronic
1164443001 19:28293505-28293527 GGGGCTGGCAGGGGCAAGTCAGG + Intergenic
1164666333 19:30041094-30041116 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
1164841306 19:31394465-31394487 GGTAGTGGCAAGAGAAAATGAGG - Intergenic
1164863038 19:31578127-31578149 GGTGGTGGCAAGAGGAAATGAGG - Intergenic
1165006970 19:32815191-32815213 GGGGGTGGCAAGAGCAAATCTGG - Intronic
1165599942 19:37045956-37045978 GGCAGTGGCAAGAGAAAATGAGG + Intronic
1165888249 19:39094896-39094918 GGTGGTGGCAAGAGAAAATGAGG + Intronic
1166864924 19:45830035-45830057 GGGGGTGGCAGGCGCACACCTGG + Exonic
1167087792 19:47322242-47322264 GGTAGTGGCAAGAGAAAATGAGG + Intergenic
1167424407 19:49422670-49422692 GGCGGCGGCAAGAGCGAGTCTGG - Intronic
925514023 2:4659351-4659373 GGGGTTGGCAAGACAAAATTGGG - Intergenic
925640068 2:5978805-5978827 GGGTGTGGCCAGGGCAAAGCTGG + Intergenic
925805760 2:7646127-7646149 GGTGGTGGCAAGAAAAAATAAGG + Intergenic
926213473 2:10889032-10889054 GGTGATGGCAAGAGAAAATGAGG + Intergenic
926448375 2:12972594-12972616 GGTGGCGGCAAGAGAAAATGAGG + Intergenic
927612760 2:24558442-24558464 GGTGGTGGCAAGAGAAAATAAGG + Intronic
928159070 2:28905110-28905132 GGAGATGGCAAGAGCAAATGAGG + Intronic
930334257 2:50025545-50025567 GGCAGTGGGAAGAGTAAATCAGG + Intronic
931117171 2:59177503-59177525 AGGGGTGGAAAGAACAAATAAGG - Intergenic
931202815 2:60116629-60116651 GGCTGTGGCAAGAGAAAATGAGG + Intergenic
931828615 2:66027332-66027354 TGGAGTGGCATGAGGAAATCTGG - Intergenic
931929597 2:67115473-67115495 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
931963193 2:67504301-67504323 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
932552333 2:72784573-72784595 GGTGGCGGCAAGAGAAAATGAGG + Intronic
932629744 2:73329564-73329586 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
933008109 2:77022139-77022161 GGTGGCGGCAAGAGAAAATGAGG + Intronic
933008378 2:77024043-77024065 GGCAGTGGCAAGAGAAAATGAGG + Intronic
933398015 2:81755854-81755876 TGTGGCGGCAAGAGAAAATCAGG + Intergenic
934317390 2:91936635-91936657 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
935151188 2:100437955-100437977 GTCGGTGGCAAGAGAAAATGAGG - Intergenic
935304900 2:101727973-101727995 GAAGGTGGCAAGACCAAATAAGG + Intronic
935449004 2:103188194-103188216 GGTGGTGGGAAGAGAAAATGAGG - Intergenic
935475333 2:103514110-103514132 GGCGGTGGCAAGAGAAAATGAGG + Intergenic
935626113 2:105173569-105173591 GGTGGTGGCAAGAGAAAAAGAGG + Intergenic
935927646 2:108088115-108088137 GGTGGAGGCAAGAGAAAATGAGG - Intergenic
936351558 2:111716608-111716630 GGGGGAGTCAAGAGCATAGCTGG - Intergenic
936406035 2:112203791-112203813 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
936683608 2:114803172-114803194 GGTGGTGACAAGAGAAAATAAGG - Intronic
936792168 2:116163587-116163609 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
936862243 2:117031941-117031963 GGTGATGGCAAGAGAAAATGAGG + Intergenic
936936974 2:117848112-117848134 GGCGGCGGCAAGAGAAAATGAGG - Intergenic
937415038 2:121707765-121707787 GGGGGTGGCAAGAGTACATATGG + Intergenic
937897785 2:126991502-126991524 GTGGGAGGCAAGAGCGAAGCCGG + Intergenic
938286257 2:130120274-130120296 GGGAGTGGCAAGAGCAACGTGGG - Exonic
938336895 2:130508994-130509016 GGGAGTGGCAAGAGCAACGTGGG - Exonic
938429350 2:131218622-131218644 GGGAGTGGCAAGAGCAACGTGGG + Exonic
939272762 2:139960860-139960882 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
941560156 2:167035012-167035034 GGTGGTGGCAAGAGAGAATGAGG - Intronic
941803731 2:169689039-169689061 GGTGGTGGCAAGAGAAAATGAGG + Intronic
941864366 2:170318652-170318674 GTGGGTGGCAAGAGCAGAGCAGG + Intronic
942975885 2:182016253-182016275 AGGGGTGGCATCAGCAATTCAGG + Intronic
943832769 2:192484256-192484278 GGTGGTGGCAAAAGAAAATGAGG - Intergenic
943833042 2:192486198-192486220 GGTGATGGCAAGAGAAAATGAGG - Intergenic
944044197 2:195389431-195389453 GGCTGTGGCAAGAGAAAATGAGG - Intergenic
944828136 2:203505316-203505338 GGCGGTGGCAAGAGAAAATGTGG + Intronic
945323163 2:208450777-208450799 GGCTGTGGCACGAGCAACTCTGG + Exonic
946437023 2:219663982-219664004 GGCGGTGGCAAGAGAGAATGAGG + Intergenic
946480923 2:220055795-220055817 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
946574139 2:221056431-221056453 GGTGGTGTCAAGAGAAAATGAGG + Intergenic
946574390 2:221058203-221058225 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
946930255 2:224663670-224663692 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
947044636 2:225967572-225967594 GGTGGTGGCAAAAGAAAATGAGG + Intergenic
947573123 2:231250803-231250825 GGGAGTGGGCAGAGCAAATGTGG + Intronic
947646760 2:231747902-231747924 GGCGGCGGCAAGAGAAAATGAGG - Intronic
948346676 2:237304524-237304546 GGTGGTGGCAAGAGAACATGAGG - Intergenic
1170364787 20:15587177-15587199 GGTGGCGGCAAGAGAAAATGAGG + Intronic
1170395735 20:15923293-15923315 GGCGGTGGCAAGAGAAAATGAGG + Intronic
1170872382 20:20218323-20218345 GGTGGTGGCAAGACAAAATGAGG - Intronic
1171290283 20:23979190-23979212 GGGGGTGGCATGAGCAATCAGGG + Intergenic
1172200336 20:33121642-33121664 GGCGGTGGCAAGAGAGAATGAGG - Intergenic
1172240823 20:33411468-33411490 GTGGGTGGCAGGAGCAGATGGGG - Intronic
1172397351 20:34617957-34617979 GGTGGTGGCAAGAGAGAATGAGG - Intronic
1172645651 20:36467656-36467678 GGGAGTGGGAAGAGCCAATTGGG + Intronic
1173726570 20:45302644-45302666 GGGAGTGGCAAGGGCAGCTCAGG + Intronic
1174289801 20:49499992-49500014 GGGGGTGGCAGGAGCCACTCTGG - Intergenic
1174856972 20:54055404-54055426 GGTGGTGGCAAGAGAAAATGAGG + Intronic
1174950902 20:55040706-55040728 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
1176131439 20:63498400-63498422 GGGGGTGCCTAGAGCTATTCTGG - Intronic
1176933824 21:14843688-14843710 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1177117386 21:17102763-17102785 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
1177485173 21:21746960-21746982 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1177523872 21:22267675-22267697 GGGAGTGGCAAGAGAAAATGAGG - Intergenic
1178262009 21:31108277-31108299 TGGGGAGGCAAGAGGAAAGCTGG - Intergenic
1178847853 21:36188364-36188386 GGCGGTGGCAAGAGATAAGCTGG - Intronic
1179038782 21:37783446-37783468 GGTGGTGGCAAGAGAAAATGAGG - Intronic
1179473020 21:41624523-41624545 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1180305564 22:11120427-11120449 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
1180544083 22:16482606-16482628 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
1180767145 22:18351822-18351844 GGGGGTGGCATGAGCAATCAGGG - Intergenic
1180779165 22:18510557-18510579 GGGGGTGGCATGAGCAATCAGGG + Intergenic
1180811885 22:18767877-18767899 GGGGGTGGCATGAGCAATCAGGG + Intergenic
1181198041 22:21202121-21202143 GGGGGTGGCATGAGCAATCAGGG + Intergenic
1181401705 22:22653683-22653705 GGGGGTGGCATGAGCAATCAGGG - Intergenic
1182948560 22:34349133-34349155 GTGTGTGGTAAGAGAAAATCAGG - Intergenic
1183361264 22:37384575-37384597 GGGGGAGGCAAGGGCAAGTGGGG - Intronic
1184442819 22:44528748-44528770 GAGGATGGCAAGAGCAAGTTAGG + Intergenic
1184713069 22:46264350-46264372 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
1185084841 22:48735231-48735253 CGGGGTGGCTAGAGGAGATCAGG - Intronic
1185414239 22:50701066-50701088 GGGGGTGGGGGGAGCAGATCTGG - Intergenic
1203228766 22_KI270731v1_random:92716-92738 GGGGGTGGCATGAGCAATCAGGG - Intergenic
949872711 3:8602919-8602941 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
949934543 3:9106674-9106696 GGTGGTGGCAAGAGAAAATGAGG - Intronic
949939607 3:9144644-9144666 GGTGGCGGCAAGAGAAAATGAGG - Intronic
950539181 3:13599774-13599796 GGGGGTGGCTTGGGAAAATCCGG + Intronic
950576550 3:13835493-13835515 GGGGGTGGCCAGAGCCAGGCAGG - Intronic
950700540 3:14742789-14742811 GGTGGTGGCAAGAGAAAACGAGG + Intronic
950800898 3:15551182-15551204 GGTGGTGGCAAGAGAAAACGAGG - Intergenic
950963222 3:17127733-17127755 GGTGGTAGCAAGAGAAAATGAGG - Intergenic
951604954 3:24422820-24422842 GGGGGTGGCATGTGCATATAGGG - Intronic
952195592 3:31072563-31072585 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
952269119 3:31815216-31815238 GGGGGCGGGAAGAGCAAGCCAGG - Intronic
953696990 3:45167361-45167383 GGGGGTGGTATGTGCATATCTGG + Intergenic
953943080 3:47119601-47119623 GGTGGTGGCAAGAGAAAAAGAGG - Intronic
954451639 3:50574893-50574915 GAGGGTGGCAAGTCCAAAGCAGG - Intronic
954456825 3:50604122-50604144 GGGGGTGGGAAGAGTAACTTTGG - Intergenic
954759426 3:52863317-52863339 GGTGGTGGCAAGAGAAAATGAGG + Intronic
954849339 3:53587181-53587203 GGGAGGGGCAAGAACAAAACTGG + Intronic
955530140 3:59864354-59864376 GGTGGCAGCAAGAGAAAATCAGG - Intronic
955675382 3:61442707-61442729 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
956503120 3:69909237-69909259 GGTGGTGGCAAGAGAAAATGAGG - Intronic
956546509 3:70408960-70408982 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
956885667 3:73556930-73556952 GGGGCTGGAAAGAGGAAAACAGG - Intronic
957274558 3:78074166-78074188 GGTGGCGGCAAGAGAAAATGAGG + Intergenic
957704140 3:83756927-83756949 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
957737138 3:84216696-84216718 GGCGGTGGCAAGAGAAAATGAGG + Intergenic
957762033 3:84571774-84571796 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
957929891 3:86863952-86863974 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
957963283 3:87288692-87288714 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
957988033 3:87596339-87596361 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
958428432 3:94007550-94007572 GGTGGTGGCAAGAGAAAATGAGG + Intronic
958600218 3:96287954-96287976 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
958661319 3:97071506-97071528 GCCGGTGGCAAGAGAAAATGAGG + Intronic
958910980 3:99994764-99994786 GGGGGTGGCAAGAGAAAATGAGG + Intronic
958911271 3:99996684-99996706 GGGGGTGGCAAGAGAAAATGAGG + Intronic
959235525 3:103717743-103717765 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
959727231 3:109558228-109558250 GGCGATGGCAAGAGAAAATGAGG - Intergenic
959762191 3:109978268-109978290 AGGGGTGGCATGGGCAATTCAGG + Intergenic
959968540 3:112382467-112382489 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
960492649 3:118335179-118335201 GGGGGTAGCAAGATCCAATCTGG - Intergenic
960496887 3:118385040-118385062 GATGGTGGCAAGAGAAAATGAGG - Intergenic
962045635 3:131756938-131756960 GGCAGTGGCAAGAGAAAATGAGG - Intronic
962346520 3:134623180-134623202 GGGAGTGGCCAGAGCAAGCCAGG - Intronic
962440042 3:135405395-135405417 GGTGGCGGCAAGAGAAAATGAGG + Intergenic
963356410 3:144213522-144213544 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
963744580 3:149113678-149113700 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
963806853 3:149731414-149731436 GGGTTTGACAAGAGAAAATCAGG + Intronic
963868156 3:150385195-150385217 GGTGGCAGGAAGAGCAAATCAGG + Intergenic
964427257 3:156567271-156567293 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
965878660 3:173360799-173360821 GGATGTGGAATGAGCAAATCTGG - Intergenic
965897561 3:173595784-173595806 GGTGGTGGCAAGAGAAAATGAGG + Intronic
966083523 3:176036983-176037005 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
966676635 3:182597138-182597160 GGGAGTGTGAAGATCAAATCAGG + Intergenic
966733204 3:183167820-183167842 GGTGGCGGCAAGAGAAAATGAGG + Intergenic
967351400 3:188517665-188517687 GGCGGTGGTAAGAGAAAATGAGG + Intronic
967609297 3:191484190-191484212 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
967689683 3:192458999-192459021 GGTGGTGGCAAGAGAAAATGAGG - Intronic
967717279 3:192776227-192776249 GGTAGTGGCAAGAGAAAATAAGG - Intergenic
968817023 4:2827569-2827591 GGGGGTGGTGAGAGCCAAACCGG - Intronic
970090381 4:12400622-12400644 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
970222390 4:13824400-13824422 GGTGGTGGCAGGAGAAAATCAGG - Intergenic
970222668 4:13826329-13826351 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
970321817 4:14882224-14882246 GGGGGTGGATAGAGGAAATATGG + Intergenic
970339281 4:15087236-15087258 GGTGGTGGAAAGAGAAAATCAGG + Intergenic
970357978 4:15276864-15276886 GGTGTTGGCAAGAGAAAATGAGG + Intergenic
970427043 4:15955059-15955081 GGTGGCGGCAAGAGAAAATGAGG + Intergenic
970741925 4:19249693-19249715 GGTGGCAGCAAGAGCAAATGAGG - Intergenic
970742207 4:19251537-19251559 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
971481768 4:27121133-27121155 TGGGGTGGAAAGAGTAAATCTGG - Intergenic
972100221 4:35406664-35406686 GGTGGTGCCAAGAGAAAATGAGG - Intergenic
972100498 4:35408596-35408618 GGAGGTGGCAAGAGAAAACGAGG - Intergenic
972900048 4:43672210-43672232 GGAGGTGCCAAGAGCAAGTGAGG - Intergenic
972974706 4:44619894-44619916 GAGGGTGGACTGAGCAAATCTGG + Intergenic
973078472 4:45961135-45961157 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
974104668 4:57456247-57456269 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
974104844 4:57458258-57458280 GGTGGTGGCAAGAGAGAATGAGG + Intergenic
974453939 4:62101745-62101767 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
974535799 4:63173542-63173564 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
975257690 4:72256579-72256601 GGTGGTGGCAAGAGAGAATGAGG - Intergenic
975540804 4:75509777-75509799 GGTGGTGGCAATAGAAAATGAGG - Intronic
975706516 4:77117426-77117448 GGGGGCGGCAAGAGAAAATGAGG + Intergenic
976003474 4:80400542-80400564 GGCGGTAGCAAGAGAAAATGAGG - Intronic
976949723 4:90813638-90813660 GGCAGTGGCAAGAGAAAATGAGG - Intronic
977022032 4:91771352-91771374 GGTGGTGGCAAGAGAAAAATGGG + Intergenic
977099715 4:92795360-92795382 GGTGGTGGCAACAGAAAATGAGG - Intronic
977592339 4:98841167-98841189 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
977714491 4:100166804-100166826 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
977949629 4:102955255-102955277 GGTGGCGGCAAGAGAAAATGAGG - Intronic
978100915 4:104840475-104840497 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
978101210 4:104842401-104842423 GGTGGTGGCAAGAGAAAAATAGG + Intergenic
979922862 4:126523819-126523841 GGTGGTGGCAAGAAAAAATGAGG + Intergenic
980202921 4:129678213-129678235 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
980686287 4:136234139-136234161 GGTGGTGGCAAAAGCTAATGGGG - Intergenic
981281534 4:142965324-142965346 GGTGGTGACAAGAGAAAATGAGG + Intergenic
981643184 4:146968204-146968226 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
981997799 4:150993673-150993695 GGTGGTGGCAAGAGAAAAAGAGG + Intronic
982279015 4:153665090-153665112 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
982730642 4:158952428-158952450 GGTGGTGGCAAGAGAAAATGAGG - Intronic
983014750 4:162599630-162599652 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
983083152 4:163412657-163412679 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
983337377 4:166414917-166414939 GGTGGTGGCAAGACAAAATGAGG + Intergenic
983462741 4:168047690-168047712 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
984017462 4:174442744-174442766 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
984841071 4:184068073-184068095 AGAGGGGGCAAGAGCAAATTTGG - Intergenic
984922657 4:184779321-184779343 GGTGGCGGCAAGAGAAAATGCGG - Intronic
985183853 4:187295524-187295546 GGTGGCGGCAAGAGAAAATGAGG + Intergenic
985809349 5:2071569-2071591 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
986450068 5:7854558-7854580 GGTGGCGGCAAGAGAAAATGAGG + Intronic
986908159 5:12520265-12520287 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
987332865 5:16872752-16872774 GGTGGTGGCAAGAGAAAATGAGG + Intronic
987651019 5:20740021-20740043 GGCGGCGGCAAGAGAAAATGAGG - Intergenic
987658343 5:20838404-20838426 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
987725173 5:21688584-21688606 GGAGGAGGCAAGAGAAAATGAGG - Intergenic
988439870 5:31220808-31220830 GGGGGTGGGAAGATGAAAACTGG + Intronic
988501114 5:31784566-31784588 GGGGGTGGTCAGTGCAAAACAGG + Intronic
988620154 5:32815127-32815149 GGTGGTAGCAAGAGAAAATGAGG - Intergenic
988744543 5:34121442-34121464 GGCGGCGGCAAGAGAAAATGAGG + Intronic
990198258 5:53342949-53342971 GGTGGTGACAAGAGAAAATGAGG - Intergenic
990252705 5:53932763-53932785 GTGGCTGGCAATAGCAAAGCAGG + Intronic
990595429 5:57308421-57308443 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
990844428 5:60121503-60121525 GTTGGTGGCAAGAGAAAATGAGG + Intronic
991285823 5:64974415-64974437 GGTGGTGGCAAGAGAGAATGAGG + Intronic
991369144 5:65900129-65900151 GAGGGTGGCAAGAGAAGATGAGG + Intergenic
992122713 5:73611056-73611078 GGCGGTGGCAAGAGAAAATGAGG + Intergenic
992693345 5:79260346-79260368 GGTGGTGGCAAGAGCAGCTGTGG - Intronic
992838134 5:80660272-80660294 GGCGGTGGCAAGAGAAAATGAGG + Intronic
993235024 5:85293626-85293648 GGGGTTGGAGAGAGCAAAGCCGG - Intergenic
993309568 5:86312891-86312913 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
993575285 5:89592096-89592118 GGTGGTGGCAAGAAAAAATGAGG - Intergenic
994153835 5:96479885-96479907 GAGGGTGGCAAGAGCACTCCAGG + Intergenic
994524072 5:100881839-100881861 GGCGGTGGCAAGAGAAACTGGGG - Intronic
994831100 5:104785144-104785166 GGTGGTGGCAAGAAAAAATGAGG - Intergenic
995488439 5:112663378-112663400 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
995883639 5:116869426-116869448 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
996194685 5:120589634-120589656 GGTGGTGGCAGGAGAAAATGAGG + Intronic
996196204 5:120610630-120610652 GGCAGTGGCAAGAGAAAATGAGG - Intronic
996196490 5:120612569-120612591 GGTGGTGGCAAGAGAAAATGAGG - Intronic
996617548 5:125458905-125458927 GGTGGCAGCAAGAGAAAATCGGG - Intergenic
997108377 5:131046924-131046946 GGTGGTGGCAAGAGAAAAAGGGG + Intergenic
998398431 5:141834780-141834802 GGGGTTGGCAAGGGCCAATCAGG + Intergenic
998538521 5:142956820-142956842 GGTGGTGGCAAGAGAGAATGAGG + Intronic
998889491 5:146730677-146730699 GGTGGCGGCAAGAGAAAATGAGG - Intronic
999100008 5:149015702-149015724 GCGGGTGGTAAGAGGAAGTCTGG - Intronic
999108148 5:149091940-149091962 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
999269570 5:150288942-150288964 GGAGGTGGGGAGAGGAAATCAGG - Intronic
999585860 5:153088847-153088869 GGGTGTCCCAAGAGAAAATCTGG + Intergenic
999636572 5:153629204-153629226 GGGGGAGGGAAGAGGAAATGAGG - Intronic
1000676467 5:164127897-164127919 GGTGGTGGCAAGAGAAAACAAGG + Intergenic
1001544882 5:172564892-172564914 GGAGCTGGCAAGAGCAGATTGGG + Intergenic
1002464224 5:179397738-179397760 CGTGGTGGCAAGAGAAAATGAGG - Intergenic
1003373821 6:5555173-5555195 GGTGGTGACAAGAGAAAATGAGG - Intronic
1003401886 6:5797370-5797392 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
1003659124 6:8043959-8043981 GGTGGTAGCAAGAGAAAATGAGG - Intronic
1003697622 6:8426535-8426557 GGTGGTGGCAAGAGAAAATGAGG - Intronic
1004699376 6:18064944-18064966 GGCGGTGGCAAGAGAAAATGAGG + Intergenic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005906549 6:30266020-30266042 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1005977084 6:30807949-30807971 GGAGGTGGCAAGAGCAAGCGAGG + Intergenic
1006067926 6:31475705-31475727 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
1006303136 6:33204593-33204615 GGGCGTGGCAAGGGCAAAGCCGG - Intergenic
1006344023 6:33465455-33465477 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1006344298 6:33467382-33467404 GGCGGTGGCAAGAGAAAATGAGG - Intergenic
1006697298 6:35941687-35941709 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
1006725748 6:36197640-36197662 GGGGGTGCCGAGGGGAAATCTGG + Intronic
1007228184 6:40329252-40329274 GAGGGAGACAAGGGCAAATCAGG + Intergenic
1007971608 6:46057345-46057367 GGCGGTGGCCAGAGAAAATGAGG - Intronic
1008279661 6:49581542-49581564 TGAGGTGGCAACAGCAACTCTGG - Intergenic
1008705403 6:54152462-54152484 GGTGGTGGTAAGAGAAAATGAGG + Intronic
1008755996 6:54796299-54796321 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1008926865 6:56896391-56896413 GGTGGTGGCAAGAGAAAATAAGG - Intronic
1009471347 6:64031012-64031034 GGAGGTGCCAAGAGCAAGTGAGG - Intronic
1009480809 6:64156282-64156304 GGTGGTGGCAAGATAAAATGAGG - Intronic
1009490366 6:64283797-64283819 GGTGGTGGCAAGAGAAAATAAGG + Intronic
1009688380 6:66992426-66992448 GGGGGTGGCTAGAGTGAAGCTGG + Intergenic
1010227704 6:73506497-73506519 GGGAGTGGCAAGAGAAAATGAGG - Intronic
1010411744 6:75568783-75568805 GGTGGTGGCAAGAGGAATTTAGG + Intergenic
1010494285 6:76514211-76514233 GGTGGGGGCAAGAGAAAATGAGG + Intergenic
1010612016 6:77964007-77964029 GGTGGTGGCAAGAGAGAATGAGG - Intergenic
1010922639 6:81703313-81703335 GGCAGTGGCAAGAGAAAATGAGG - Intronic
1011353919 6:86453970-86453992 GGAGGTGGCAAGAGAAAATGAGG - Intergenic
1012195865 6:96341127-96341149 GGTGGTGGCAAGAGAAAATTAGG + Intergenic
1012196134 6:96343053-96343075 GGTGGCGGCAAGAGAAAATGAGG + Intergenic
1012546489 6:100425154-100425176 GGCAGTGGCAAGAGAAAATGAGG - Intronic
1013762899 6:113538767-113538789 GCGGCTGACCAGAGCAAATCTGG + Intergenic
1014482317 6:121953919-121953941 GGTGGTGGCAAGAGAAAGTGAGG + Intergenic
1014482623 6:121956153-121956175 GGTGGTAGCAAGAGAAAATGAGG + Intergenic
1014817383 6:125950964-125950986 GGTGGAGGCAAGAGAAAATAAGG - Intergenic
1015523320 6:134152592-134152614 GGTGGTGGCAAGAGAAAATAAGG - Intergenic
1015676954 6:135761440-135761462 GATGGTGGCAAGAGAAAATGAGG + Intergenic
1015735796 6:136398645-136398667 GGTGGTGGCAAGAGCAAATGAGG - Intronic
1015754834 6:136596698-136596720 AGGGGTGGAAAGAGCAAGACAGG + Intronic
1015969793 6:138732149-138732171 GGCGATGGCAAGAGAAAATGAGG + Intergenic
1016297340 6:142587374-142587396 GGTGGTGGCAAGAGAAAATAAGG - Intergenic
1016450828 6:144180553-144180575 TGTGGTGGCAAGAGAAAATGAGG - Intronic
1016614212 6:146028301-146028323 GGAGGTTGAAAGAGCAAAGCGGG + Intronic
1017785206 6:157751193-157751215 GGGGGTGGCAAGAGAAAATGAGG + Intronic
1017791034 6:157799677-157799699 GGTGGTGGCAAGAGAAAATGAGG + Intronic
1018270213 6:162069273-162069295 GGTGGTGGCAAGAGAAAATGAGG - Intronic
1019025135 6:168955022-168955044 GGGGGTTGCAAGAGGACATGGGG + Intergenic
1019050891 6:169182745-169182767 GGCGGCGGCAAGAGAAAATGAGG + Intergenic
1019638450 7:2089402-2089424 GGTGGTAGCAAGAGAAAATGAGG - Intronic
1021507532 7:21402110-21402132 GGAGGCGGCAAGAGAAAATGAGG - Intergenic
1021656582 7:22879926-22879948 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
1022678532 7:32522924-32522946 GGCGGTGGCAAGAGAAAATGAGG - Intronic
1022909002 7:34882279-34882301 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1026278557 7:68901901-68901923 GGCGGCGGCAAGAGAAAATGAGG - Intergenic
1026295129 7:69044926-69044948 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
1026391124 7:69903142-69903164 GGGGGTGGGAAAAGCAAAAGAGG + Intronic
1026571636 7:71536533-71536555 GGCGATGGCAAGAGAAAATGAGG + Intronic
1027481746 7:78706322-78706344 GATGGTGGCAAGAGAAAATGAGG - Intronic
1027670130 7:81086470-81086492 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
1027834303 7:83220200-83220222 GATGGTGGCAAGAGAAAATTAGG - Intergenic
1027836877 7:83255186-83255208 GGAGGTGGCAAGATCAAAAGAGG + Intergenic
1027922724 7:84416294-84416316 GGTGGTGGCAAGAGAAAATGAGG - Intronic
1028138496 7:87246711-87246733 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1028142842 7:87291022-87291044 GGTGATGGCAAGAGAAAATGAGG - Intergenic
1028869887 7:95758257-95758279 GGGGGTGGCAAGGGCACCACTGG + Intergenic
1030161884 7:106517654-106517676 GGTGGTGGCAAGATAAAATGAGG - Intergenic
1030784396 7:113641895-113641917 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1031055756 7:116991443-116991465 GGTGGCGGCAAGAGAAAATGAGG + Intronic
1031145592 7:117994119-117994141 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1031174919 7:118338161-118338183 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
1032779871 7:135156964-135156986 GGTGGTGGCAAGAGAAAATGAGG - Intronic
1032913722 7:136463080-136463102 GGTGGTGACAAGAGAAAATGAGG + Intergenic
1033054232 7:138034924-138034946 GGTGGCGGCAAGAGAAAATGAGG + Intronic
1033549705 7:142435796-142435818 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
1033772473 7:144567588-144567610 GGCAGTGGCAAGAGAAAATGAGG + Intronic
1034320368 7:150174296-150174318 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1034642179 7:152612996-152613018 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
1034772374 7:153792925-153792947 GGCGGTGGCAAGAGAAAATGAGG - Intergenic
1034815504 7:154169005-154169027 TGGAGTGGCAAGAGCAAGGCTGG + Intronic
1035728086 8:1836907-1836929 GGCGGCGGCAAGAGAAAATGAGG - Intronic
1035840852 8:2810723-2810745 GGCGGCGGCAAGAGAAAATGAGG + Intergenic
1036000464 8:4596944-4596966 GGAGGTGGCAAGAGAAAATGAGG - Intronic
1036499567 8:9300883-9300905 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
1037241471 8:16783761-16783783 GGAGGTGCCAAGAGCAAGTGAGG - Intergenic
1038139180 8:24823492-24823514 GGTGGTGGCAAGGGAAAATGAGG - Intergenic
1038589246 8:28821312-28821334 GGCGGTGGCAAGAGAAAATGAGG + Intronic
1039657400 8:39424451-39424473 GGCGGTGGCAAGAGAAAATGAGG + Intergenic
1040643672 8:49371804-49371826 GGCGGTGGCAAGAGAAAATAAGG + Intergenic
1040645567 8:49392642-49392664 GGTGGTGGCAAGAAAAAATGAGG + Intergenic
1041431610 8:57787447-57787469 GGTGGTGGCAAGGGAAAATGAGG - Intergenic
1041774091 8:61505173-61505195 GGTGGCGGCAAGAGAAAATAAGG - Intronic
1041792959 8:61716276-61716298 GGAGGTGGCAAGAGAAAATGAGG + Intergenic
1041878467 8:62718039-62718061 GGTGGTGGCAAGAGAGAATGAGG + Intronic
1042074067 8:64968617-64968639 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1042085225 8:65100085-65100107 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1042432923 8:68728588-68728610 GGCAGTGGCAAGAGAAAATAAGG + Intronic
1042466216 8:69132525-69132547 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1042692308 8:71514588-71514610 GGCAGTGGCAAGAGAAAATGAGG + Intronic
1043110044 8:76169462-76169484 GGAGGTGCCAAGAGCAAGTGAGG - Intergenic
1043235648 8:77862226-77862248 GGGGGTGGCCGGTGCAAATCTGG + Intergenic
1043265750 8:78266032-78266054 GGTGGTGGCAAGAGAGAATGAGG - Intergenic
1043621942 8:82204647-82204669 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
1043743445 8:83843470-83843492 GGCAGTGGCAAGAGAAAATGAGG - Intergenic
1043834884 8:85034551-85034573 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1044443203 8:92244447-92244469 GGCGGTGGCAAGAGAAAATGAGG + Intergenic
1044456067 8:92394057-92394079 GGAGGTGCCAAGAGCAAGTGAGG + Intergenic
1045082773 8:98646805-98646827 GGAGGTGGTAAGACCTAATCAGG - Intronic
1045993135 8:108333642-108333664 TGTGGTGCCAAGAGCAAATCTGG + Intronic
1046129408 8:109947655-109947677 GGCAGCGGCAAGAGAAAATCAGG - Intergenic
1046231643 8:111365540-111365562 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
1047194727 8:122711334-122711356 GGTGGTGGCAAGACAAAATGAGG - Intergenic
1047788431 8:128177215-128177237 TGGGGTAGCAAGGGCAAAACCGG + Intergenic
1047941298 8:129829908-129829930 GGTGGTGGCAAGACAAAATGAGG + Intergenic
1048339499 8:133527820-133527842 TGGGGTGGCCAGAGCCCATCTGG - Intronic
1048782833 8:138020886-138020908 GGTGGTGGCAAGAAAAAATGAGG - Intergenic
1048783121 8:138022816-138022838 GGCGGTGACAAGAGAAAATGAGG - Intergenic
1049167220 8:141133872-141133894 GGGGGTGGCAGGAGGCAGTCAGG + Intronic
1049825454 8:144664722-144664744 GGTGGTGGCAAGAAAAAATAAGG - Intergenic
1050411542 9:5371499-5371521 GGCGGTGGCAAGAGAAAATGAGG - Intronic
1050805525 9:9671719-9671741 GGTGGTGGCAACAGAAAATGAGG - Intronic
1050910092 9:11056810-11056832 GGAAGTGGCAAGAGAAAATGAGG - Intergenic
1051361273 9:16283663-16283685 GAGTGTGGCAAGAGGGAATCAGG - Intergenic
1051383887 9:16486091-16486113 GGGGGTGGAAACAACAAAGCAGG - Intronic
1052472561 9:28918202-28918224 GGTGGCGGCAAGAGAAAATGAGG + Intergenic
1052575913 9:30292263-30292285 GGTAGTGGCAAGAGAAAATGAGG + Intergenic
1052576184 9:30294176-30294198 GGTGGTGGCAAGAGAAACTGAGG + Intergenic
1052834589 9:33241025-33241047 GGGGGTTGCAATTTCAAATCAGG + Intronic
1053384304 9:37674699-37674721 GGTGGCGGCAAGAGCAAATGAGG + Intronic
1055333606 9:75209139-75209161 GGCGGTGGCAAGAGAATAGCTGG - Intergenic
1055372965 9:75620017-75620039 GGCGGTGACAAGAGAAAATCAGG - Intergenic
1056021538 9:82443052-82443074 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1056236245 9:84597665-84597687 GGGTGAGGTAGGAGCAAATCTGG - Intergenic
1056471097 9:86904973-86904995 GAGAGTGGCATGAGCAACTCAGG + Intergenic
1056638519 9:88350602-88350624 GGGGGCGGCAAGAGAAAATGAGG + Intergenic
1056690085 9:88800567-88800589 GGGGGAGGCCAGAGGAAATTAGG + Intergenic
1057863004 9:98656903-98656925 GGTGCTGGCAAGAGCAAAGCTGG + Intronic
1058004439 9:99900901-99900923 GGTGGTGACAAGAGAAAATACGG + Intergenic
1058725292 9:107797450-107797472 GGGGGCAGCAAGAGAAAATGAGG + Intergenic
1058774157 9:108267463-108267485 GGTAGTGGCAAGAGAAAATGAGG - Intergenic
1059482484 9:114602145-114602167 GGTGGAGGCAAGAGAAAATGAGG + Intergenic
1059716503 9:116918058-116918080 GGTGGCGGCAAGAGAAAATGAGG - Intronic
1059753747 9:117273148-117273170 GGCAGTGGCAAGAGAAAATGAGG + Intronic
1059991641 9:119870790-119870812 GGAGGTGCCAAGAGCAAGTGAGG + Intergenic
1060311817 9:122469386-122469408 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1060620424 9:125060692-125060714 GGCAGTGGCAAGAGAAAATGAGG - Intronic
1060909656 9:127339392-127339414 GGTGGCGGCAAGAGAAAATGAGG + Intronic
1061276836 9:129573719-129573741 GGGAGTGGGAAGAGCAAAACAGG - Intergenic
1186231453 X:7459377-7459399 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1186906201 X:14113339-14113361 GGGGGTGACAAAATCTAATCTGG + Intergenic
1186992594 X:15085480-15085502 GGTGGTGGCAAGAGGAAATGAGG - Intergenic
1187328402 X:18313390-18313412 GGTGGCGGCAAGAGAAAATGAGG - Intronic
1187413397 X:19070587-19070609 GGGGGTGGCGAGAGCCAACTGGG + Intronic
1188657340 X:32715094-32715116 GGGGGTGGAAGGAGGAAATGGGG - Intronic
1188794342 X:34443055-34443077 GGTGGCGGCAAGAGAAAATGAGG + Intergenic
1189028680 X:37427962-37427984 GGTGGTGGCAAGAGAAAATGAGG + Intronic
1189378279 X:40482858-40482880 GGCGGTGGCAAGAGAAAATGTGG + Intergenic
1190883959 X:54514233-54514255 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
1191626362 X:63275315-63275337 GGTGGTGGCAGTAGAAAATCAGG - Intergenic
1192501481 X:71656465-71656487 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1192846151 X:74908925-74908947 GGTGGTGGCAAGAGAAAATGAGG - Intronic
1193230644 X:79041522-79041544 TGTGGTGGCAAGAGAAAATGAGG + Intergenic
1193232335 X:79062591-79062613 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1193498528 X:82241815-82241837 GGTGGTGGCAATAGAAAATGAGG - Intergenic
1193759319 X:85444245-85444267 GGCGGTGGCAAGAGAAAATGGGG + Intergenic
1194335780 X:92644504-92644526 GGAGGTGGCAAGTGCAAAAGAGG + Intergenic
1194474116 X:94336558-94336580 GGTGGCGGCAAGAGAAAATAAGG - Intergenic
1194503675 X:94707657-94707679 GGTGGTGGCAAGAGAGAATGAGG + Intergenic
1194829091 X:98598027-98598049 GGTGGTGGCAAGAGAAAATGAGG + Intergenic
1194864790 X:99052946-99052968 GGAGGTGGCAAGATAAAATGAGG - Intergenic
1195322307 X:103729670-103729692 GGAGGTGGAAAGAGAAAACCGGG - Intergenic
1195745541 X:108113699-108113721 GGCGGTGGCAAGAGAAAATGAGG + Intronic
1195863867 X:109408721-109408743 GGTGGTGGCAAGAGAAAATGAGG - Intronic
1196302656 X:114064556-114064578 GGTGGTGGCAAGAAAAAATAAGG - Intergenic
1196399686 X:115300753-115300775 GGTGGTGCCAAGAGCATCTCTGG - Intronic
1196558500 X:117120132-117120154 GGCAGTGGCAAGAGAAAATGAGG + Intergenic
1196558765 X:117122049-117122071 GGTGGCGGCAAGAGAAAATGAGG + Intergenic
1196973736 X:121137026-121137048 GGTGGCGGCAAGAGAAAATGAGG + Intergenic
1197037334 X:121890163-121890185 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1198677207 X:139143943-139143965 GGGGGTGGCAGGTGCATATTAGG - Intronic
1198777810 X:140199450-140199472 GGTGGTGGCAAGAGAGAATGAGG + Intergenic
1198975050 X:142327267-142327289 GTGGGTGGCAGTAGCCAATCAGG + Intergenic
1199191555 X:144977598-144977620 GGAGGCGGCAAGAGAAAATAGGG - Intergenic
1200218520 X:154379379-154379401 GGGGGCGGCACGAGCGCATCGGG - Exonic
1200979771 Y:9251901-9251923 GGCGGTGGCAAGAGGGAATGAGG + Intergenic
1201184698 Y:11389018-11389040 GGTGGCGGCAAGAGAAAATGAGG - Intergenic
1202019937 Y:20453648-20453670 GGTGGTGGCAAGAGAAAATGAGG - Intergenic
1202131609 Y:21617348-21617370 GGTGGTGGCAAGAGGGAATAAGG - Intergenic