ID: 1165007929

View in Genome Browser
Species Human (GRCh38)
Location 19:32821839-32821861
Sequence CCAGCTCCTCCTCTTTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 656
Summary {0: 1, 1: 0, 2: 2, 3: 105, 4: 548}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165007929_1165007933 7 Left 1165007929 19:32821839-32821861 CCTCAGCAAAGAGGAGGAGCTGG 0: 1
1: 0
2: 2
3: 105
4: 548
Right 1165007933 19:32821869-32821891 AGAGTTGGCTGACCTCGGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 124
1165007929_1165007932 2 Left 1165007929 19:32821839-32821861 CCTCAGCAAAGAGGAGGAGCTGG 0: 1
1: 0
2: 2
3: 105
4: 548
Right 1165007932 19:32821864-32821886 TTAATAGAGTTGGCTGACCTCGG 0: 1
1: 0
2: 0
3: 5
4: 105
1165007929_1165007935 19 Left 1165007929 19:32821839-32821861 CCTCAGCAAAGAGGAGGAGCTGG 0: 1
1: 0
2: 2
3: 105
4: 548
Right 1165007935 19:32821881-32821903 CCTCGGCCAGGCTAATTGCACGG 0: 1
1: 0
2: 1
3: 3
4: 140
1165007929_1165007931 -8 Left 1165007929 19:32821839-32821861 CCTCAGCAAAGAGGAGGAGCTGG 0: 1
1: 0
2: 2
3: 105
4: 548
Right 1165007931 19:32821854-32821876 GGAGCTGGCGTTAATAGAGTTGG 0: 1
1: 0
2: 1
3: 4
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165007929 Original CRISPR CCAGCTCCTCCTCTTTGCTG AGG (reversed) Intronic
900535417 1:3174674-3174696 GAAGCCCCACCTCTTTGCTGGGG + Intronic
900563840 1:3322777-3322799 CCAGCACCTCCTCAGTGCTCAGG + Intronic
900591474 1:3462153-3462175 GCAGCTCCCGCTCTCTGCTGGGG + Intronic
901058329 1:6459993-6460015 GTCGCTCCTCCTCTTTCCTGAGG - Exonic
901132032 1:6968066-6968088 GCAGCTCATTCCCTTTGCTGTGG + Intronic
901402641 1:9025197-9025219 CCACCTCCTCCTCTTTTCCGGGG - Intronic
902362432 1:15949548-15949570 CCTACTCCTCCTCTTCTCTGAGG + Intronic
902807204 1:18868533-18868555 CTGGCTTCTCCTCTTTCCTGGGG + Intronic
903028545 1:20446575-20446597 CCACGTCCTCCACTTTGCAGTGG + Intergenic
903259563 1:22124048-22124070 CCAGCTCCTCATCTCTGCCCAGG + Intronic
903380751 1:22895533-22895555 CCTGGTCTTCCTCATTGCTGTGG + Exonic
903892187 1:26577285-26577307 CCACCCCCTCATCTTTGCTCAGG - Intergenic
904535306 1:31195497-31195519 CCAGCTCCTCCTGTCTTCTCAGG + Intronic
904910733 1:33932345-33932367 CCAGCTCGGCCTCTTCTCTGGGG - Intronic
905278063 1:36831913-36831935 CCAGCCCCTCCTCTTACCTCCGG + Intronic
905500552 1:38433164-38433186 CCATCTCCTCTTCTTTTCTTGGG - Intergenic
906057712 1:42929631-42929653 CCAGCCCATCCTCATCGCTGTGG - Exonic
906084242 1:43117090-43117112 CCAGCTCCTCCTTTTACCTCTGG + Intergenic
906182821 1:43836606-43836628 CCAGCTGCTCTACTGTGCTGGGG - Intronic
906886711 1:49656419-49656441 CCAGCTCCTCCTTGTACCTGTGG - Intronic
907501344 1:54883780-54883802 CCAGCTCACCCTCTGTCCTGTGG - Intronic
909178604 1:72391451-72391473 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
909675110 1:78230708-78230730 CCAGCTCGTCCTCCTTGGTGTGG + Intergenic
910325640 1:86003674-86003696 CCAGCTCATCATCTTTTGTGTGG + Intronic
910780925 1:90932202-90932224 ACAGCTCCTGGTCTTTTCTGTGG - Intronic
911110806 1:94182874-94182896 CCACCTTCTCCTCTTTTATGAGG - Intronic
912002646 1:104854380-104854402 CCAACTCCTGCTCTTGGCTTTGG + Intergenic
912668105 1:111601183-111601205 CCACCTGCTTCTCTTTGGTGAGG + Intronic
912746040 1:112246230-112246252 CCAGCTCCTCCTCCCTGCTCAGG + Intergenic
913308245 1:117455522-117455544 CCAGATCCTACACTTGGCTGAGG + Intronic
913398955 1:118406680-118406702 CCAGCTCCTCTTTTTACCTGTGG - Intergenic
913721497 1:121600772-121600794 CCAGCTCCTCCTTGTAGCTCTGG + Intergenic
914831117 1:151171659-151171681 CCAGCTCCTTGTCATTGCTTCGG + Exonic
914999140 1:152572123-152572145 CCACCTCCTCCTCTCCCCTGCGG - Intronic
915602739 1:156932428-156932450 CCAGCCCCACCTCTGTGATGCGG - Exonic
916181099 1:162084499-162084521 CCTCCTCCACCTCCTTGCTGGGG - Intronic
916202667 1:162286941-162286963 CCAGCTGTTAGTCTTTGCTGAGG + Intronic
920227421 1:204448762-204448784 CCAGCTCCTCCTCTTCTCCCTGG + Intronic
920535468 1:206734007-206734029 GCTGCTCCTCATCTGTGCTGGGG - Exonic
920544412 1:206803513-206803535 CCAGCTTGTACTCTTTGTTGTGG - Intronic
920851968 1:209634252-209634274 GCTGCTTATCCTCTTTGCTGAGG - Intronic
921222338 1:212981942-212981964 CGAGCTCCTCCTCTGCACTGAGG + Intronic
921846647 1:219890248-219890270 CCAGCTCCTCCTTGTCCCTGTGG - Intronic
922715433 1:227868325-227868347 CCAGCTCCCCCTCATTGAAGGGG + Intergenic
922724929 1:227918295-227918317 CCAGGTCCTCCTCTTTCCCCAGG + Intergenic
923039304 1:230308506-230308528 CCAGCTGCCCCTCTTTGTGGAGG - Intergenic
923723167 1:236484394-236484416 CCAGCTCCTCTTCAATTCTGAGG - Intronic
924130066 1:240897860-240897882 CCAGCTCCTCTTTTTACCTGTGG + Intronic
924465541 1:244296130-244296152 GGAGCTCCTCTTCTGTGCTGGGG + Intergenic
924775985 1:247114709-247114731 CCAGCTCCTTCTCTACCCTGAGG - Intergenic
1063546637 10:6987778-6987800 CCAGCCTCACCTCCTTGCTGTGG - Intergenic
1063688336 10:8259633-8259655 CCTGCTTCTCTTCTGTGCTGGGG - Intergenic
1064249974 10:13699541-13699563 CAAGCTCCTCCTCTCTGCGCCGG - Intronic
1065222275 10:23508510-23508532 CCAGCTCCTCCTTGTACCTGTGG + Intergenic
1065407907 10:25389317-25389339 CCAGGGTCTCCTCTTTGCTGAGG + Intronic
1065412377 10:25443701-25443723 CCAGCCCCTCTTCTTTTCTTTGG + Intronic
1065621930 10:27590852-27590874 CCAGCTCCTCCTCTTACTTCTGG - Intergenic
1065963313 10:30751763-30751785 CGAGCGGCTCCTCTTTGCTGAGG + Intergenic
1067100895 10:43333732-43333754 TCAGCTTATCTTCTTTGCTGAGG - Intergenic
1067348898 10:45457911-45457933 CCTGCTCCTCCTCTTCCCTTGGG + Exonic
1067495014 10:46753853-46753875 CCAGTCCCTCCACTTTGATGCGG + Intergenic
1067599641 10:47586543-47586565 CCAGTCCCTCCACTTTGATGCGG - Intergenic
1067672288 10:48334047-48334069 GCCTCTGCTCCTCTTTGCTGGGG + Intronic
1069066480 10:63947224-63947246 CCAGCTCCTCCTTGTCCCTGTGG + Intergenic
1069355609 10:67581637-67581659 CCAGCTCCTCCTCATACCTCTGG + Intronic
1069360786 10:67639419-67639441 CCAGCTCCTCCTCATACCTCTGG - Intronic
1069720005 10:70543909-70543931 CCAGCCCCACCTCTCTGATGTGG - Intronic
1069807108 10:71132874-71132896 CCAGCTCCACCTGTCTGCTGGGG + Intergenic
1071207183 10:83295000-83295022 CCAGCTCCTCCTTGTACCTGTGG - Intergenic
1071441800 10:85705521-85705543 CCAGCTCCTCCTTGTACCTGTGG - Intronic
1071459640 10:85880185-85880207 CCAGCTCCTCCTTGTACCTGTGG - Intronic
1071651170 10:87394427-87394449 CCAGTCCCTCCACTTTGATGCGG - Intergenic
1072251449 10:93585423-93585445 CAAGCTCCTCTTTCTTGCTGGGG + Intronic
1072993195 10:100218056-100218078 ACAGGTCCTCCTCTCTGCTGAGG + Exonic
1073260685 10:102188235-102188257 CCAGGGCCTCCTCTCTGCTGAGG - Intergenic
1073492315 10:103861149-103861171 CCAGTTCCCCCAGTTTGCTGGGG + Intergenic
1074188365 10:111115697-111115719 CCGGCACCTCCTCATTGCTGTGG - Intergenic
1074241164 10:111640661-111640683 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1074470632 10:113723414-113723436 CCAGCTCCTGCTGTTTCTTGGGG + Intronic
1075238623 10:120756864-120756886 CCAACTGCTCCTCTCTGCTTTGG + Intergenic
1075334058 10:121596579-121596601 CCCGCTCCTACTCAGTGCTGGGG - Intronic
1075592845 10:123705008-123705030 AGGGCTCCTCCTCTTTCCTGGGG - Intergenic
1075651519 10:124130634-124130656 CCAGAGCCTCCTCTTTGCAGAGG + Intergenic
1075793313 10:125101448-125101470 CCAGCACCTCGCCTTGGCTGCGG + Intronic
1076426587 10:130371432-130371454 GCAGCTGCTCCTGTTTGCTAAGG + Intergenic
1076842565 10:133052977-133052999 CCATCTGCTCCCCTGTGCTGGGG - Intergenic
1077065927 11:640907-640929 CCAGCTTCCCCTCTCTGCAGGGG + Intergenic
1077233797 11:1470324-1470346 CCACTTCATCCTCTTTGCTCGGG - Exonic
1078390483 11:10931816-10931838 TCAAAGCCTCCTCTTTGCTGAGG - Intergenic
1078420876 11:11211591-11211613 TCAGCACTTCCTCTTGGCTGGGG - Intergenic
1078562093 11:12381079-12381101 CCAGCTCCAGCTGCTTGCTGCGG + Intronic
1078664158 11:13310596-13310618 ACAGCTACTCCACTCTGCTGTGG + Intronic
1079330679 11:19530167-19530189 CCCACACCGCCTCTTTGCTGGGG - Intronic
1080914497 11:36642420-36642442 CCAGCTCCTCCTCGTACCTCTGG - Intronic
1080956267 11:37099541-37099563 TAAGTTCCTCCTCTCTGCTGAGG + Intergenic
1081665536 11:44915109-44915131 CCAGCTCCAGCTCATTGCCGTGG + Intronic
1082155151 11:48801025-48801047 CCAGCTCCTCCTCATACCTCTGG + Intergenic
1082239587 11:49856153-49856175 CCACCCCCTCCTCTTTGCTCAGG + Intergenic
1082242567 11:49888198-49888220 CCACCCCCTCCTCTTTGCTCAGG - Intergenic
1082799779 11:57406122-57406144 CCAGCTCTTCCTTCTTCCTGTGG - Intronic
1082810795 11:57477678-57477700 TCAGCTCCTCCTCATGGCGGGGG - Intergenic
1083310249 11:61780255-61780277 CCAGGTCCTCCTCTGTGCGCAGG - Exonic
1083383618 11:62290239-62290261 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1083513413 11:63233212-63233234 CCAGCTCCTCCTTTTACCTCTGG + Intronic
1085023847 11:73225251-73225273 CCAGCTCCTCCTCCTGACTTTGG + Intronic
1085406686 11:76267357-76267379 CCAGCTCCTCTTCCTTGTGGTGG + Intergenic
1085864934 11:80279877-80279899 CCAGGTCCACATCTTTGTTGTGG - Intergenic
1086531992 11:87797404-87797426 CCAGCTCCTCCTTGTAGCTCTGG - Intergenic
1087044623 11:93834426-93834448 AGGGCTCATCCTCTTTGCTGTGG + Intronic
1087293920 11:96347498-96347520 CCAGCTCCTCCTTGTACCTGTGG + Intergenic
1087372386 11:97301523-97301545 CCAGCTCCTCCTTGTACCTGTGG - Intergenic
1088403646 11:109448170-109448192 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1089078687 11:115759457-115759479 CCAGCTTCTCCCCTTGGCTATGG - Intergenic
1089284549 11:117397109-117397131 CTGGCACCTCCTCTCTGCTGAGG + Exonic
1089358811 11:117873088-117873110 CCACCTCCTCCTGGATGCTGTGG - Intronic
1090201774 11:124862811-124862833 CCACCTTCTCTTCTTTACTGAGG - Intergenic
1090879876 11:130824161-130824183 GCAGCTCCTCCCCTTACCTGGGG + Intergenic
1090986529 11:131771687-131771709 TTAGCTCCTCCTCTCTCCTGTGG + Intronic
1091000427 11:131906408-131906430 TCAACTCCTCCTCCTTCCTGGGG + Intronic
1091069980 11:132553985-132554007 CCAGCTCCTCATCACTCCTGGGG - Intronic
1091319915 11:134642067-134642089 CCAGCTCCTCCTGTCAGTTGGGG + Intergenic
1091837044 12:3593362-3593384 CCAGCTCCTCCGCTCTGCCCTGG + Exonic
1092035769 12:5333189-5333211 CCAGCTGTTCCTCTTTGTGGGGG + Intergenic
1092638221 12:10475238-10475260 CCAGCTCCTCCTTTTACCTCTGG + Intergenic
1092853207 12:12649303-12649325 CCTGCTCCTGCTTTTTCCTGAGG - Intergenic
1093886456 12:24467061-24467083 CCAGCTCTTTATCTTTGCTGAGG - Intergenic
1094108741 12:26839146-26839168 CCAGCTCCCTCTGCTTGCTGTGG + Intergenic
1095875477 12:47075997-47076019 CCAGCTCCTTCTCTTTTCTCAGG - Exonic
1095952409 12:47789025-47789047 ACAGCTCCTACTCGTTGCAGGGG + Intronic
1095969843 12:47894169-47894191 TTAGCTCCTCCTCTGTCCTGGGG - Intronic
1096121947 12:49094150-49094172 CCAGCTCCTCCGTTTTCCTATGG - Intronic
1096744414 12:53716047-53716069 CCATCTCCTCCTTTCTCCTGAGG - Exonic
1096895249 12:54815150-54815172 CCAGCTCCTCCTCGTACCTCTGG + Intergenic
1097551520 12:61077559-61077581 CCAGCTCCTCCTTGTACCTGCGG - Intergenic
1098057633 12:66525093-66525115 CCAGCTCCTCCTTGTAGCTTTGG - Intronic
1099501016 12:83414705-83414727 CCAGCTTGTCCTTTTTGCTTAGG + Intergenic
1100370999 12:93968587-93968609 CAAGCTCCTCATCTTTACTTCGG + Intergenic
1100853622 12:98739106-98739128 CCAGCTCCACCACTTGGCTGTGG - Intronic
1101755349 12:107617085-107617107 GCAGCTCCTCCTGGATGCTGGGG + Exonic
1101950057 12:109167719-109167741 TGAGCTCCTGCTCTGTGCTGGGG + Intronic
1102408380 12:112694298-112694320 GCTGCTCCACCTCTTAGCTGAGG + Intronic
1102930620 12:116859393-116859415 CCAGCTCCCCCCATTTTCTGGGG - Exonic
1103432035 12:120896249-120896271 ACAGCTCCACCTCATTGTTGTGG - Intronic
1104003426 12:124875166-124875188 ACAGCTGCTCCTCATTGCTCAGG - Intronic
1104025814 12:125025325-125025347 CCAGCTTCTCCTCCACGCTGGGG - Exonic
1104370360 12:128218823-128218845 CCAGCTCCTCTTCTGGGGTGTGG - Intergenic
1106154837 13:27144761-27144783 CCAGCTCCTCCCGATTTCTGGGG - Intronic
1106617569 13:31343976-31343998 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1106640652 13:31581243-31581265 CCAGCTCCTCCTTGTACCTGTGG + Intergenic
1106780783 13:33057082-33057104 CTTCCTCCTCCTCTTTACTGGGG + Intronic
1109378442 13:61526209-61526231 CCACCTCTTTCTCTTTTCTGTGG - Intergenic
1110728917 13:78857488-78857510 CCAGCTCCTCCTCGTACCTCTGG + Intergenic
1112437289 13:99399492-99399514 TCAGCCCCTCTTCTTTGATGAGG + Intergenic
1112464235 13:99629544-99629566 GCAGCTCCTTCTCTGTACTGTGG + Intronic
1113512850 13:110869762-110869784 CCCGAACCTCCTCTTGGCTGAGG + Intergenic
1113801210 13:113087306-113087328 CCAGCTCCTTCACCTTGGTGTGG - Exonic
1116013606 14:39380194-39380216 CCAGCTCCTCTTTTTTCCTCAGG - Intronic
1116036708 14:39636108-39636130 CCAGCTCCTCCTTGTAGCTCTGG + Intergenic
1116563554 14:46415550-46415572 CCTTCTCCTCCTCCTTTCTGAGG - Intergenic
1116719982 14:48483896-48483918 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1117883997 14:60340570-60340592 CCAGCTCCTCCTCATACCTCTGG - Intergenic
1118310129 14:64685966-64685988 CCAGCCCCTACTGTCTGCTGTGG + Intergenic
1118312143 14:64702018-64702040 CCATCTCCTCATCTCAGCTGGGG + Intergenic
1118590307 14:67395949-67395971 CCAGCTCTGCCACTTGGCTGTGG + Intronic
1119147734 14:72332124-72332146 CCAGAGCTTCCTCTTGGCTGGGG + Intronic
1119348667 14:73946488-73946510 CTATCTCCTCCTCTGGGCTGAGG + Exonic
1120089596 14:80315864-80315886 CCAGCTGCTCCTCATTGCTTGGG + Intronic
1120098893 14:80421625-80421647 CCATATCCTCCTCTTTTATGGGG + Intergenic
1120780094 14:88479285-88479307 CCTCCTCCTCCTCGCTGCTGTGG + Exonic
1120956561 14:90088498-90088520 CCAGCTCCACCTCACTGCTGTGG + Intronic
1121787818 14:96675684-96675706 CCAGCCATTCCTCTTGGCTGTGG - Intergenic
1121865053 14:97355133-97355155 CCTTCTCCTCCTTTTTCCTGGGG + Intergenic
1122711801 14:103663831-103663853 CCACGTCCTCCTCCTTGCTCAGG - Intronic
1122826376 14:104372785-104372807 CCTCCTCCTCCTGTTTCCTGGGG + Intergenic
1123004211 14:105313901-105313923 CCATTGCCTCCTCTTTGCTTGGG + Exonic
1123014034 14:105365103-105365125 GCAGCTCCAGCCCTTTGCTGAGG + Intronic
1123127487 14:105958697-105958719 CCAGCTCCTCCTTGTAGCTCTGG + Intergenic
1123804937 15:23860976-23860998 CCACCACCTTCTCTTCGCTGGGG + Intergenic
1124220682 15:27847511-27847533 CCAGGGCCTCCTCTCTGCTTTGG - Intronic
1124668964 15:31620345-31620367 CCAGCTCCTCCTTTTACCTCTGG + Intronic
1124669930 15:31629671-31629693 CCAGCTCCTCCTTTTACCTCTGG + Intronic
1125752933 15:42042754-42042776 CCAGATCCTTCTCTTTGCCTTGG + Intronic
1126329873 15:47520800-47520822 CCCTCCCTTCCTCTTTGCTGGGG - Intronic
1126906539 15:53373968-53373990 CCAGCTCATCAACTTTGCTTTGG + Intergenic
1127731081 15:61802386-61802408 TCAGCACCTCATCTTTGCTCAGG - Intergenic
1128114014 15:65094313-65094335 CCATCTCCTCCTCAGAGCTGAGG + Intronic
1128159106 15:65411368-65411390 CGTGCTCCTCCTCTATGCAGGGG - Exonic
1128339272 15:66809001-66809023 CCCGCTCCTCATCTTTGCAGTGG + Intergenic
1128788671 15:70416657-70416679 ACAGCTAGTCCTCTTTGCTGTGG + Intergenic
1130024999 15:80263241-80263263 CCAGCTCTTCCTTTTTTTTGGGG + Intergenic
1134532573 16:14995719-14995741 CCAGCTCCTCCTTTTACCTCTGG + Intronic
1135421618 16:22308969-22308991 CAATCTGCTCCCCTTTGCTGCGG - Exonic
1135427275 16:22349376-22349398 TCAGCTCCTCCACTTGGCTCTGG + Exonic
1135565252 16:23506888-23506910 CCAGGTCCCCCTTTTTGCTCTGG + Intronic
1136383074 16:29905964-29905986 CCAGGACCTCCTCTCTACTGCGG + Exonic
1136855413 16:33652262-33652284 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1137637068 16:49996004-49996026 CCAGTTCCTCCTGTCTGCTTTGG - Intergenic
1139529866 16:67537772-67537794 CCGCCCCCTCCTCTTTCCTGAGG - Intronic
1139582217 16:67880399-67880421 CCACCTCCTCTTCTTGGCTGTGG + Intronic
1139625796 16:68187645-68187667 CCAGGGTCTCCTCTCTGCTGAGG - Intronic
1139863457 16:70044992-70045014 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1139914244 16:70418460-70418482 CCAGCTCCGCCTCCTTACAGAGG - Intronic
1140219201 16:73031677-73031699 CCAGCTCGTTCTGTTTGCTGTGG - Intronic
1141161938 16:81635059-81635081 CCTGCTCTTCCTCTGTGGTGTGG - Intronic
1141421679 16:83921732-83921754 CCAGCTCCTCGCTTTTCCTGAGG + Exonic
1141468964 16:84225704-84225726 CCAGGTCCTCCTCCTGCCTGTGG + Intronic
1141746951 16:85932204-85932226 CCAGCGTCTCCTCTTGGCAGGGG - Intergenic
1141999104 16:87653931-87653953 CCAGCTGCCCATCTTTGGTGCGG + Intronic
1203116999 16_KI270728v1_random:1500743-1500765 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1142577216 17:917506-917528 CCAGCTCCTCCTCTTCCTTCTGG + Intronic
1142643918 17:1300121-1300143 ACAGATGCTCCTGTTTGCTGGGG + Exonic
1142676970 17:1519685-1519707 CCTGCTCCTCCTCTTCCCTTTGG - Exonic
1142930237 17:3278302-3278324 TGAGCTGCTGCTCTTTGCTGTGG - Exonic
1143659285 17:8314900-8314922 CTAGCCCCTCCTCTTCCCTGTGG - Exonic
1143982654 17:10883468-10883490 CCATGACCTCCTCTTTTCTGGGG - Intergenic
1145058130 17:19716415-19716437 CCAGCTCCTCCTCCTTACCAGGG + Exonic
1145234590 17:21199766-21199788 CCAGCTCCTCCCCGCTGCGGAGG + Intronic
1145868432 17:28255489-28255511 ACCGCTACTCCTCTCTGCTGGGG + Intergenic
1147310214 17:39591595-39591617 CCAGGGCCTGCCCTTTGCTGGGG + Intergenic
1147553856 17:41463990-41464012 CCTCCTCTTCCTCTTTCCTGGGG + Intronic
1148180225 17:45600238-45600260 GCAGCTCCTCCTCCCCGCTGAGG + Intergenic
1148268673 17:46245657-46245679 GCAGCTCCTCCTCCCCGCTGAGG - Intergenic
1148431796 17:47649421-47649443 CCAGCTCCGCCTCTTCCCGGGGG + Intergenic
1149891183 17:60391888-60391910 TCAGCGCCTCCTCGTAGCTGAGG + Exonic
1149964237 17:61146012-61146034 GCAGCTCTTCTGCTTTGCTGGGG + Intronic
1150409990 17:64934923-64934945 CCAGATTCTCCTCTTTGCCTAGG + Intergenic
1150529188 17:65959057-65959079 CCAGGGCCTACTCTCTGCTGAGG + Intronic
1151152316 17:72098675-72098697 CCAGCCTCTCCCCTTTGCCGTGG - Intergenic
1152191717 17:78892167-78892189 CCAGCTCCAGCGCTTGGCTGAGG - Exonic
1153401055 18:4684075-4684097 CCAGCTCCTCCTGTTACCTCTGG - Intergenic
1153820331 18:8826267-8826289 CCAGCTCTTCCCTTTAGCTGTGG + Intronic
1153822491 18:8844225-8844247 GTAGCTCCTCGTCTTTGCAGGGG - Intergenic
1154076235 18:11204727-11204749 CCAGCTGCTCCTCTGCTCTGAGG + Intergenic
1155679882 18:28475836-28475858 GCAGTTCCTGCTTTTTGCTGTGG - Intergenic
1156637511 18:39049184-39049206 CCAACTTCCCCTCTCTGCTGGGG - Intergenic
1157240746 18:46007507-46007529 CCAGCTTCTCCTCCTGGCAGAGG - Intronic
1157401271 18:47390517-47390539 CCACCTCCTTCTCCCTGCTGTGG - Intergenic
1157549882 18:48574114-48574136 CCAGCTCCTCCTTCCTGCCGGGG + Intronic
1157810617 18:50692892-50692914 GCAGCTCCTCCGTTTTGCAGGGG + Intronic
1158754286 18:60303474-60303496 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1160833640 19:1114456-1114478 CCTGCTCCTCCACCTTGCTGCGG - Intronic
1160932789 19:1578522-1578544 CCAGCTCTTCCTGCTTCCTGGGG + Exonic
1160985387 19:1836185-1836207 CCAGGTTCTCCCCATTGCTGGGG - Intronic
1161395328 19:4042437-4042459 CCAGCTCCTCCTCTGTGGATTGG - Intergenic
1161958000 19:7506857-7506879 CCAGCTCCTCCCCCTTCCTCTGG + Intronic
1162019733 19:7862968-7862990 CCATCACCTCCTCCTTGCTCTGG - Exonic
1162461236 19:10815608-10815630 CCAGCTCCTCCTCTGTGCACTGG - Intronic
1163431006 19:17267590-17267612 CCAGCTCCTCGCCTTTCCTGGGG + Intronic
1163761929 19:19142046-19142068 CCATTTCATCCTCTGTGCTGTGG - Intergenic
1164358221 19:27467132-27467154 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1164377166 19:27698016-27698038 CCAGCTCCTCCTTTTTCCTCTGG + Intergenic
1164726319 19:30468252-30468274 CCAAGTCCTCCTCTTTGCCCTGG - Intronic
1165007929 19:32821839-32821861 CCAGCTCCTCCTCTTTGCTGAGG - Intronic
1165469218 19:35993939-35993961 CCAGCTTCTCCTCTCTGAAGGGG + Intergenic
1165867175 19:38946003-38946025 CCAGCTCCTCCTTCAGGCTGTGG - Intronic
1166022043 19:40040488-40040510 CCAGCTCCTCCTTTTACCTCTGG + Intronic
1166055093 19:40283823-40283845 CCAGCTGTTCCTCTTTGCATAGG - Intronic
1166083346 19:40458639-40458661 CCATCCCCTCCTCTGTTCTGGGG + Intronic
1166355437 19:42224745-42224767 CCAGCTCATCCTCTCCCCTGGGG + Exonic
1166898178 19:46036974-46036996 CTAGGGCCTCCTCTTTGCTGAGG + Intergenic
1167171650 19:47836283-47836305 CCAGCTCCTCCAGTTGGCTCCGG - Exonic
1167213477 19:48148611-48148633 CCAGCATATCCTCTATGCTGGGG + Intronic
1168627468 19:57930659-57930681 CTAGTTTCTCCTCTGTGCTGAGG - Intronic
925051228 2:817125-817147 TCAGCTCCTCCTTTATGGTGTGG + Intergenic
925162292 2:1694452-1694474 CCAGCGCCGCCCCTGTGCTGTGG + Intronic
925164598 2:1708339-1708361 CCAGCAGCTCCTCTTTGGTCTGG + Intronic
925406177 2:3606586-3606608 CCAGCCCCTGCTCCTTGCTCTGG + Intronic
926424384 2:12727925-12727947 CCGCCTCCCCCTCTCTGCTGTGG + Intronic
926859235 2:17291561-17291583 CCAGGGCCTCCTCTCTGCTGAGG - Intergenic
928683536 2:33726699-33726721 CCATCTTCTCCTATTTCCTGGGG - Intergenic
930290187 2:49483887-49483909 CCAGCTCCTCCTTGTACCTGTGG - Intergenic
930703261 2:54480826-54480848 CCAGCTCTTCTTCCTTGCAGGGG + Intronic
930885429 2:56320703-56320725 CCAGCTCCTCCTCGTACCTCTGG - Intronic
931657027 2:64518614-64518636 CCAGCCCTTCCTCTCTGCGGGGG - Intergenic
932705258 2:74019771-74019793 CCAGGACCTCCTTTTTCCTGCGG - Intronic
933212439 2:79586189-79586211 CCGGCTTCTCCTCTTCTCTGTGG + Intronic
934997762 2:98981417-98981439 CCAGCTCCTCCTTGTACCTGTGG - Intergenic
935406454 2:102715161-102715183 CCAGTTAATCCTCCTTGCTGCGG + Intergenic
935937824 2:108205714-108205736 CCAGCTCCTCCTTGTGGCTCTGG + Intergenic
937576102 2:123424134-123424156 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
938369858 2:130762267-130762289 CCAGCTGCGCCCCTTTGTTGGGG - Exonic
940593683 2:155763699-155763721 CCAGCTCCTCCTTGTACCTGTGG + Intergenic
941035944 2:160569493-160569515 CCTGCTGCTGCTCCTTGCTGTGG + Intergenic
941236853 2:162985832-162985854 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
941910966 2:170764126-170764148 CAAGCTCCGCCTCCTTGCAGTGG - Intergenic
942083746 2:172426148-172426170 ACAGCTCCTGCTCTTTCCTGGGG + Intergenic
943140790 2:183978980-183979002 CCAGCTCCTCCTCGTACCTCTGG - Intergenic
943859088 2:192836523-192836545 CCAGTTCCTCCTCGTAGCTCTGG + Intergenic
943919863 2:193692058-193692080 CCAGTTCTTACTCATTGCTGTGG - Intergenic
946133886 2:217629511-217629533 CCAGCTCCTGCTCTGTGGGGTGG - Intronic
946789326 2:223284814-223284836 CCAGGGCCTCCTCTCTGCTAAGG - Intergenic
946941016 2:224770282-224770304 CCAGCTGGTCCTCTTTGATGAGG + Exonic
947461398 2:230307146-230307168 GGACCTCCTCCTCTTTGCTGAGG + Intronic
947837089 2:233183587-233183609 CCATCTCCTCCTCTATTCCGGGG + Intronic
947884645 2:233557658-233557680 TCAGCTCCTCCTGCTTCCTGGGG - Intronic
948269584 2:236663992-236664014 ACAGCTCATGCTCTTTACTGAGG + Intergenic
948887511 2:240891563-240891585 CCAGGTCCACCCCTTGGCTGAGG + Exonic
948891813 2:240910520-240910542 CCAGCTGTCCCTCTTTGCTGAGG + Intergenic
948903063 2:240965839-240965861 CCAGCTCCTGCTCCAGGCTGTGG - Intronic
948974678 2:241457059-241457081 CCAGTACCTCCTCTCTGCTCAGG - Intronic
948982902 2:241503896-241503918 CCAGCTCCTCCGCTGGGCTTAGG - Intronic
948997157 2:241587365-241587387 CCAGCACCTCCTCTCTCCTCAGG + Intronic
1169472745 20:5902183-5902205 CAAGCTCCTGCCCTCTGCTGTGG - Intergenic
1170832538 20:19855459-19855481 CCAGCTCCTCCTCATACCTCTGG + Intergenic
1171331376 20:24341768-24341790 TCAGCACCTCTTCTTTGTTGTGG - Intergenic
1171391569 20:24804753-24804775 CCAGCTCCTCCTGCTTGCTGGGG - Intergenic
1172621778 20:36322169-36322191 TCTTCTGCTCCTCTTTGCTGGGG - Intronic
1172781337 20:37438518-37438540 CCCGCTCCTCCTCCCTGCTCTGG - Intergenic
1173404601 20:42753679-42753701 CCAGCCCCTCCTCTTGACTTGGG + Intronic
1174061934 20:47839158-47839180 CTGGCTCCTCCTCTTTCCTCAGG - Intergenic
1174069574 20:47890073-47890095 CTGGCTCCTCCTCTTTCCTCAGG + Intergenic
1174451327 20:50622521-50622543 CCAACTCCTCCTCTTCCCAGGGG + Intronic
1175174542 20:57103048-57103070 CCAGCTCCTCCTTTGTCCTTGGG + Intergenic
1176423530 21:6533913-6533935 CCAGCTCCCACTCATAGCTGGGG - Intergenic
1176684852 21:9838552-9838574 CCCTCTCTTCCTCTTTGCAGGGG - Intergenic
1178417057 21:32412660-32412682 CCGCCCCCTCCCCTTTGCTGGGG + Exonic
1178707364 21:34886947-34886969 CCAGCACCTCCACCATGCTGCGG + Exonic
1179038050 21:37776926-37776948 CCAGCTCCTCCTCGTACCTCTGG + Intronic
1179039669 21:37791184-37791206 CCAGCTCCTTCTCTCTCCTCTGG + Intronic
1179217700 21:39381292-39381314 ACAGCTCCTCATTTCTGCTGTGG - Intronic
1179502986 21:41821511-41821533 CCCCCTCCTCCTCCCTGCTGAGG - Intronic
1179699024 21:43142229-43142251 CCAGCTCCCACTCATAGCTGGGG - Intergenic
1181695163 22:24589299-24589321 CAAGGCCCTCCTCCTTGCTGGGG - Intronic
1182462545 22:30492616-30492638 CCAGCACCTGCTCTTGGCTGTGG - Intronic
1183195572 22:36351422-36351444 GCCGCCCCTCGTCTTTGCTGCGG + Intronic
1183455169 22:37918668-37918690 CCTCCTCCTCCCCTTTGCGGGGG - Intronic
1183463780 22:37968745-37968767 CCAGCTCCTCCTCTTTGAAGGGG - Exonic
1183619599 22:38964810-38964832 CCAGCTCCTTCTTGTTCCTGGGG + Intronic
1184150687 22:42636646-42636668 CCAGCACCTACTCTGTGCTCAGG - Intronic
1184231988 22:43163275-43163297 CCAGCTCCCCCTCTTCCCTGTGG - Intergenic
1184256487 22:43289966-43289988 CCAGCGCCTCCTCCTTGTTAAGG + Intronic
1184371767 22:44086947-44086969 CCAGCTCCTCTTCCCAGCTGGGG - Intronic
1184537822 22:45099619-45099641 GCTGCTCCTTCTCTGTGCTGGGG + Intergenic
1184567400 22:45300319-45300341 ACAGCTCCTCCTCTTTGGATGGG + Intergenic
1184935998 22:47721396-47721418 CCTCCTCCTCCTCCTTCCTGTGG + Intergenic
950033422 3:9866982-9867004 CCAGCTCCTCCTCCTCACTCAGG + Exonic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950421748 3:12903608-12903630 CCAGGTCTTCCTCTTGGCTCTGG + Intronic
950442340 3:13017560-13017582 TCAGGTCCTCCTCTGTGCTGTGG + Intronic
950495562 3:13332130-13332152 CCTGCTCCTTCTCTTCTCTGTGG - Intronic
951609466 3:24476038-24476060 CCAGCTGCTGCTCTTTGGTGGGG + Intronic
952104502 3:30053673-30053695 CCAGCTCCTCCTTGTACCTGTGG - Intergenic
953065986 3:39471642-39471664 CCAGCTCCTCCTCTGGCATGAGG + Intronic
953139444 3:40213880-40213902 CCAGCTCCTTTGCTTTGCTTCGG + Intronic
953145941 3:40274908-40274930 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
954147546 3:48641771-48641793 CCAGCTCCCCATCTTTCCTGCGG - Intronic
954456804 3:50604026-50604048 CCAGCTCCTGCTCATTGCCTGGG + Intergenic
954629766 3:52041439-52041461 CCAGAGCCTCCTCTGAGCTGGGG - Intergenic
954679147 3:52332185-52332207 CCAGCTTCTCTTCTGCGCTGAGG + Exonic
954680732 3:52344613-52344635 CCTGCTCCTCCTCCTTCTTGGGG - Exonic
954961517 3:54569496-54569518 CCAGCTCCTTCCCTTGGCTAGGG - Intronic
955105714 3:55895883-55895905 CAAGCACCTTCTCTTTGCTATGG + Intronic
955319933 3:57967081-57967103 CCAGCTCCTTCTCATTGTTTAGG + Intergenic
955631567 3:60980971-60980993 CCTGCTCTTCCTCTCTGCTGAGG + Intronic
955808154 3:62758216-62758238 CCAGCCTTTCTTCTTTGCTGAGG + Intronic
956038742 3:65123614-65123636 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
957942298 3:87020631-87020653 CCAGCTCCTCCTTGTTCCTCTGG - Intergenic
957966146 3:87324109-87324131 CCAGCTCCTCATATTTGATCTGG - Intergenic
957972794 3:87404723-87404745 CCAGCTCCTCCTCGTACCTCTGG - Intergenic
958632385 3:96700488-96700510 CCACCTCTTTCTCTTTCCTGCGG + Intergenic
958853905 3:99361476-99361498 CCAGCTCCTCCTTTTACCTTTGG + Intergenic
960278511 3:115754456-115754478 CCAGCTCCTCCTTTTGCCTCTGG - Intergenic
960278928 3:115759142-115759164 CCATCTCCTTCACTTGGCTGAGG + Intergenic
961513489 3:127418894-127418916 CCAGCTCCTCTTCTGGCCTGGGG + Intergenic
961543949 3:127619074-127619096 CCTCCTCCTCCTTGTTGCTGGGG - Exonic
961616753 3:128188708-128188730 CCAGCAGCCCCTCTTTGCCGGGG + Intronic
961657161 3:128449551-128449573 CCACCTGCTCCTTTTTGGTGGGG - Intergenic
962374773 3:134850703-134850725 CCAGCCGCTCCTCCTTGCTCAGG - Intronic
962411322 3:135143866-135143888 ACAGCTCCTCCTCCCTGCTGGGG - Intronic
962534631 3:136316759-136316781 GCAGCACCTCCTCCCTGCTGGGG - Intronic
962836433 3:139193221-139193243 CCAGCTCCTCCTTTTACCTCTGG + Intronic
963785050 3:149526019-149526041 CCATCTCATCCACATTGCTGAGG + Exonic
965487750 3:169299292-169299314 CCAGCCCCTCCTCTTGGCCTCGG - Intronic
965607584 3:170512250-170512272 CCTGCTCCTCATCTGGGCTGGGG - Intronic
966073417 3:175906576-175906598 CCAGCTCCTCTTTTTACCTGTGG - Intergenic
966734691 3:183179475-183179497 CGCGCTCCTCCTCGGTGCTGCGG + Exonic
967408053 3:189139137-189139159 CCAGGTCCTCCTCCTTTGTGAGG - Intronic
967865540 3:194187072-194187094 CCAGCTCCGCCTGTGTGCAGGGG - Intergenic
967972934 3:195012511-195012533 CCAGGTCATTCTCTGTGCTGTGG - Intergenic
968588680 4:1446825-1446847 CCAGCACCTGCTCTGTGCTGGGG - Intergenic
968661320 4:1799946-1799968 CCAGCCCCTCCTGTATCCTGAGG - Intronic
969301372 4:6299278-6299300 CCCTCTGCTCCTCTTGGCTGTGG + Intronic
969302054 4:6302924-6302946 GCAGCTCTTCCCCTTTCCTGGGG + Exonic
969352678 4:6606713-6606735 ACAGCTCCTCCTTTCTGCTCAGG - Intronic
969446493 4:7247753-7247775 CCAGCTCCTCATCTTTGAACTGG + Intronic
971080294 4:23202467-23202489 CCAACTCCTCCTCTTTTCCTGGG + Intergenic
972285604 4:37644940-37644962 CCAGCTCCGCCACTTTCCAGCGG + Intronic
972854016 4:43083825-43083847 CCAGCTGATCCTTTTTGCTTAGG + Intergenic
972890502 4:43551484-43551506 CCAGAGCCTCCTCCCTGCTGTGG + Intergenic
973132479 4:46664732-46664754 CCAGCTCCTCCTTGTAGCTCTGG + Intergenic
973347379 4:49071397-49071419 CCAGCTCCTCCTTGTTCCTGTGG - Intergenic
973713156 4:53649548-53649570 ACAGCTCCTCCTCTTGCCTCTGG + Intronic
974061050 4:57036290-57036312 CCACCTCCTCCTCCTGCCTGAGG - Intronic
974111811 4:57534432-57534454 CCAGCTCCTCCTTTTACCTCCGG + Intergenic
974427252 4:61757198-61757220 CCAGCTCCTCCTTGTTCCTCTGG + Intronic
974706112 4:65518878-65518900 CCAGCTCCTCCTCGTACCTCTGG - Intronic
974769454 4:66392223-66392245 CTAGCTCCTTCTTTTTACTGTGG - Intergenic
974770136 4:66401728-66401750 CCAGCTCCTCCTTTTACCTCTGG + Intergenic
974829808 4:67176112-67176134 CCAGCTCCTCCTCATACCTCTGG + Intergenic
975462845 4:74674865-74674887 ACAGCTCCTCCTCTTTCCTCTGG - Intergenic
976269639 4:83218058-83218080 CCACTTCCTCCTCTGTGCAGTGG + Intergenic
977616851 4:99096513-99096535 CCAGCTCCTCCTTGTACCTGTGG + Intergenic
978022298 4:103829022-103829044 CCAGCTCCTCCTTTTACCTCTGG + Intergenic
979290578 4:118975560-118975582 GCACCTCCTCCTCCTTCCTGGGG - Intronic
979648809 4:123106688-123106710 CCAAGTCCCCTTCTTTGCTGAGG - Intronic
980162642 4:129184173-129184195 CCAGCTCCTCCTTGTAGCTCTGG + Intergenic
981387668 4:144150492-144150514 CCAGCTCCTCCTCGTATCTCTGG + Intergenic
981725292 4:147841076-147841098 CCAACTACTCATCTCTGCTGTGG - Intronic
982223213 4:153142176-153142198 CCACCTCCTCTTCATTTCTGTGG - Intergenic
982330181 4:154172591-154172613 CCAGCTCCTCCTTTTACCTCTGG + Intergenic
984144066 4:176039727-176039749 CCAGCTTCTTCTTTTTGCTTAGG + Intergenic
984667108 4:182440755-182440777 CCAGCTGCTCCTCACTTCTGCGG + Intronic
984854305 4:184180422-184180444 CCAGCTCCTCCTTGTTCCTCTGG - Intronic
985091024 4:186362760-186362782 CCAGCTGTTCCTGTTTGGTGAGG - Intergenic
985669579 5:1200597-1200619 CCTGCACGGCCTCTTTGCTGGGG + Intergenic
985729293 5:1538324-1538346 CCACCTACTTCTCCTTGCTGTGG + Intergenic
985913240 5:2898838-2898860 CCAGCACCTACTCATGGCTGGGG - Intergenic
986016514 5:3761999-3762021 GCACCACCTCCTCTTTTCTGGGG + Intergenic
986216556 5:5724843-5724865 ACAGCTCCTTCTGTTGGCTGCGG - Intergenic
987369278 5:17178661-17178683 CCAGCTCCTCCTCTCAGCTCAGG - Intronic
987858056 5:23447274-23447296 CTAGCTTCTTCTCTTCGCTGTGG - Intergenic
988227257 5:28428100-28428122 CCACCTCCGTCTCTTTACTGTGG - Intergenic
988586015 5:32508163-32508185 CCACCTCCGACTCTTTGTTGTGG + Intergenic
989108891 5:37888496-37888518 TCAGCTCATGCTCTATGCTGAGG + Intergenic
989971643 5:50532397-50532419 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
990140037 5:52692754-52692776 CCAACTCATCCTCTTGCCTGAGG + Intergenic
990365529 5:55066594-55066616 CCCGCTCCTCCACTTTGCACAGG + Intergenic
990888211 5:60618701-60618723 CCAGCTCCTCCTTGTACCTGTGG - Intronic
990923432 5:60993600-60993622 CCAGGGCCTCCTATCTGCTGAGG - Intronic
991477682 5:67040687-67040709 CCAGCTCCATCTCTTAGCTGTGG + Intronic
992693099 5:79259252-79259274 CCAGGGTCTCCTCTCTGCTGAGG - Intronic
993364372 5:87018770-87018792 CCAGCCCCACCTCTATCCTGGGG + Intergenic
994161201 5:96558770-96558792 CTAGCTCCTCCTCATAGCTCTGG - Intronic
995467230 5:112463318-112463340 CCAGCTCCTCCTTTTACCTCTGG + Intergenic
995628321 5:114104003-114104025 CCAGCTCCTCTTTTTAGCTCTGG + Intergenic
996158206 5:120129448-120129470 CCAGCTCCTCCTTTTACCTCTGG + Intergenic
996625867 5:125569757-125569779 CCAGCTCCTCCTCGTACCTCTGG - Intergenic
998278789 5:140784332-140784354 CCACCTCCCCCTCTCTGCTGGGG - Intergenic
998525343 5:142837779-142837801 CCAGCTCATTCTCTTTTCTTAGG + Intronic
998778360 5:145628692-145628714 CCAGCTCCTCCTCTTCTTTCAGG + Intronic
999596994 5:153215432-153215454 AGAGCTGCTGCTCTTTGCTGGGG - Intergenic
999814264 5:155160174-155160196 CCAGCTCCTCCTTTTACCTCTGG + Intergenic
1001273903 5:170336456-170336478 CCTGCCCTTCCTCTTCGCTGTGG - Intergenic
1001425272 5:171618513-171618535 CCTCCTCCTCCCCTTTCCTGGGG + Intergenic
1001848427 5:174941760-174941782 CCATCACCTCCCCTTTACTGAGG - Intergenic
1002051203 5:176572598-176572620 CCCACTCCTCCCCCTTGCTGCGG - Intronic
1002842402 6:917613-917635 CCATCTCCTCCTCTTGACAGGGG - Intergenic
1003590316 6:7431816-7431838 CCAGCTCCTCCCCCTGGCTTAGG - Intergenic
1004099587 6:12595170-12595192 CCAGCTCTTCATCTTGCCTGTGG + Intergenic
1004354411 6:14918783-14918805 CCTGCCCCGCCTCTTTCCTGGGG - Intergenic
1004412045 6:15390125-15390147 CAAGTTCCTCCTCCTTACTGTGG - Intronic
1005083493 6:21980793-21980815 CCACCTCCTCCTCCCTGCTCTGG + Intergenic
1005083654 6:21981695-21981717 CCACCTCCTCCTTTCTGCTTTGG + Intergenic
1006348004 6:33498516-33498538 CTAGGGCCTCCTCTCTGCTGAGG + Intergenic
1006427892 6:33977600-33977622 CCAACTCCTGCTCGTTGGTGGGG - Intergenic
1006531485 6:34658836-34658858 TCAGCTCCAACTCTTGGCTGTGG + Intronic
1006915616 6:37591985-37592007 CCAGCTCCTCCTGCCTGGTGGGG + Intergenic
1007161003 6:39792020-39792042 CCGGCTCCTCCTCTGGGCTACGG - Intergenic
1007448988 6:41928913-41928935 CAAACTGCTCCTCTTTTCTGAGG - Intronic
1007934785 6:45723318-45723340 CCAGCAGCTCCACTTTGCTGTGG + Intergenic
1008348177 6:50455166-50455188 CCTGCTCCCACTCTTGGCTGCGG + Intergenic
1008829351 6:55739080-55739102 CCAGCTCCTCCTTGTACCTGTGG - Intergenic
1009000179 6:57703963-57703985 CCAGCTCCTCCTTGTACCTGTGG - Intergenic
1009166448 6:60347322-60347344 CCAGCTCCTCCTTTTACCTCTGG + Intergenic
1009362295 6:62829264-62829286 CCAGCTCCTCCTTGTTCCTCTGG + Intergenic
1009532535 6:64838897-64838919 GCAGCTCCTCCTAGTTGCTTAGG - Intronic
1009647459 6:66425042-66425064 CCAGCTCCTCCTTGTACCTGTGG - Intergenic
1010056955 6:71577898-71577920 CCTGCACATCCTCTTTGCTGGGG + Intergenic
1011348357 6:86396131-86396153 CCAGCTCCTCTTCATACCTGTGG - Intergenic
1012387382 6:98697927-98697949 CCAGCTACTACTATGTGCTGAGG + Intergenic
1012662859 6:101924753-101924775 CCATGTCCCACTCTTTGCTGGGG + Intronic
1013878390 6:114862956-114862978 CTAGGTTCTCCTCTTTGATGTGG - Intergenic
1014185892 6:118433629-118433651 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1014246358 6:119073955-119073977 CCTTCACCTCCACTTTGCTGAGG - Intronic
1014289313 6:119539931-119539953 CTAGGGCCTCCTCTCTGCTGAGG + Intergenic
1015190556 6:130467372-130467394 CCAAATCCTCCTGTTTACTGTGG - Intergenic
1015711130 6:136141544-136141566 CCAGCTCCTCCTTGTACCTGTGG + Intronic
1015842224 6:137488378-137488400 CCAGCTGCGTCTCTTCGCTGGGG - Intergenic
1016026449 6:139292228-139292250 CCAGCTGCTTCTCTCTGCTAAGG - Intergenic
1016459378 6:144266145-144266167 CCAGCTCCTCCTGCTGGATGGGG - Intergenic
1016730620 6:147423551-147423573 TCTGCTCCTCTTCTTTGCTGTGG + Intergenic
1016994474 6:149951843-149951865 ACAGCTCCTCCTGCTTTCTGTGG - Intergenic
1017382714 6:153848710-153848732 ACAGCTCCTCCTGCTTGCAGGGG - Intergenic
1018307908 6:162477674-162477696 CATCCTCCTCCTCTCTGCTGCGG + Intronic
1018642861 6:165921038-165921060 CCAGCTCCTCCTATTTCCAGGGG - Intronic
1018832757 6:167457654-167457676 CCGGTTCCTCCTCTTTGCTATGG - Intergenic
1018979576 6:168592340-168592362 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979586 6:168592391-168592413 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979594 6:168592442-168592464 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979606 6:168592496-168592518 GGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979616 6:168592547-168592569 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979627 6:168592601-168592623 GGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979635 6:168592652-168592674 TGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979646 6:168592703-168592725 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979656 6:168592754-168592776 CGAGCTCCTCCTTCTTCCTGAGG + Intronic
1018979665 6:168592805-168592827 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979675 6:168592856-168592878 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979686 6:168592907-168592929 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979697 6:168592958-168592980 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979707 6:168593009-168593031 CGAGCTCCTCCTTCTTCCTGAGG + Intronic
1018979716 6:168593060-168593082 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979726 6:168593111-168593133 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979737 6:168593162-168593184 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979747 6:168593213-168593235 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979756 6:168593264-168593286 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979767 6:168593315-168593337 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979777 6:168593366-168593388 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979787 6:168593417-168593439 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979798 6:168593468-168593490 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979808 6:168593519-168593541 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979818 6:168593570-168593592 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979829 6:168593621-168593643 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979839 6:168593672-168593694 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979849 6:168593723-168593745 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979859 6:168593774-168593796 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979870 6:168593825-168593847 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979880 6:168593876-168593898 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979891 6:168593927-168593949 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979901 6:168593978-168594000 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979912 6:168594029-168594051 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979922 6:168594080-168594102 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979933 6:168594134-168594156 GGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979943 6:168594185-168594207 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979953 6:168594236-168594258 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979963 6:168594287-168594309 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979974 6:168594341-168594363 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979985 6:168594395-168594417 GGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979995 6:168594446-168594468 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018980005 6:168594497-168594519 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018980014 6:168594548-168594570 TGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018980024 6:168594599-168594621 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018980033 6:168594650-168594672 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018980043 6:168594701-168594723 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018980053 6:168594752-168594774 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018980063 6:168594803-168594825 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018980074 6:168594857-168594879 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018980084 6:168594908-168594930 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018980095 6:168594962-168594984 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018980105 6:168595013-168595035 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018980114 6:168595064-168595086 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018980135 6:168595166-168595188 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018980146 6:168595220-168595242 CGAGCTCCTCCTCCTTCCTGAGG + Intronic
1019260984 7:81886-81908 TCAGTTCCTCATCTGTGCTGTGG - Intergenic
1019432890 7:1007570-1007592 GGAGCTTCTCCTCTTTCCTGGGG - Intronic
1019787318 7:2985369-2985391 CCAGTGCCTCCCTTTTGCTGTGG - Intronic
1020028202 7:4914523-4914545 CCAGCTCCCTCTCTTTGTTGGGG - Intronic
1020308900 7:6854851-6854873 CCAGCCCCTCCTCCCTCCTGAGG - Intergenic
1020927908 7:14355855-14355877 CCAGCTCCTCCTCGTACCTCTGG + Intronic
1021415308 7:20376973-20376995 ACAGCCTCTCTTCTTTGCTGAGG + Intronic
1021753167 7:23825176-23825198 CCAGCTCCTCCTTTTACCTCTGG + Intronic
1022338255 7:29443725-29443747 TCACCCCCTCCTCTTTCCTGAGG - Intronic
1022934215 7:35155359-35155381 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1023334565 7:39154840-39154862 CCACCTTCTCCATTTTGCTGGGG - Intronic
1023498307 7:40821342-40821364 CCAGCTCCTCCTCGTACCTCTGG + Intronic
1023498838 7:40827129-40827151 CCTGCCCCTCCTTTATGCTGTGG - Intronic
1023625085 7:42107579-42107601 CCAGCTCCTGCTCTGTTCTCTGG - Intronic
1023718726 7:43071664-43071686 CCAGCTCCTCCTCTTCTGTGTGG - Intergenic
1024342922 7:48285321-48285343 CCAGCCCTTCCTACTTGCTGTGG - Intronic
1024552328 7:50573411-50573433 CCAGCTCCTCCTTTTACCTCTGG + Intergenic
1025080690 7:55979921-55979943 GTAGCCACTCCTCTTTGCTGGGG - Intronic
1025232525 7:57212006-57212028 CTGGCTCCTCCTCTTTCCTCAGG + Intergenic
1025582614 7:62739357-62739379 CCAACTCCTCCTCTTACCTCTGG + Intergenic
1027964657 7:84990018-84990040 CCAGCTCCTCCTTGTACCTGTGG + Intergenic
1028854807 7:95578598-95578620 CCAGCTTCTCCTCTGTGTTCAGG + Intergenic
1030182529 7:106725176-106725198 CCAGCTCCTCCTCTTACCTCTGG - Intergenic
1031401555 7:121330042-121330064 GGAGCTCTTCCTCTTTCCTGCGG + Intronic
1031753311 7:125605753-125605775 CCACTTCTTCCCCTTTGCTGAGG + Intergenic
1032804129 7:135339000-135339022 CAGGCTCTTCCTCTTGGCTGGGG - Intergenic
1034131617 7:148723343-148723365 CCACCTTCTCTTCTGTGCTGAGG + Intronic
1034634059 7:152553567-152553589 CCAGTGCCACCTCTGTGCTGGGG - Intergenic
1034886895 7:154805073-154805095 ACAGCTACTCCTCTGTGGTGGGG - Intronic
1035369294 7:158368761-158368783 CCAAGTCTTCCTCCTTGCTGTGG + Intronic
1035642379 8:1193896-1193918 CCAGCGGCTCCTCCTGGCTGGGG - Intergenic
1035900096 8:3450005-3450027 CCAGCTCCTCCTCATCGATGTGG + Intronic
1036086259 8:5616449-5616471 CTAGCTCCTCATTTTAGCTGAGG + Intergenic
1036370457 8:8158257-8158279 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1036880435 8:12507374-12507396 CCAGCTCCTCCTTTTACCTCTGG + Intergenic
1036920951 8:12854854-12854876 TCAGGTCCTCATCTGTGCTGTGG - Intergenic
1038140818 8:24843122-24843144 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1039406355 8:37316015-37316037 CCTGCAGCTCCTCTTTGCTGGGG + Intergenic
1039548973 8:38429781-38429803 CCACCTCCTCCCCTGTGATGCGG + Exonic
1040368244 8:46742463-46742485 CCAGCTCCTCCTTTTACCTCTGG + Intergenic
1040403713 8:47079062-47079084 CCAGCTCCTCCTTGTACCTGTGG - Intergenic
1040693711 8:49970932-49970954 CCAGCTCCTCCTTGTACCTGTGG - Intronic
1041130539 8:54694397-54694419 CCAGCTCCTCCTTGTAGCTCTGG + Intergenic
1041807310 8:61866462-61866484 CCACCTCAGCCTCTTAGCTGGGG + Intergenic
1043200789 8:77367063-77367085 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1044248151 8:89974986-89975008 CCAACTCCCCCTCCTTTCTGGGG + Intronic
1044858667 8:96500191-96500213 ACACCTCCTCCTCTTCCCTGAGG + Intronic
1045013642 8:97980395-97980417 CCACGGCCTCCTCTTTGATGAGG - Intronic
1045069971 8:98492846-98492868 CCATCCCCTCCTCTTTCCTTAGG + Intronic
1045224598 8:100232230-100232252 ACTCCTCCTCCTCTTGGCTGCGG + Intronic
1045386350 8:101674621-101674643 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1045764445 8:105649959-105649981 CCAGCTCCTCCTTTTACCTCTGG + Intronic
1045840753 8:106577872-106577894 CCAGCTACCCTTCCTTGCTGTGG + Intronic
1046277334 8:111981097-111981119 CCACCTCTTCCTTTTTGCTTGGG + Intergenic
1046314217 8:112478886-112478908 CCTGCCCCTCCCCTATGCTGAGG + Intronic
1048334290 8:133491478-133491500 CCAGCCCTTCCTTTATGCTGAGG - Intronic
1049130552 8:140836348-140836370 CCATCTCTTCCTCCTTCCTGGGG + Intronic
1049189737 8:141280329-141280351 CCACCTATTCCTGTTTGCTGTGG - Intronic
1049305237 8:141899377-141899399 CTCGTTCCTCCTCTTTGATGTGG + Intergenic
1049688157 8:143947278-143947300 CCAACCCCTGCCCTTTGCTGTGG + Intronic
1050174941 9:2860225-2860247 CCATCTTCTCCTTTTTTCTGTGG + Intergenic
1050275404 9:3992503-3992525 CCATCTCCTCCTTTACGCTGAGG - Intronic
1050307158 9:4316395-4316417 GCAGCTCCTACTCCTTGCTAGGG + Intronic
1050633018 9:7580695-7580717 CCAGCTCCTGCTTTTTTCTCAGG - Intergenic
1051210061 9:14731872-14731894 CCAGCTCCTCCTTCCTGCTGGGG + Intergenic
1052484589 9:29080989-29081011 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1052627934 9:31001543-31001565 CCAGCTCCTCCTCATACCTCTGG + Intergenic
1052917609 9:33935638-33935660 CCACCACCTCCTTCTTGCTGTGG + Intronic
1054805514 9:69393113-69393135 GCAGCTCCACCCCTTAGCTGCGG - Intergenic
1055428435 9:76219124-76219146 GCAGCTCCTCCTCTCTCCAGGGG + Intronic
1055866422 9:80819408-80819430 CCAGCTCCTCCTTGTACCTGTGG - Intergenic
1056465640 9:86851331-86851353 CCAGCTCCTCTTCATAGCTCTGG + Intergenic
1056828292 9:89891718-89891740 CATGCTGCTCCTGTTTGCTGGGG + Intergenic
1056978298 9:91282100-91282122 CCTCCTCCTCCTCTCTGCTCTGG + Intronic
1057090511 9:92254058-92254080 CCAGGTCATCCTCTGTGGTGGGG - Intronic
1057215837 9:93228310-93228332 CCTGCTTCTCCTCTCTGCTTTGG + Intronic
1057412264 9:94827109-94827131 ACAGCTTCTCTTCTTTTCTGTGG + Intronic
1057729229 9:97594447-97594469 CCAGCTCCTCCTCGGGACTGAGG + Intronic
1058350459 9:104015375-104015397 CCAGCTCCTCCTCGTACCTCTGG + Intergenic
1058588936 9:106540342-106540364 CCAGCTCCTCCTCGTACCTCTGG + Intergenic
1060219546 9:121757094-121757116 CCACCTCTTCCTCCATGCTGAGG - Exonic
1062205598 9:135335186-135335208 CCAGCTCCTCCTCTGTGCATCGG + Intergenic
1062322614 9:135997838-135997860 CCAGCTGCTCCTCTCGGCTGTGG + Intergenic
1203779557 EBV:93514-93536 CCAGGTCCTCCTCTGGACTGTGG + Intergenic
1186509287 X:10118311-10118333 TCAGCTCCTCCTCGGAGCTGGGG + Intronic
1187307387 X:18108314-18108336 CCAGCTCCTCCTCGTACCTCTGG - Intergenic
1189258050 X:39655503-39655525 CCAGCTCCGCAGCTTTGCTTGGG + Intergenic
1190217939 X:48492615-48492637 CCAACTCCTCTCCATTGCTGTGG - Intergenic
1190401237 X:50037300-50037322 ACAGCCCCTCCACTTTGCTCTGG - Intronic
1190737783 X:53267048-53267070 CCTCCTCCTCCTCTTCCCTGGGG + Intronic
1190909651 X:54759090-54759112 ACAGCTCCTTATCTTTGCTCAGG + Intronic
1190916030 X:54811751-54811773 CCAGCTCCATCGCTATGCTGAGG + Intronic
1191712984 X:64172231-64172253 ACATCTCCTAGTCTTTGCTGAGG - Intergenic
1191804619 X:65121228-65121250 CCAGCTCCTCCTTTTACCTCTGG + Intergenic
1193074144 X:77337515-77337537 CCAGCTCCTCCTTGTACCTGTGG - Intergenic
1193474224 X:81943778-81943800 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1193616498 X:83694481-83694503 CCAGCTCCTCCTTTTACCTCTGG + Intergenic
1193840002 X:86397968-86397990 CCAGCTCCTCCTTTTACCTCTGG + Intronic
1195147794 X:102034991-102035013 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1195293937 X:103457126-103457148 CCAGCTCCTCCTTTTACCTCTGG + Intergenic
1196138171 X:112232182-112232204 CCAGATACGACTCTTTGCTGAGG - Intergenic
1196629694 X:117923662-117923684 CAAGCTACTCCTCTTTTCAGAGG - Intronic
1197051562 X:122064943-122064965 CCAGCTCCTCTTTTTTCCTCTGG - Intergenic
1197057980 X:122143564-122143586 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1197152508 X:123235232-123235254 CCTGCCCCTCCCCTTTTCTGAGG - Intronic
1197678345 X:129355365-129355387 CCAGCTCCTCCTTTTACCTCTGG - Intergenic
1197990942 X:132316454-132316476 CCAGCTCCTCCTCGTACCTCTGG + Intergenic
1198159847 X:133996939-133996961 CCAGCTAATACTCTTTGGTGTGG + Intergenic
1198926453 X:141801812-141801834 CCAGCTCCTCCTCGTACCTCTGG + Intergenic
1199806795 X:151308130-151308152 CCAGCTTATCCTCTATACTGGGG + Intergenic
1200082493 X:153585106-153585128 CCAGGACCTCCTCTTAGCTTTGG + Intergenic
1200160930 X:154008562-154008584 CAAGTTTCTCCTCTTTTCTGAGG - Intergenic
1200248853 X:154541670-154541692 CCACGCCCTCCTCTTTCCTGAGG + Intronic
1200426708 Y:3029425-3029447 CCAGCTCCTCCTTTTACCTCTGG + Intergenic