ID: 1165007716

View in Genome Browser
Species Human (GRCh38)
Location 19:32820073-32820095
Sequence CTATCGAAGGAGAAGAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165007711_1165007716 -7 Left 1165007711 19:32820057-32820079 CCTAGCAGAGGAGGATCTATCGA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1165007716 19:32820073-32820095 CTATCGAAGGAGAAGAGGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165007716 Original CRISPR CTATCGAAGGAGAAGAGGGT GGG Intronic
902572420 1:17355254-17355276 CTATTGAACAAGAAGAGGCTGGG + Intronic
904527000 1:31141285-31141307 CTATCAAAGGAGGAGAGGAGAGG + Intergenic
907670700 1:56472630-56472652 ATATTGAATGAGAAGAGGTTTGG + Intergenic
908623797 1:66016944-66016966 CTACTGAAGGAGAAGAGTATGGG + Intronic
908701461 1:66906727-66906749 AGATAGAAGGAGAATAGGGTAGG - Intronic
910499338 1:87871507-87871529 CTATGGAAGGAGAAGATGTGTGG - Intergenic
912954864 1:114148213-114148235 CTATGGGTGGAGAAGAGGGGAGG - Intronic
914956767 1:152169648-152169670 CTGTCCCAGGAGAAGAGGGAAGG + Intergenic
917556205 1:176091700-176091722 CAATCGAACCAGAAGAGGGATGG + Intronic
919745983 1:201009453-201009475 CTGTCGAAGGAGAAGATTGAGGG - Exonic
920009307 1:202856211-202856233 CTTCCTCAGGAGAAGAGGGTTGG - Intergenic
924699326 1:246435156-246435178 CTATTAAAGGAGAAGAGGAAAGG + Intronic
1064570839 10:16691530-16691552 CTTGGGAAGGAGAAGAAGGTTGG - Intronic
1066350154 10:34630065-34630087 CTATCAAACTAGAAGAGGGAGGG + Intronic
1067294170 10:44965239-44965261 CTATGGAAGGAGGAGAGGCTTGG + Intronic
1068654899 10:59564436-59564458 CCAAGGAAGGAGAAGAGGGCAGG + Intergenic
1069021767 10:63496472-63496494 CTTTGGAAGAAGAAGAGAGTGGG - Intergenic
1070588866 10:77787419-77787441 CCATCGAAGGAGAGGAGGACAGG + Intergenic
1072463988 10:95646335-95646357 CTGTATCAGGAGAAGAGGGTGGG + Intronic
1073135089 10:101215931-101215953 CTTTTGAAGGAGAAGACGGTGGG - Intergenic
1074181698 10:111070887-111070909 CTAGAGAAAGAGAAGAGAGTTGG - Intergenic
1074860831 10:117509107-117509129 CTATAGGATGAGAAGATGGTGGG + Intergenic
1076109507 10:127850037-127850059 CCATCAAAGGGGAAGAAGGTGGG + Intergenic
1077105074 11:838628-838650 CTGTCGAGGGAGACGAGGGCTGG - Exonic
1078764063 11:14276590-14276612 CTAAAGAAGGGGAAGAGGGAGGG + Intergenic
1083143195 11:60738470-60738492 CTTTCGAAGCAGCAGAGAGTAGG - Intronic
1083232924 11:61334467-61334489 CTACGGATGGAGAAGAGTGTGGG - Intronic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1085565803 11:77512332-77512354 GGGTAGAAGGAGAAGAGGGTGGG - Intergenic
1086298169 11:85395333-85395355 ATATCGAGGCAGAAGAGGGGTGG + Intronic
1089774612 11:120827471-120827493 GTCTGGAAGGAGAGGAGGGTGGG + Intronic
1093215983 12:16361588-16361610 CTGTCGTTGGAGAAGAGGGGAGG + Intronic
1096262608 12:50102591-50102613 CCATGGAAGGAGAATATGGTTGG + Intergenic
1105351377 13:19619306-19619328 CTCTTGAGGGAGAAGAGGATTGG + Intergenic
1107163490 13:37259015-37259037 CTAAGGAAGGAGAACAGGATAGG + Intergenic
1107629863 13:42332447-42332469 GTATAGAAGGAGAAGAAGGAGGG + Intergenic
1109967196 13:69715790-69715812 ATATCGAATGAGAAAAGGTTTGG + Intronic
1110277893 13:73660528-73660550 CAAAAGAAGGAAAAGAGGGTAGG + Intergenic
1111777236 13:92679895-92679917 CTCTTGAAAGAGAAGGGGGTGGG - Intronic
1113405247 13:110032896-110032918 CTCTTTAAGGAGAAGCGGGTGGG - Intergenic
1114482683 14:23045361-23045383 CTATGGAAGGAAAAGAGAGGAGG - Intergenic
1117119860 14:52554763-52554785 CTATTAAAGGAGAAAAGAGTTGG - Intronic
1118435356 14:65766081-65766103 CCATGGAAGAGGAAGAGGGTGGG - Intergenic
1119897220 14:78230474-78230496 CTATGGAAGGAGAGAAGGCTGGG + Intergenic
1122398434 14:101451633-101451655 TTATAAAAGGGGAAGAGGGTCGG - Intergenic
1124201966 15:27686439-27686461 CCATCAAAGGAGAAGAGACTGGG + Intergenic
1128212056 15:65909680-65909702 ATATGGAAGAAGAATAGGGTGGG + Intronic
1128537192 15:68500366-68500388 CTCAGGAAGGAGAAGAGGTTTGG - Intergenic
1130717315 15:86347974-86347996 CTATTGAATGAGAAAAGGCTGGG + Intronic
1133854372 16:9535940-9535962 TTATTAAAAGAGAAGAGGGTGGG - Intergenic
1138245000 16:55460805-55460827 CTAACTAAGGAGAAGGGAGTCGG - Intronic
1140700946 16:77581077-77581099 CTGTCCAAGGAGAAGATGGCTGG + Intergenic
1143011768 17:3869899-3869921 CGAAGGAAGGAGAGGAGGGTGGG + Intronic
1149098383 17:52872252-52872274 CAATCGAAAGAGAAGAAGGGAGG - Intronic
1150958440 17:69888171-69888193 CTATCCCAGGAAAAGTGGGTAGG - Intergenic
1151201887 17:72474806-72474828 CTCTACAAGGAGGAGAGGGTTGG + Intergenic
1153083041 18:1250596-1250618 ATATTGAAGAAGAAGATGGTTGG - Intergenic
1153861890 18:9219600-9219622 CTGTTGAAGGAGAAGAGGAGAGG - Intronic
1155739668 18:29272527-29272549 CTATAGAGGAAGAAGAGGGAAGG - Intergenic
1156628946 18:38943912-38943934 CTGTGGAAGGAGACCAGGGTGGG + Intergenic
1157592687 18:48845074-48845096 CTATGGAAGAAGAAAAGGGGAGG - Intronic
1159416524 18:68156383-68156405 ATACCGTAGGCGAAGAGGGTTGG - Intergenic
1162247120 19:9410680-9410702 CTAACAGAGTAGAAGAGGGTGGG - Intergenic
1162548154 19:11343373-11343395 GTATCAGAGGAGAAGAGGCTCGG - Intronic
1162997756 19:14347143-14347165 CTTTTGAAGGCAAAGAGGGTAGG + Intergenic
1165007716 19:32820073-32820095 CTATCGAAGGAGAAGAGGGTGGG + Intronic
1165079516 19:33299417-33299439 CTAGGGAAAGAGGAGAGGGTTGG + Intergenic
926128786 2:10287309-10287331 CTCTAGAAGGGGAAGAGGGCAGG + Intergenic
927969900 2:27298937-27298959 CTCTCCCAGGAGGAGAGGGTAGG - Intronic
929906105 2:46048110-46048132 CTATGGAAGGGGCAGGGGGTGGG - Intronic
931471275 2:62539944-62539966 CTGTAGAATGAGAAGAGGGGAGG + Intergenic
933874512 2:86605396-86605418 ATATTGCAGGAGAAGAGGCTGGG - Exonic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935314461 2:101817677-101817699 CTTTCCATGGAGAAGAGGGCGGG + Intronic
937246346 2:120496569-120496591 CTACCTAAGGATAAGAGGGAAGG + Intergenic
942913734 2:181277543-181277565 TTCTCGAAGGAGAAGTGGGATGG + Intergenic
943839060 2:192554200-192554222 GAATGGAAGGAGAAGAGGGAGGG + Intergenic
945802560 2:214451283-214451305 CTAAGGAAGGATAAGTGGGTCGG + Intronic
948073192 2:235144090-235144112 CTCTGGAAGGGGATGAGGGTGGG - Intergenic
1168846221 20:946433-946455 CGATCGACGGGGAAGAGGTTTGG + Intergenic
1169325854 20:4675797-4675819 CTATAAAAGGAGGAGAGAGTGGG + Intergenic
1169547868 20:6669330-6669352 CTATGCAGAGAGAAGAGGGTAGG - Intergenic
1172496977 20:35394459-35394481 CTACCACAGGAGTAGAGGGTTGG + Intronic
1173279609 20:41617515-41617537 CTATCGGATGTGCAGAGGGTTGG - Intronic
1174002980 20:47388336-47388358 GTATGGAAGGGGCAGAGGGTGGG - Intergenic
1174830791 20:53810544-53810566 CTTGTGAAGGAGATGAGGGTGGG + Intergenic
1174904767 20:54538984-54539006 ATATCAAAGGAGAACAGGGCCGG + Intronic
1176926239 21:14752833-14752855 CTCTCCCAGGAGAAGATGGTTGG - Intergenic
1179124271 21:38577569-38577591 CTCTCGTGGGAGAAGAGGCTGGG + Intronic
1182173642 22:28259940-28259962 ATATCGCAGGAGCAGAGGGTTGG - Intronic
1182767014 22:32764983-32765005 CCCTGGAAGGACAAGAGGGTGGG - Intronic
951903926 3:27684992-27685014 CTATCAAAGCAGAAAAGAGTGGG + Intergenic
952535286 3:34303021-34303043 CTATGGGAGGATAGGAGGGTGGG - Intergenic
954058840 3:48052197-48052219 GTAGCTAAGGAGAACAGGGTGGG + Intronic
955086793 3:55710328-55710350 TTATCGCAGGAGAAGAGGTAGGG - Intronic
956536183 3:70279758-70279780 CCATGGAAGGAAAAGAGGGATGG - Intergenic
957272979 3:78055330-78055352 GTATTGGAGGAGGAGAGGGTGGG - Intergenic
962681078 3:137801064-137801086 CAATGGAAGAGGAAGAGGGTTGG + Intergenic
964427822 3:156571674-156571696 CTTTCCAAGGAGAATATGGTGGG - Intergenic
965199221 3:165634970-165634992 CTATCAATGGAGAAGAGAGTTGG + Intergenic
966464885 3:180219708-180219730 ATATTGAAGGAGAACAGAGTTGG + Intergenic
968999958 4:3972636-3972658 CTACCAAAGCACAAGAGGGTGGG - Intergenic
969101387 4:4771409-4771431 CTTTGAAAGGAGAAGAGTGTGGG + Intergenic
972492187 4:39598363-39598385 CTCTGGAGGGAGAAGTGGGTAGG - Intronic
972709330 4:41578725-41578747 CTATCAAAGGAGGGGAGGGGAGG - Intronic
979226913 4:118296626-118296648 CTATCTAAGAGGAGGAGGGTGGG + Intronic
983112731 4:163772916-163772938 ATATGGAAGGAGAAGGAGGTGGG + Intronic
983846014 4:172519401-172519423 ATATTGATGGTGAAGAGGGTTGG - Intronic
985173903 4:187180517-187180539 CTTTTGTAGGAGAATAGGGTAGG + Intergenic
985239324 4:187913326-187913348 CAATAGAAAGAGAAGAGTGTGGG - Intergenic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
990884882 5:60580033-60580055 CTTTGGGAGGAGAAGAGGGTAGG - Intergenic
993935168 5:93990561-93990583 CCATTGAAGGAGGAGAGGTTGGG + Intronic
994377836 5:99035169-99035191 CTATTGAAGGACAAGGGGATTGG - Intergenic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
998095001 5:139391946-139391968 CGACGGAAGGAGAGGAGGGTAGG + Exonic
998184414 5:139967675-139967697 CTATGAAAGGAGAACAGGGCCGG + Intronic
1000230881 5:159314085-159314107 CCATGGAAGGAGGAGATGGTGGG - Intergenic
1000450734 5:161383716-161383738 CTATGGTGGGGGAAGAGGGTTGG - Intronic
1000561622 5:162796376-162796398 CTATCTTAGGAGAAAAGAGTTGG + Intergenic
1005028832 6:21490732-21490754 CTATGGAGGAAGAATAGGGTGGG + Intergenic
1005322902 6:24672847-24672869 CTATCGAAGAAGAGGTGGGCAGG - Intronic
1009822306 6:68818715-68818737 CTATCTAAGGATAAGAAGCTTGG - Intronic
1009909576 6:69909190-69909212 CTTTCTAAGGAAAAGAGGGTAGG + Intronic
1015441920 6:133258580-133258602 CTATAGAAGGGGAGGAGGGCAGG - Intronic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1017773245 6:157659685-157659707 CTTTCCAAGGCGCAGAGGGTGGG - Intronic
1022802320 7:33788258-33788280 CTTCCGAAGGCAAAGAGGGTGGG - Intergenic
1025218929 7:57088046-57088068 CTTTCAAAGCAGAAGTGGGTAGG + Intergenic
1025629836 7:63261134-63261156 CTTTCAAAGCAGAAGTGGGTAGG + Intergenic
1025652441 7:63482893-63482915 CTTTCAAAGCAGAAGTGGGTAGG - Intergenic
1032667432 7:134050934-134050956 CAATCCAATGAGAAGAGTGTAGG + Intronic
1039776000 8:40737329-40737351 CGATTTAAGGAGAAGAGGGATGG + Intronic
1041529971 8:58854521-58854543 CAATGGAAGGAGAAGAAGGTGGG + Intronic
1043219694 8:77645022-77645044 CTATGGAAGGAGAAGGGGAAGGG - Intergenic
1047455994 8:125012157-125012179 CTATGGCAGGAGCATAGGGTGGG + Intronic
1049214479 8:141401542-141401564 CTACCAAAGGAGGGGAGGGTGGG - Intronic
1049644129 8:143728490-143728512 TTAGGGAAGGAGAAGGGGGTTGG + Exonic
1054892189 9:70262776-70262798 ATATGGAATGATAAGAGGGTGGG + Intronic
1055679207 9:78697279-78697301 CTAACTAAGCAGAAGAGAGTGGG + Intergenic
1187731892 X:22263958-22263980 CTATAGAAAAAGAAGAGGGTAGG + Intergenic
1190361970 X:49658035-49658057 CTATGGCAGGATTAGAGGGTTGG - Intergenic
1192164813 X:68821384-68821406 CAAGGGAAGGAGAGGAGGGTTGG + Intergenic
1196199715 X:112871832-112871854 CTATCTTAGGAGAAGAGAATGGG + Intergenic
1200142379 X:153908559-153908581 CTCTCGAAGGAGCAGAGCGAAGG - Intronic