ID: 1165011804

View in Genome Browser
Species Human (GRCh38)
Location 19:32853938-32853960
Sequence TTAACAACTTTTTTGTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 729
Summary {0: 1, 1: 0, 2: 4, 3: 68, 4: 656}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165011804_1165011805 11 Left 1165011804 19:32853938-32853960 CCAACAAACAAAAAAGTTGTTAA 0: 1
1: 0
2: 4
3: 68
4: 656
Right 1165011805 19:32853972-32853994 AGACCTAAATAGTCCACCCATGG 0: 1
1: 0
2: 0
3: 7
4: 73
1165011804_1165011807 16 Left 1165011804 19:32853938-32853960 CCAACAAACAAAAAAGTTGTTAA 0: 1
1: 0
2: 4
3: 68
4: 656
Right 1165011807 19:32853977-32853999 TAAATAGTCCACCCATGGATTGG 0: 1
1: 0
2: 0
3: 9
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165011804 Original CRISPR TTAACAACTTTTTTGTTTGT TGG (reversed) Intronic
903089214 1:20895075-20895097 ATAAAAAATTTTGTGTTTGTTGG - Intronic
903096352 1:20979032-20979054 TTAATAAGTTTTTGCTTTGTTGG + Intronic
903108776 1:21109783-21109805 GTAACAAATTTTTTATTTTTGGG + Intronic
904511508 1:31013605-31013627 TTAATAATTGTTTTGGTTGTTGG - Intronic
905987354 1:42298541-42298563 TTTAAAACTTTTTTTTTTCTTGG + Intronic
906583919 1:46958965-46958987 GTAACAGGTTTTTTGTTTTTTGG - Intergenic
906627362 1:47335720-47335742 TTAAAAAAATTTTTTTTTGTTGG + Intronic
906927680 1:50136668-50136690 TTAACATCTTTCTCGTTTCTGGG + Intronic
906989354 1:50721615-50721637 TTAAATCATTTTTTGTTTGTTGG + Intronic
907151590 1:52293431-52293453 TAATAAACTTTTTTGTTTTTAGG + Exonic
907436423 1:54452105-54452127 TTAATAATTTTTTTTTTTTTTGG - Intergenic
907621565 1:55986208-55986230 TGAAGAACTTTTTTTTTTCTTGG + Intergenic
907651720 1:56301725-56301747 TTAACAACTCTTTTGTCACTGGG + Intergenic
908466898 1:64404954-64404976 TCACCAACTCTGTTGTTTGTTGG - Intergenic
908479898 1:64528741-64528763 TTATAAACATTTTTTTTTGTGGG + Intronic
908574685 1:65447110-65447132 TTATCATCTTTTTTTTTTCTTGG + Intronic
909623321 1:77688905-77688927 TTAACCACTTTTCTGTTTGGGGG + Intergenic
909901242 1:81138385-81138407 TGAGCAAGTGTTTTGTTTGTAGG - Intergenic
910749900 1:90617844-90617866 TAAACAAATTTATTTTTTGTTGG - Intergenic
910919446 1:92328351-92328373 TTAAATTCTTTTTTCTTTGTTGG + Intronic
910970480 1:92850963-92850985 TTAACTACTTTTTTATTTCCTGG - Intronic
911946684 1:104118744-104118766 TATACGACTTTTTTTTTTGTGGG - Intergenic
912984755 1:114416258-114416280 TTTAGAACATTTCTGTTTGTTGG - Intronic
913082987 1:115407000-115407022 TTCACAACTTGATTGTTTGGTGG + Intergenic
914330200 1:146661952-146661974 TTAACTACTTTTTAGTGTTTTGG + Intergenic
915569274 1:156735288-156735310 TAAAAAACTTTTTTTTTTTTTGG - Intronic
915594914 1:156891282-156891304 TTAAAAACTTTTTTTTTTATTGG + Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
917493915 1:175522722-175522744 ATAACAGCTTTATTTTTTGTGGG - Intronic
918269026 1:182877999-182878021 TTAACCACTTTTTCCTATGTAGG + Exonic
918275285 1:182948201-182948223 TTTCTAAGTTTTTTGTTTGTTGG + Intronic
918281788 1:183013380-183013402 TTATCAACATTATTGTTTGTAGG + Intergenic
918329039 1:183438515-183438537 CTAACAGCATTTTTGTGTGTGGG - Intergenic
918386918 1:184018061-184018083 TTAATGTCTTTATTGTTTGTTGG - Intronic
918458489 1:184752287-184752309 TTATCAACTATTTGGTTTGTTGG + Intronic
919278310 1:195450011-195450033 TTAACAACTCTTTGGTTGATGGG - Intergenic
919577113 1:199324177-199324199 ATAATGTCTTTTTTGTTTGTTGG - Intergenic
920001767 1:202805715-202805737 TTAGAAACTGTTTTGTTTTTGGG - Intronic
920530879 1:206701530-206701552 TTAAAAAGTATTTAGTTTGTAGG + Intronic
922089767 1:222384783-222384805 TTAGCCAGTTTTTTGTGTGTTGG - Intergenic
922648264 1:227313176-227313198 TTAGTAATTTTTTTGTTTTTAGG - Intronic
923292779 1:232562793-232562815 TGAAGCATTTTTTTGTTTGTAGG - Intergenic
923463226 1:234225348-234225370 TGCAAAACTTTTTGGTTTGTTGG + Intronic
923692192 1:236205536-236205558 TAATCAACTTTTTTATTTCTTGG + Intronic
923989097 1:239414326-239414348 TTAACAACTTTTTTTTAAGTAGG - Intronic
924310223 1:242733355-242733377 TTATCAATTTTTTTCTTTTTTGG - Intergenic
924316051 1:242797737-242797759 TTAATAACTCTTTTGTTGATAGG + Intergenic
924901018 1:248399545-248399567 ATAACATCTGTTATGTTTGTTGG - Intergenic
1063368459 10:5505949-5505971 TTATCATCTTTACTGTTTGTTGG - Intergenic
1063430413 10:5983556-5983578 TTAAAAAACTTTTTGTTTGGAGG + Intergenic
1064678150 10:17782322-17782344 GTAACAAATTTCTAGTTTGTAGG - Intronic
1064983850 10:21190312-21190334 TAAACATTTTTTTTTTTTGTAGG - Intergenic
1065704400 10:28458692-28458714 TTAGCAATTTTTTTTTTTTTTGG + Intergenic
1065904411 10:30237141-30237163 TTAACAACTCTCTTAATTGTGGG - Intergenic
1067022509 10:42813900-42813922 CCAACAGTTTTTTTGTTTGTTGG + Intronic
1067092159 10:43273094-43273116 TATACAACTTTTTTGATGGTGGG - Intergenic
1067154914 10:43772730-43772752 TTTGGAATTTTTTTGTTTGTTGG + Intergenic
1067737606 10:48870363-48870385 TTAACTACTTTTTTTTGAGTTGG - Intronic
1068276942 10:54812430-54812452 CCAACTAATTTTTTGTTTGTTGG + Intronic
1068499103 10:57820531-57820553 TTATTAACTTTTTAATTTGTGGG - Intergenic
1068815821 10:61311076-61311098 CTAACAGTTTTTTTTTTTGTTGG + Intergenic
1069005342 10:63311511-63311533 TTAATAACTTTTAGGTTTCTTGG - Intronic
1069538576 10:69275216-69275238 TTAAAAGGTTTTTTGTTTTTTGG - Intronic
1069705672 10:70457953-70457975 TAAGCAACTTTTTTTTTTTTAGG - Intergenic
1070223841 10:74479373-74479395 TTAGCCACTTTGTTTTTTGTTGG + Intronic
1070463474 10:76692981-76693003 TTTACAATTCTTTTGGTTGTGGG + Intergenic
1070697789 10:78575561-78575583 TTAAGCACTTTTTTGTGTGCTGG - Intergenic
1071224415 10:83511439-83511461 TTATCAATTTTTTTTTTTGTGGG - Intergenic
1071500588 10:86201172-86201194 TTATCTACTTTATTGTCTGTGGG - Intronic
1071677109 10:87665208-87665230 TTTACCACTTTTTTTTTTTTTGG + Intronic
1071885471 10:89945203-89945225 TTAGTAACTTTTTTCTTTGTCGG + Intergenic
1071993956 10:91128494-91128516 TTAACAGCATCTTTCTTTGTTGG - Intergenic
1074359444 10:112813331-112813353 TTGACAACCATTTTATTTGTGGG - Intronic
1075288578 10:121208794-121208816 CTGACAACTTTTTTTTTTGGGGG - Intergenic
1075503379 10:122999024-122999046 TTAAAAACACTTTTTTTTGTAGG - Intronic
1075843601 10:125526808-125526830 TTAACAAAATTTTTGTTTTGTGG + Intergenic
1075917901 10:126185473-126185495 TTAACATCTGTTTTTTTTTTTGG + Intronic
1076521343 10:131083227-131083249 TTACCAACTTTTATGTGTGGAGG + Intergenic
1078585491 11:12583437-12583459 CTAGCAAGTTTTTTGTTTGGAGG + Intergenic
1079000936 11:16755039-16755061 TTTGCATCTTTTTTGTTTTTGGG - Exonic
1079029355 11:16974266-16974288 TGAACAATTTTTTTTTTTTTTGG - Intronic
1079198299 11:18351223-18351245 TTAAAAAATTTTTTTTTTCTAGG - Intronic
1079866085 11:25736154-25736176 TTACAGACTTTTTTGTGTGTGGG - Intergenic
1080533600 11:33200233-33200255 TTAACAATTTTTTTATTTCGTGG + Intergenic
1080679753 11:34463356-34463378 TTAAAAAATTCTTTGTTTATTGG + Intronic
1081068932 11:38585062-38585084 TTAACAGCCATTTTGTTTGTTGG - Intergenic
1081140858 11:39497825-39497847 TGGACAACTTTTTTTTTTTTTGG + Intergenic
1081509590 11:43756540-43756562 TTAAAAAATGTTGTGTTTGTGGG + Intronic
1081879597 11:46437107-46437129 TTAAATGCTTTTTTGTGTGTTGG - Intronic
1082040558 11:47681397-47681419 TTAACAAGTTTTGTGTTCTTGGG - Intronic
1082064383 11:47887309-47887331 ATAACAAATTTTTTCTTTTTTGG - Intergenic
1082779532 11:57275969-57275991 TTATTAATTGTTTTGTTTGTTGG + Intergenic
1083074041 11:60018771-60018793 TTAATGTCTTTTTTGTATGTGGG + Intergenic
1083506523 11:63162986-63163008 TTTTGAGCTTTTTTGTTTGTTGG - Intronic
1084052916 11:66612611-66612633 TTTACCACATTTTTGTTTTTAGG - Intergenic
1084342335 11:68514234-68514256 AAAAAAACTTTTTTTTTTGTAGG + Intronic
1085540243 11:77261234-77261256 CTAACATCTTTTTTTTTTTTTGG + Intronic
1087533587 11:99415143-99415165 TTAACCTCCTTTTTGTTTATAGG - Intronic
1087738794 11:101864096-101864118 CTGACAACTTTTTTGTTGGTCGG - Intronic
1088126300 11:106428263-106428285 TTAACAATTTTTTTTTCTGCAGG + Intergenic
1088138543 11:106586707-106586729 TTAACAACTTATTTCCTTTTTGG - Intergenic
1088345159 11:108816040-108816062 CTAGCAACTTTTTTTTTTTTTGG + Intronic
1088936111 11:114401676-114401698 CTAAACACCTTTTTGTTTGTAGG + Exonic
1089234859 11:117015063-117015085 TTAAAAACTTTTGTGTATTTTGG - Intronic
1090052240 11:123389736-123389758 TTCACAACTTTTTTCTAGGTGGG + Intergenic
1090219228 11:125001863-125001885 TGTACAAGTTTTTTTTTTGTGGG + Intronic
1090303664 11:125671271-125671293 CTAATAACTTTTTTTTTTGAAGG - Intronic
1090485912 11:127111984-127112006 TTATCAACGTTTTATTTTGTTGG - Intergenic
1090783371 11:130027121-130027143 TTAAAAACTTTTTATTTTTTAGG + Intergenic
1091133826 11:133169918-133169940 ATAAAATCATTTTTGTTTGTGGG + Intronic
1091385241 12:90346-90368 TTAGCAATTTTTTTGTTTCGTGG + Intronic
1091412305 12:251789-251811 TTAAAAACTTTTTTTTTTTTTGG - Intronic
1091465565 12:681004-681026 TTTACAATTTTTTTTTTTTTGGG - Intergenic
1091488429 12:912020-912042 TTAACAACTTTTTTTTTGAGAGG - Intergenic
1091717774 12:2792051-2792073 TTAACGGCTTTTTTTTTTTTTGG + Intergenic
1091752230 12:3030172-3030194 TAAAAAGTTTTTTTGTTTGTTGG + Intronic
1092335821 12:7632206-7632228 TTATCAACTTTGTTGGTTGTAGG + Intergenic
1093274635 12:17109059-17109081 TTAATGACATTTTTGTTTATTGG - Intergenic
1093602433 12:21044802-21044824 TTAACAACTGATTTGTTGGTTGG - Intronic
1093831458 12:23765174-23765196 TTAACAACTTGTTTATTATTTGG + Intronic
1094562317 12:31567141-31567163 TTGGCAACTTTATTGTATGTTGG - Intronic
1094804663 12:34077404-34077426 TTATGCACATTTTTGTTTGTTGG - Intergenic
1095263597 12:40127134-40127156 TAAACAACTTTGTTATTTGCAGG + Intergenic
1095650243 12:44599422-44599444 TTAATAACTTTTTAATTTCTAGG - Intronic
1095894800 12:47269341-47269363 ATATCTACTGTTTTGTTTGTGGG + Intergenic
1096684794 12:53280990-53281012 TTAACCACTTTTTTTTTTTTAGG - Intronic
1096711645 12:53461508-53461530 TTAACAACTTGTCACTTTGTAGG + Intronic
1096754999 12:53792053-53792075 TTAACACCTGTTTTGCTTGCTGG - Intergenic
1096851789 12:54443996-54444018 GTAACAGTTTTTTTTTTTGTGGG + Intergenic
1097263852 12:57734943-57734965 GTACCAGCTTTTTTGTGTGTTGG + Intronic
1097444383 12:59649955-59649977 TTTAGAACTTTTTTTTTGGTGGG - Intronic
1097911737 12:64977767-64977789 TAAAAAATTTTTTTATTTGTTGG + Intergenic
1099224303 12:79950767-79950789 TTAGCAAGTTTTTTTTTTGTAGG + Intergenic
1099544069 12:83954447-83954469 TATACAAGTTTTTTGCTTGTAGG + Intergenic
1100114883 12:91292429-91292451 ATAAATATTTTTTTGTTTGTGGG + Intergenic
1100308540 12:93373203-93373225 ATAACAATTTTTTTATTTGAGGG - Intergenic
1100735332 12:97523163-97523185 TTAATACCTTATTTGGTTGTTGG + Intergenic
1100845104 12:98650194-98650216 TTAATAATTTTTTTTTTAGTAGG + Intronic
1100961284 12:99965446-99965468 TTAATAACTATTTTGTGTGGAGG - Intronic
1101070296 12:101067682-101067704 TTGAGCACTTTTTTGTTTTTGGG - Intronic
1101784420 12:107870518-107870540 TTACCACCTTTTTTTTTTGGTGG - Intergenic
1101905704 12:108824071-108824093 TTAACAACTCCATTGTTTCTTGG + Intronic
1102067350 12:109988270-109988292 TTAATAGCTTTTTTGTCAGTCGG - Intronic
1102268026 12:111505574-111505596 TGAACATCTTTTGTGTTTATTGG - Intronic
1102441264 12:112965474-112965496 TTGAGAAGTGTTTTGTTTGTTGG - Intronic
1102641454 12:114370789-114370811 TTAAAAATTTTTTTGTTTTGGGG + Intronic
1103181276 12:118914053-118914075 TTAAAAACTTTTTTTTTTTTTGG - Intergenic
1103455928 12:121065266-121065288 TGAACAAGTTTTTTTTTTTTTGG + Intergenic
1104021028 12:124992492-124992514 TTAAAAACTTTTTTGTAGGTCGG - Intergenic
1104692359 12:130836596-130836618 TTACCAGATTTTTTGTTTTTAGG - Intronic
1105018114 12:132798491-132798513 TGAGCAACTTTTTACTTTGTGGG - Intronic
1105375247 13:19838387-19838409 TTACCAGCATTTTGGTTTGTTGG - Intronic
1105549106 13:21376118-21376140 TTAATAACTTTTTTTATTGTTGG - Exonic
1105654945 13:22426302-22426324 ATAAAAGCTTTTTTGCTTGTTGG - Intergenic
1105919823 13:24952286-24952308 TTTACAAGTTTTTTTTTTTTTGG - Intergenic
1106105101 13:26725970-26725992 TTAACAATTTTTTTCTTTCATGG + Intergenic
1106277030 13:28219809-28219831 TTAATCACTTTCTTTTTTGTAGG - Intronic
1106855744 13:33849890-33849912 TCTAATACTTTTTTGTTTGTTGG - Intronic
1107626152 13:42287282-42287304 TTAATTACTTTTTTTTTTTTGGG + Intronic
1107842524 13:44473897-44473919 ATAACAGCTTTTTAATTTGTTGG - Intronic
1107850332 13:44565496-44565518 ATAACAACTTTTTAGATTCTAGG - Intronic
1108050311 13:46428824-46428846 TTACCAATTTTTCTGTTTCTTGG + Intronic
1108124724 13:47229604-47229626 TTAACATCTTTTTTTTTTTGAGG - Intergenic
1108170259 13:47734539-47734561 TTAACAATTTTTATGTGTATAGG - Intergenic
1108239880 13:48452784-48452806 TTTTCTACTTTTTTGTGTGTGGG + Intronic
1108575855 13:51789913-51789935 TGACCAACTTTTTTGGTTCTTGG - Intronic
1108875896 13:55050489-55050511 TGATCAATTTTTATGTTTGTTGG - Intergenic
1109162719 13:58995778-58995800 TTAACAAATTTTTTGACTATTGG + Intergenic
1109383699 13:61599702-61599724 TTCACAACTTTTTTTTTTTTTGG - Intergenic
1109518662 13:63478482-63478504 TTAAATTCTCTTTTGTTTGTTGG - Intergenic
1109542834 13:63802140-63802162 TTACCAATTTTTCTGTTTCTTGG + Intergenic
1109670545 13:65600935-65600957 TAAACATCTGTTTTGTTTATTGG + Intergenic
1109734030 13:66457465-66457487 TGAACAACCTTTCTATTTGTAGG - Intronic
1110094244 13:71496238-71496260 ATAGCAATTTTTTTGTTTTTTGG - Intronic
1110342637 13:74411360-74411382 TTAACATCTTATTTCTTAGTTGG + Intergenic
1111696401 13:91630326-91630348 TTAGCTTCTTTGTTGTTTGTAGG + Intronic
1111800747 13:92977374-92977396 ATAATAATTTTTTTGCTTGTTGG + Intergenic
1111862329 13:93723740-93723762 TTCACAATTTTTTTGAGTGTGGG + Intronic
1112491967 13:99874200-99874222 TTAAAAACATTTTAGTTTCTGGG - Intronic
1112964590 13:105172073-105172095 CTAACAATTTTTTTGTCTTTAGG - Intergenic
1113196408 13:107812781-107812803 TTTTCATTTTTTTTGTTTGTTGG + Intronic
1113977169 13:114236615-114236637 TTACCACCTTTTTTTTTTTTTGG + Intronic
1114196651 14:20483817-20483839 TTAAAAACATTTCTGTTTATTGG - Intergenic
1114309066 14:21449676-21449698 CTAATCACTTTTATGTTTGTAGG + Intronic
1114511702 14:23267429-23267451 GTAACAATTTTTTTTTTTTTGGG + Intronic
1114701655 14:24684760-24684782 TTACCAATTTTTTTATTAGTTGG + Intergenic
1114842644 14:26283222-26283244 TTATCAACTTCTATGTTTGCTGG + Intergenic
1115094448 14:29618067-29618089 CTAAAAGCTTTTTTGTTTTTTGG - Intronic
1115536129 14:34375042-34375064 TTAAAGACTTTTTTTTTTTTTGG - Intronic
1115724890 14:36202543-36202565 TTAACAGTTTTTTTTTTTTTTGG - Intergenic
1115798476 14:36966018-36966040 TTAAAAACTTTTAATTTTGTAGG - Intronic
1116004716 14:39280333-39280355 TCTACAAGTTTTTTTTTTGTGGG + Intronic
1116063055 14:39948323-39948345 TTAAAAACTCTTTTGATTTTTGG - Intergenic
1116370129 14:44120253-44120275 TTTGCATCTTTTTTGTTTTTGGG + Intergenic
1116473867 14:45317569-45317591 TTACCTATTTTTTTTTTTGTGGG + Intergenic
1116508804 14:45718410-45718432 TGGATAACTTTTCTGTTTGTGGG + Intergenic
1116584251 14:46682427-46682449 CTAACAAGTTTTTTTTTTTTTGG + Intergenic
1116805792 14:49492974-49492996 TTAATTATTTTTTTGTTTTTGGG - Intergenic
1116876657 14:50118852-50118874 TTAATTACTTTTTTTTTTGAGGG - Exonic
1117129547 14:52671566-52671588 TTAAAAACTTTTTTTTTCTTAGG + Intronic
1117351722 14:54887841-54887863 TTGACTACTTTTATGTTTGAAGG + Intronic
1117700262 14:58405512-58405534 TTAATAGCTTTTTTATTTTTTGG + Intronic
1117872949 14:60219785-60219807 TTAACCACTATTTAGTTTGTGGG + Intergenic
1118584157 14:67336257-67336279 GTAAGAAACTTTTTGTTTGTTGG - Intronic
1118965750 14:70583225-70583247 CTTACAACTTTTCTGTTTGCCGG + Intronic
1119011414 14:70993561-70993583 TTAAAAACCTTTTTGTATATTGG + Intronic
1119119267 14:72058849-72058871 TTAACTACTTATTTGATGGTAGG - Intronic
1119338961 14:73858794-73858816 TTAAAAATTTTTTTATTTATAGG + Exonic
1119481084 14:74958314-74958336 TTAAAAACTTTTTTTTTTTGGGG + Intergenic
1119503000 14:75146858-75146880 TGAACAACTGTTTTGTGTTTGGG - Intronic
1119552443 14:75524793-75524815 TTAACCATTTTTTTTTTTTTTGG + Intronic
1120049957 14:79853944-79853966 TTAACAAATTTTTACTTTGGGGG - Intronic
1120384558 14:83827779-83827801 TTATAAACCATTTTGTTTGTCGG + Intergenic
1120683155 14:87505580-87505602 TGAAGAACTTTTTTGTTTTGGGG - Intergenic
1120693125 14:87615461-87615483 TTGACAGCTTTTTTTTTTGGAGG + Intergenic
1120773986 14:88412122-88412144 TTGAGTACTTTTTTATTTGTTGG + Intronic
1121370562 14:93354665-93354687 TTAAAAAACTTTTTTTTTGTAGG + Intronic
1122492848 14:102131472-102131494 TTAAGAATTTATTTGTTTGCTGG - Intronic
1122739794 14:103865607-103865629 TGAACAACTTTTTTTTTTTTTGG - Intergenic
1124259881 15:28179074-28179096 TTAAAAACTTTTTTGTTTTTTGG + Intronic
1124698868 15:31893759-31893781 GTATCTCCTTTTTTGTTTGTTGG + Intergenic
1124787648 15:32696794-32696816 ATAAGAGCTTTTTTGTTTCTTGG + Exonic
1124827964 15:33117964-33117986 TTAACAACAATTTTCTTTCTAGG - Intronic
1125395462 15:39242802-39242824 TTATCAGCATTTTTGTTTGTTGG - Intergenic
1126160122 15:45604066-45604088 TTAAAAATAGTTTTGTTTGTGGG + Intronic
1126572379 15:50165534-50165556 TTAAAAACTTTTTTATTTAGGGG - Intronic
1126601560 15:50433233-50433255 TAAATAACTTTTTTTTTTTTTGG - Intronic
1126931838 15:53662014-53662036 AAAACACCTATTTTGTTTGTTGG - Intronic
1127173783 15:56331686-56331708 TTAAAAATTTTTTTTTATGTAGG - Intronic
1127402592 15:58604544-58604566 TCAACAGGTATTTTGTTTGTTGG - Intronic
1127474339 15:59318535-59318557 TTGAAATCTTTTTTGTTTTTTGG - Intronic
1127620703 15:60731342-60731364 TTAGCAACCATTTAGTTTGTGGG + Intronic
1127859852 15:62984733-62984755 TTAAAAACATTTTTTTTTCTGGG + Intergenic
1128174668 15:65544550-65544572 TTAAAAATTTTTATTTTTGTGGG + Intronic
1128432505 15:67611134-67611156 TTAATAAGTTTTATGTTTATTGG - Intronic
1128523791 15:68394229-68394251 TTAAAATCTTAGTTGTTTGTTGG - Intronic
1128946414 15:71825499-71825521 TTAAAAACCTTTTTATTTTTTGG + Exonic
1129017245 15:72479403-72479425 TAAATAACTTTTTTTTTTTTTGG + Intronic
1129076037 15:72996890-72996912 CAGACAACTTTTTTGTTTGTTGG - Intergenic
1129864152 15:78890376-78890398 TTGACACCTTTTTTTTTTGGTGG + Intronic
1130002869 15:80062574-80062596 TGAATAACCTTTTTGTTTGAAGG + Intronic
1130178654 15:81602658-81602680 TTATCAACATTCTTGTTTGTAGG + Intergenic
1130681120 15:85997570-85997592 TTAATAACTTTAATGTTCGTGGG - Intergenic
1131488085 15:92838709-92838731 TTTTCAACTTTTCTGTTTGTTGG - Intergenic
1131740280 15:95382747-95382769 TTACCAACTTTTTTCTTTCATGG - Intergenic
1132422276 15:101680817-101680839 TTATCAACTTTTTTCTTTTATGG + Intronic
1133003822 16:2866385-2866407 TTTGCAACTTTTGTGTTTCTGGG - Intergenic
1134305211 16:13025802-13025824 TTAACAACATTTTTTTTGGGGGG + Intronic
1134492835 16:14708545-14708567 TTAACATTTTCTTTCTTTGTAGG + Intergenic
1134498216 16:14747667-14747689 TTAACATTTTCTTTCTTTGTAGG + Intronic
1134582358 16:15381426-15381448 TTAACATTTTCTTTTTTTGTAGG - Intergenic
1135108018 16:19667752-19667774 TTAACAACTATTTTTTTTTCTGG - Intronic
1135313676 16:21425476-21425498 TTAACATTTTGTTTTTTTGTAGG - Intronic
1135366600 16:21857756-21857778 TTAACATTTTGTTTTTTTGTAGG - Intronic
1135445215 16:22513402-22513424 TTAACATTTTGTTTTTTTGTAGG + Intronic
1135516241 16:23137742-23137764 TTAATAACTTTTTGCTTTGTTGG - Intronic
1135918854 16:26630244-26630266 TTAACAATTTTCTTCTTTATAGG + Intergenic
1136152815 16:28363199-28363221 TTAACATTTTCTTTTTTTGTAGG - Exonic
1136210268 16:28752074-28752096 TTAACATTTTCTTTTTTTGTAGG + Exonic
1136277612 16:29188090-29188112 TAAGCATCTTTTTTGTTTGTTGG + Intergenic
1136310339 16:29404179-29404201 TTAACATTTTCTTTTTTTGTAGG - Intergenic
1136323788 16:29505970-29505992 TTAACATTTTCTTTTTTTGTAGG - Intronic
1136438473 16:30245951-30245973 TTAACATTTTCTTTTTTTGTAGG - Intronic
1136789228 16:32954775-32954797 GTAACAATTTTTTTTTTTTTTGG - Intergenic
1136880585 16:33899163-33899185 GTAACAATTTTTTTTTTTTTTGG + Intergenic
1137276002 16:46933977-46933999 TTTAAAACTTTTTTTTTTTTTGG + Intergenic
1138057972 16:53856348-53856370 TAAACATCTTTTTTTTTTTTTGG + Intronic
1139201004 16:64976886-64976908 TTCAAAGCTTTTTTGTTGGTTGG - Intronic
1139637765 16:68268707-68268729 TTAAAAATTTTTTTGTTGGCTGG + Intronic
1139858022 16:69996566-69996588 TTAACATTTTCTTTTTTTGTAGG - Intergenic
1140003355 16:71048954-71048976 TTAACTACTTTTTAGTGTTTTGG - Intronic
1140589638 16:76336442-76336464 TTAATAACTTTTTCTTTTGGGGG - Intronic
1140754021 16:78051559-78051581 CTAACAATTTTTTTTTTTTTTGG + Intronic
1142081987 16:88154132-88154154 TAAGCATCTTTTTTGTTTGTTGG + Intergenic
1142722891 17:1788742-1788764 TGAACAAATTTTTTTTTTTTTGG - Intronic
1144152259 17:12460666-12460688 TCTACAACTTTTTTGTATATTGG - Intergenic
1145076925 17:19863213-19863235 TTGACAACCTTTTTTTTTTTTGG - Intronic
1147022747 17:37550696-37550718 TTAGCACCTTTTTTTTTTTTTGG - Intronic
1147194683 17:38757952-38757974 TTATTAACTTTTTTTTTCGTTGG - Intronic
1147943882 17:44069312-44069334 TTTACACCTTTTTTTTTTTTTGG + Intergenic
1148328432 17:46797921-46797943 AAAACCAGTTTTTTGTTTGTTGG + Intronic
1148717791 17:49728208-49728230 TTAAAAATGTTTTTCTTTGTGGG - Intronic
1149317597 17:55453143-55453165 TTAAAAATTTTGTTGTGTGTTGG - Intergenic
1149803230 17:59590069-59590091 TTTACTAATTTTTTTTTTGTAGG + Intronic
1149843258 17:59985420-59985442 TTTACTAATTTTTTTTTTGTAGG - Intergenic
1150863709 17:68827477-68827499 GTAACAACCTTTTTTTTTTTTGG + Intergenic
1151020723 17:70614053-70614075 TTAACATATTTTTTGTAAGTAGG - Intergenic
1151273924 17:73019038-73019060 TTAACAGTTTTTTTGCTTTTAGG - Intronic
1152428796 17:80236006-80236028 CTAAAAACTTTTTGCTTTGTGGG - Intronic
1152620317 17:81360726-81360748 CTAACCACTTTTTTGTAAGTTGG - Intergenic
1152711797 17:81874828-81874850 TGAACATCTTTTCTGTGTGTAGG + Intergenic
1153360750 18:4193847-4193869 TTTACAATTTTTTTTATTGTTGG - Intronic
1153471289 18:5448872-5448894 TTTAAAACTTTCTTGATTGTTGG - Intronic
1153708256 18:7769565-7769587 TTAAAAAATTTTTTGGTGGTGGG + Intronic
1153874813 18:9359950-9359972 TTAACATCTGTCTTGTTTCTAGG + Exonic
1154089237 18:11342158-11342180 TTAACAACTGGTTAGTTTATTGG + Intergenic
1155349901 18:24896343-24896365 TTGACAACTTTATTTTTTGTGGG + Intergenic
1155493165 18:26419307-26419329 TTAAAAACTTCTTTGTTGGCAGG + Intergenic
1155548250 18:26937780-26937802 TTGACAAGCTTTTTGTGTGTAGG - Intronic
1155631433 18:27898043-27898065 TTATTCACTTGTTTGTTTGTGGG - Intergenic
1155637112 18:27969161-27969183 TTAGCAAATTTTTTGTTGGTGGG - Intronic
1156152220 18:34255735-34255757 TAAACCACTTTTTTTTTTTTTGG - Intergenic
1156737911 18:40284832-40284854 TTAAAAACCTTTTTGTATCTTGG - Intergenic
1156799652 18:41094540-41094562 TGATGAACTGTTTTGTTTGTAGG + Intergenic
1156874389 18:41989849-41989871 TAAATAACTTTTTTTTATGTTGG + Intronic
1157000764 18:43521504-43521526 TTACCAACTTTTGTCTTTGGTGG + Intergenic
1157853543 18:51082172-51082194 TTAACAATTATTTTGTAGGTGGG + Exonic
1158078976 18:53565999-53566021 CTAACAACATTTGTCTTTGTGGG + Intergenic
1158375181 18:56855507-56855529 TTAACAGCTTTTATGTCTGTAGG - Intronic
1158389475 18:57033419-57033441 TGAAGAACTTTCTTGATTGTTGG - Exonic
1158722682 18:59939442-59939464 TTAAAAAATTTTTTTTTTGGTGG + Intergenic
1158959401 18:62576251-62576273 TTAAGACTTTTTTTGTTTCTGGG - Intronic
1159129382 18:64263013-64263035 TTGACAACATTCTTATTTGTTGG - Intergenic
1159213591 18:65362324-65362346 CTAAAAACTTTTCTTTTTGTGGG + Intergenic
1159222484 18:65482405-65482427 TTGACAACTGTATTTTTTGTTGG - Intergenic
1159255637 18:65941768-65941790 GTAACAACTTCTTAGATTGTTGG + Intergenic
1159352449 18:67293614-67293636 CAAACAACTTTTTTTTTTTTTGG + Intergenic
1159742233 18:72186340-72186362 ATATCAACTTTTTTTTTTGTGGG - Intergenic
1161146751 19:2683516-2683538 TGAGCATCGTTTTTGTTTGTTGG - Intronic
1162083423 19:8233709-8233731 TTAAAAAATTTTTTAATTGTGGG + Intronic
1163088469 19:15000985-15001007 CAAACATCTTTTCTGTTTGTGGG - Intronic
1163353334 19:16793551-16793573 TTAACTGTTTTTTTGTTTTTTGG + Intronic
1164129854 19:22351530-22351552 TCAAAATCTTTTCTGTTTGTTGG - Intergenic
1164150388 19:22545517-22545539 TTAAAAAATTTTTCTTTTGTAGG - Intergenic
1164568159 19:29345930-29345952 TTCATAACTTTTGTGTTTCTGGG - Intergenic
1164928342 19:32149705-32149727 TTAAATTCTTTTATGTTTGTTGG + Intergenic
1165011804 19:32853938-32853960 TTAACAACTTTTTTGTTTGTTGG - Intronic
1165464273 19:35963398-35963420 TTAACCACCTTTTTGGTTGTGGG + Intergenic
1165669530 19:37663636-37663658 TTAATGACTTTTTTTTTTTTTGG - Intronic
1165674771 19:37712510-37712532 ATAAGCACTTTTTTGTTTCTTGG - Intronic
1166093368 19:40524508-40524530 TTAACACATTTTTTTTTTGGAGG - Intronic
1166666193 19:44681929-44681951 TAAATAACTTTTTTTTTTTTTGG - Intronic
1167330310 19:48851622-48851644 TTTACAACATTTTTTTTTGAGGG - Intronic
1168693446 19:58391623-58391645 CTGAGAACTTTTTTGTTTTTGGG - Intronic
924965472 2:72762-72784 TTAAAAACATTTATGGTTGTGGG - Intergenic
925957395 2:8980692-8980714 TTAACGATCTTTTTGATTGTAGG - Intronic
926803984 2:16687730-16687752 TAAACAACTACTTTATTTGTCGG + Intergenic
927998205 2:27501375-27501397 TTATAAGGTTTTTTGTTTGTTGG + Intronic
928049527 2:27975677-27975699 TTATCAACTTTTTTCTTTTATGG - Intronic
928705946 2:33949918-33949940 ATAACAACTTTGTTTTTTGTTGG - Intergenic
928809108 2:35200009-35200031 TTGACAATTTTTTTTTTTTTTGG + Intergenic
928991166 2:37234079-37234101 TTATGGGCTTTTTTGTTTGTTGG + Intronic
929474847 2:42235652-42235674 TTAACAACTTATTTGTTCTTGGG + Intronic
929542745 2:42834784-42834806 GTTACAATTTTTTTGTTTGTTGG + Intergenic
930673773 2:54178584-54178606 TTAACATCTTTTATGTTTTCTGG + Intronic
930685543 2:54303360-54303382 CTAACAACTTTTTTTTTGGAGGG - Intronic
931080494 2:58764034-58764056 TTAAAAAATTTTTTGAATGTTGG + Intergenic
931173062 2:59825390-59825412 TAAACAAATATTTTGGTTGTCGG - Intergenic
932931137 2:76040895-76040917 TAAACATTTTTTATGTTTGTTGG - Intergenic
932936236 2:76105619-76105641 TTCACATTTATTTTGTTTGTAGG + Intergenic
932971263 2:76545788-76545810 TTAATAAATTTTTTGGTTGCTGG + Intergenic
933790529 2:85880425-85880447 TTAAAAACTGTTATGTCTGTTGG - Intronic
933802174 2:85970298-85970320 TTACCAATTTTTTTTTTTGTAGG - Intergenic
935028380 2:99298908-99298930 TTAATTACTTTTTGTTTTGTTGG + Intronic
935629361 2:105200138-105200160 TTAACATTTTTTATTTTTGTGGG - Intergenic
935972945 2:108548328-108548350 TTGAGAACTTTTTTGTCTTTTGG + Intronic
936393683 2:112100265-112100287 TTAGCAACTTTTCTTTTTTTAGG + Intronic
936596152 2:113850097-113850119 TTAAGAGATTTTTTGTTTTTTGG - Intergenic
936643746 2:114345608-114345630 TTTACAATTTATTTGTTTGTTGG - Intergenic
939756995 2:146126530-146126552 TTTATAACTTTTCTGTTTCTTGG - Intergenic
940212644 2:151271553-151271575 ACAACAACTTTATTTTTTGTGGG + Intronic
941851514 2:170187576-170187598 TTTTCTACTTTTTTGTATGTAGG + Intronic
942112043 2:172692288-172692310 TTAAAAAATTTTTAGTTTGATGG - Intergenic
942406123 2:175657447-175657469 TTAACATCCTTGATGTTTGTAGG + Intergenic
942903663 2:181154873-181154895 TTATCAGCTTTCTTGTTGGTAGG + Intergenic
943116091 2:183672591-183672613 TGAACAACTTTTATTCTTGTAGG - Intergenic
943347778 2:186760524-186760546 TTACCAATTTTTTTGTTACTTGG + Intronic
944752009 2:202718576-202718598 TTAAAAATTTTGTTGTTGGTTGG + Intronic
944774297 2:202946862-202946884 TGATGAACTTTTATGTTTGTTGG - Intronic
944803312 2:203257491-203257513 TTAAAAAATTTTTTTTTTGCCGG + Intronic
945145963 2:206738574-206738596 TTATTAGCTTTTTTGTTTGCTGG + Intronic
945306044 2:208259814-208259836 TTGAAAACTTTCTTGTCTGTTGG - Intronic
946749088 2:222874943-222874965 TTTATATCTTTTTTTTTTGTTGG - Intronic
947051554 2:226049620-226049642 TTTTCAACTTTTTTATTAGTAGG - Intergenic
1169062918 20:2674577-2674599 TAAACAATTTTTTTTTTTTTAGG - Intergenic
1169304584 20:4477469-4477491 TCAACCATTTTTATGTTTGTAGG + Intergenic
1170278731 20:14622498-14622520 CTAACAACTCTTTTGTGTCTTGG - Intronic
1170544288 20:17420916-17420938 TTCACAACTCTATTGGTTGTCGG - Intronic
1171215349 20:23348558-23348580 TTTACTACTTTTTTCTTTGGAGG - Intergenic
1172296484 20:33814814-33814836 TTCAAAACATTTTTTTTTGTAGG + Intronic
1172370743 20:34388604-34388626 ATCATAACTTTTTTGTTTATTGG - Intronic
1172746014 20:37209641-37209663 TAAAAAACTTTTTTTTTTTTTGG + Intronic
1173446551 20:43123996-43124018 TTAAAAATTCCTTTGTTTGTCGG - Intronic
1173765452 20:45604626-45604648 TTGAGAATTTTTTTCTTTGTTGG + Intergenic
1173996813 20:47344945-47344967 TAAAAAAATTTTTTTTTTGTAGG - Intronic
1174951225 20:55043026-55043048 TTAAACATTTTTTTGATTGTGGG - Intergenic
1175476151 20:59276078-59276100 TAAAAAAATTTTTTTTTTGTAGG + Intergenic
1176897633 21:14401101-14401123 TTAATTACTTCTTTGTTTGAAGG - Intergenic
1177165827 21:17602157-17602179 TTTACAACTTTTTTTTTTTTTGG - Intronic
1177493369 21:21857083-21857105 TTAAAAATTGTTTTATTTGTAGG - Intergenic
1178345523 21:31823900-31823922 TTAACAATTTTTTTCTTTTATGG - Intergenic
1178460027 21:32794552-32794574 TTTACAACTTGTTTTTTTCTGGG - Intronic
1178640486 21:34341364-34341386 TGAACACCTGTTTTGATTGTAGG - Intergenic
1178710888 21:34915643-34915665 TTAACATATTTGTTGTTTCTTGG + Intronic
1179147633 21:38782391-38782413 TTCACAACATTTCTGTTTGCTGG - Intergenic
1179589981 21:42401060-42401082 TCATCAACTTTTTCTTTTGTTGG + Intergenic
1180126606 21:45794946-45794968 TTAACAAATTCTCTGTTTCTAGG - Intronic
1180744891 22:18080628-18080650 TTAAAAACTTTGTTATTTTTTGG - Intronic
1180906943 22:19420519-19420541 GTCAAAACTTTTTTGTTTTTTGG - Intronic
1181564360 22:23725578-23725600 ATTACAATTTTTGTGTTTGTAGG + Intergenic
1184077414 22:42190851-42190873 TTACGAACTTTCTTTTTTGTGGG - Intronic
1184621307 22:45680623-45680645 TTAAAAATTTTTTTTTTTTTTGG + Intronic
1185134329 22:49060669-49060691 TTGCTAACTTTTTTGTGTGTGGG + Intergenic
949115626 3:318076-318098 TTCACAACTTTTTTGGAGGTGGG + Intronic
949479081 3:4476369-4476391 TTAAAAACATTTTTTTTTTTAGG - Intergenic
949486017 3:4539257-4539279 TTTACAACTTAGTTGTGTGTTGG + Intronic
949658742 3:6252583-6252605 TTACCAATTTTTTTATTAGTCGG - Intergenic
951229993 3:20167063-20167085 GTCACAATTTTTTTGTGTGTTGG - Intronic
951486453 3:23217101-23217123 ATTGCAACTTTATTGTTTGTTGG + Intronic
951564033 3:23994725-23994747 TTTGCAACTTTTTTGGTTGCTGG + Intergenic
951678963 3:25274634-25274656 ATAACAACTATTTTTTTTGTAGG + Intronic
951738387 3:25893188-25893210 TTAATAACTTTTTTTTTAGATGG - Intergenic
951869144 3:27340956-27340978 TTAAAAATTCATTTGTTTGTTGG - Intronic
952756909 3:36877430-36877452 TTAAGAAATTTCTTGTTTGAAGG - Intronic
953515491 3:43587099-43587121 TTATCAAATTTTTTTTTGGTTGG - Intronic
953773093 3:45793714-45793736 TAAACAAATTCTTTGTTTGCTGG + Intronic
954474294 3:50729321-50729343 TAAACAACTTTTTTTTTTTTTGG - Intronic
954774229 3:53001751-53001773 TTTACAATTTTTTTTTTTTTTGG - Intronic
955830035 3:62991521-62991543 TTAAGAGCTTTTTTGGTGGTGGG + Intergenic
956019002 3:64913612-64913634 TTAATAACTCTTTCATTTGTTGG - Intergenic
956052986 3:65268525-65268547 TTAATCACTGTTTTGTTTGAGGG - Intergenic
956637888 3:71384245-71384267 TTAACAGCCTGTTTGTTTGTTGG - Intronic
956825039 3:72989896-72989918 CTTGCAACTTGTTTGTTTGTTGG + Intronic
956884325 3:73543807-73543829 TGAACACCCTTTTTGCTTGTTGG - Intronic
956957673 3:74359227-74359249 AAAAGAATTTTTTTGTTTGTTGG - Intronic
957063102 3:75498246-75498268 TTAGTAACTTTTTTTTTTGTTGG - Intergenic
957669208 3:83279438-83279460 TTAAAAAGTTTTTGTTTTGTTGG + Intergenic
957783005 3:84844087-84844109 TTAAGAACTTTTGTGTTTCATGG + Intergenic
957835478 3:85582966-85582988 TAAACACCTTTTTTCTTTTTTGG - Intronic
957980673 3:87505772-87505794 TTCACAACTTTTCTGTAAGTTGG - Intergenic
959223633 3:103553964-103553986 TTACCAGTTTTTTTGTTTTTAGG + Intergenic
959383409 3:105670915-105670937 TTAACATCATTGTTGTTAGTTGG + Intronic
959689536 3:109183552-109183574 TAAACATCTTTTTTTTTTCTGGG - Intergenic
959693766 3:109227294-109227316 ATTACAACTTTTTTTTTTTTTGG - Intergenic
959751117 3:109836780-109836802 TCAACAACTTTTTTCTCTGCTGG - Intergenic
959947532 3:112142239-112142261 TTGACAACTTTTTTATTCATTGG - Intronic
959982668 3:112534345-112534367 TTAACAATTTTTTTTTTTTTTGG - Intronic
960291072 3:115885613-115885635 TAAACAACTTTTGTGTGTGTGGG + Intronic
960384991 3:117012156-117012178 TGAACAACTTTTTTTTTTTCAGG + Intronic
960505746 3:118491276-118491298 TTAGAAACTTTTTTTTTTGTGGG - Intergenic
961234036 3:125348258-125348280 TTAACTAATTTTTTTTTTCTTGG - Intronic
962092552 3:132260290-132260312 TTGTCAACTTTTGTCTTTGTTGG - Intronic
962499872 3:135980445-135980467 TTACCAACTTTTTTTTTTTTTGG - Intronic
962663496 3:137629425-137629447 TTAAGAACTTTTGTGATTCTTGG - Intergenic
962707416 3:138058412-138058434 TTGACTACTTTTTTGTGTTTTGG - Intergenic
962810324 3:138954215-138954237 AAAACAGCTTTTTTGTTTTTTGG + Intergenic
962869952 3:139480069-139480091 TTAAGAGCTTTTTGGTTTTTTGG - Intronic
963195045 3:142517822-142517844 TTAATAAGTTCTTTGTTTTTGGG - Intronic
963573770 3:147032885-147032907 TTTACAAATTTTCTGTTAGTAGG - Intergenic
963600742 3:147377099-147377121 TTAACAACTTTTTTTTTGAAAGG + Intergenic
963666425 3:148193626-148193648 TTAACAAGTTTTTTCACTGTTGG - Intergenic
964199623 3:154104038-154104060 TTATCAACTTTTTTTTTTTTTGG + Intergenic
964606397 3:158564966-158564988 TTTTCAACTTTTATGTTCGTGGG + Intergenic
965016197 3:163160453-163160475 TTAATAACTTTTTTCTTGTTTGG + Intergenic
965048583 3:163612939-163612961 TTAATAACTTATCTGTTTTTTGG - Intergenic
965412368 3:168348162-168348184 CTAATAACTTTTTTGTCAGTTGG + Intergenic
965780827 3:172284238-172284260 TTAACAACCTCTTAGTTTGTGGG - Intronic
966169864 3:177067265-177067287 TTAGCAACTATTTTATTTTTAGG + Intronic
966313728 3:178623095-178623117 TTAATCATTTTTTTGTGTGTAGG - Intronic
968168283 3:196486766-196486788 TTAACAACTTTTTTATATGTAGG - Intronic
968796282 4:2707124-2707146 CCAACAACTTTTTTTTTTGTGGG - Intronic
969727406 4:8929072-8929094 CTAACAGGTTTTTTGTTTGCAGG + Intergenic
969850593 4:9953609-9953631 TTTAGGAGTTTTTTGTTTGTTGG + Intronic
969992790 4:11281449-11281471 TTAACTAATTTTTTCTTAGTTGG - Intergenic
970271281 4:14350646-14350668 TTAACAAGTGTCTTGTTGGTAGG + Intergenic
970363081 4:15329761-15329783 TAAACAATTTTTTTTTTTTTTGG - Intergenic
970622761 4:17841878-17841900 GAAACAACTTTTTTTTTTCTTGG - Intronic
970843090 4:20499143-20499165 TTGAGCATTTTTTTGTTTGTTGG + Intronic
971441390 4:26691391-26691413 TTCACAAAATATTTGTTTGTTGG - Intronic
971513252 4:27454513-27454535 TTAATACCTTTTTTTTTTTTTGG + Intergenic
971889359 4:32497542-32497564 ATAAAAACTATTTAGTTTGTAGG + Intergenic
972435468 4:39030004-39030026 TTTTGAACATTTTTGTTTGTTGG + Intronic
972624909 4:40787675-40787697 TTAAAAACTTTTTGTCTTGTGGG - Intronic
972930824 4:44069993-44070015 TTAACAAGTTTTATCTTTTTAGG - Intergenic
972991705 4:44828577-44828599 TTTACTACTTTTTTCTTTGGAGG + Intergenic
973339453 4:48988455-48988477 TTAACTTTTTTTTTTTTTGTAGG + Exonic
973557849 4:52104022-52104044 TTAACAAATGTTTTGGATGTAGG + Intergenic
973760908 4:54114803-54114825 TTAACAATATTTTTTTTTTTTGG + Intronic
973932995 4:55811944-55811966 ATAACAAGTTTTTTGTTTTTTGG - Intergenic
974710189 4:65581989-65582011 TCAACATCTTTTGTCTTTGTTGG + Intronic
974767205 4:66362285-66362307 TTAATAATTTTTTATTTTGTGGG + Intergenic
974863813 4:67555516-67555538 GTAATAACTTTTTTTTTTGTGGG + Intergenic
974933122 4:68382776-68382798 TTAATAATTTTTTTTTTTTTGGG - Intergenic
975406927 4:74000225-74000247 TTAACAACTTTTATTTTGGAAGG + Intergenic
975871367 4:78782288-78782310 TTAACAACCTTAGTGTTTCTAGG - Intronic
975929286 4:79499231-79499253 TGAACACCTTTTTTTCTTGTCGG - Intergenic
975949029 4:79745717-79745739 TTGGAAACTTTTATGTTTGTAGG - Intergenic
976054498 4:81047548-81047570 TCAGCAACTTTTTTTTTTTTTGG - Intronic
976319615 4:83698851-83698873 TTAAAAAGTTTTTTTTGTGTTGG + Intergenic
976368931 4:84264796-84264818 TTGAGACTTTTTTTGTTTGTTGG - Intergenic
976898550 4:90142619-90142641 TTTACCACTTTTTTTTTTTTTGG + Intronic
976932790 4:90589313-90589335 TTTATAATTTTTTTGTTTATAGG + Intronic
977180134 4:93864187-93864209 TTATCCACTTCTTTGTTGGTGGG - Intergenic
977293704 4:95190489-95190511 TAAAAAAATTTTTTTTTTGTCGG + Intronic
977360383 4:95996513-95996535 TTAGCAACTTTTTTTTTTGGTGG - Intergenic
977784549 4:101017305-101017327 TTATCAGATTTTTTGTGTGTAGG + Intergenic
977812336 4:101371273-101371295 TAAAAAATTTTTTTGTGTGTGGG + Intergenic
977980258 4:103312937-103312959 TAAAAAACTTTTATGTTTGGAGG - Intergenic
978968812 4:114776601-114776623 TTAACTGCTTTTTTTTTTTTTGG + Intergenic
978971379 4:114811015-114811037 TGAACAATTTTTATGTTTTTTGG - Intergenic
979143976 4:117217240-117217262 TGAATAACTTTTTTGATTTTGGG + Intergenic
979724744 4:123947168-123947190 TAACCAACTTTTCTCTTTGTTGG + Intergenic
979911183 4:126367608-126367630 TAAACTACTTTGTTGCTTGTAGG - Intergenic
980430950 4:132694352-132694374 TTGATCACTTTTTTGTGTGTGGG - Intergenic
980923276 4:139109174-139109196 CTAACAACATTTTAGTTTCTTGG + Intronic
981042605 4:140237239-140237261 TTAACAAGTTTTTTTTTTCCTGG - Intergenic
981185633 4:141799487-141799509 TTAAAAAAATTTTTTTTTGTAGG + Intergenic
981217385 4:142186512-142186534 TTCTCAACATTTGTGTTTGTGGG + Intronic
981339188 4:143600647-143600669 TTCACAACTTTTATATTTGAAGG - Intronic
981350091 4:143719711-143719733 TTTACTGTTTTTTTGTTTGTTGG - Intergenic
981465504 4:145066475-145066497 TTAAGAACTTTTTTTTTTTAAGG + Intronic
981849516 4:149213000-149213022 TGAGCAACTTTTTTTTTTTTTGG + Intergenic
982018241 4:151177042-151177064 CTTACAACTTTTTTGGTTGATGG - Intronic
982187269 4:152815345-152815367 TCAACAACTTTTTTCTATGAAGG - Intronic
982377166 4:154705662-154705684 TTAAAGACTTTTTTTATTGTTGG + Intronic
982749901 4:159148063-159148085 CTAAGAACTGTTTTGTTTTTAGG + Intronic
982900817 4:161001347-161001369 TCCACAACTTTATTCTTTGTAGG - Intergenic
983744528 4:171180977-171180999 TTAAATACTTTTTTCTTGGTGGG + Intergenic
983758360 4:171371389-171371411 TTTAAAATGTTTTTGTTTGTGGG - Intergenic
984005886 4:174307587-174307609 TTATCAACTTTTGCTTTTGTTGG - Intronic
984051626 4:174871772-174871794 TTAAAAACATTTGTGTATGTTGG + Intronic
984514686 4:180723784-180723806 TTAACAGATCTTTTGTTTTTAGG + Intergenic
984769278 4:183423426-183423448 TTAACAATTTTTTTTTGTGGTGG + Intergenic
985093536 4:186389088-186389110 TTATCAATTTTTGTTTTTGTTGG - Intergenic
986294766 5:6428901-6428923 TTAGCACTTTTTTTGTGTGTTGG + Intergenic
986800598 5:11256217-11256239 TTATCAACTTTTTTGTCATTAGG - Intronic
986835141 5:11628773-11628795 TTAACCACTCTTTTTTTTTTTGG - Intronic
987763353 5:22193627-22193649 TTTGAAACTTTTTTCTTTGTAGG + Intronic
987768733 5:22271497-22271519 TTAAGAACATTTGTGTTTTTTGG - Intronic
988568346 5:32339349-32339371 TTAACAACTTTTACTTTTGGTGG + Intergenic
989003482 5:36784570-36784592 TTAACCACTTTTTTGTTCCATGG - Intergenic
990813950 5:59761933-59761955 TTAATTACTCTTGTGTTTGTGGG - Intronic
990998796 5:61761231-61761253 TTAAAAACTTTTAAGTTTGGGGG - Intergenic
991201033 5:63992884-63992906 TTATAAACTTTATTGTTTCTGGG - Intergenic
991313013 5:65266532-65266554 TTAACAACTTTGGTCTGTGTAGG + Intronic
991424019 5:66472285-66472307 TTTAAAAGTTTTTTTTTTGTTGG + Intergenic
991680869 5:69138148-69138170 TTTTTAAGTTTTTTGTTTGTTGG + Intergenic
991898069 5:71426713-71426735 TTTGAAACTTTTTTCTTTGTAGG + Intergenic
992041086 5:72833524-72833546 TTAATAAATTTTTATTTTGTGGG + Intronic
992192008 5:74302128-74302150 TGGACAACATTTTTGTTTGACGG - Intergenic
992278506 5:75147333-75147355 TTACCAAATTTTGTGTTTTTGGG + Exonic
992457669 5:76930982-76931004 TTAACAGCTTTTTTGCCTGAAGG + Intergenic
992576225 5:78116473-78116495 TTTAAAACTTTTGTGTTTTTTGG + Intronic
992842807 5:80712760-80712782 TTTGCATCTTTTTTTTTTGTTGG + Intronic
992925329 5:81578903-81578925 TTAACAATTTTTTTTCTTTTTGG + Intronic
992991354 5:82286904-82286926 TGATTAACTTCTTTGTTTGTTGG + Intronic
993175072 5:84473161-84473183 TTAATAACTTTGTTTTTTCTAGG - Intergenic
993753383 5:91698338-91698360 TTCACATTTTTCTTGTTTGTGGG + Intergenic
994292002 5:98038476-98038498 TTAAAAATATTTTTGTTTGTTGG - Intergenic
994344395 5:98667986-98668008 AAAACAACTTTTTCTTTTGTTGG - Intergenic
994448803 5:99913146-99913168 TTGTTTACTTTTTTGTTTGTTGG - Intergenic
994671414 5:102765956-102765978 TGAACATCTTTTTTTTTTATGGG + Intronic
994850180 5:105044900-105044922 TTTAGAACTTTTTTTTTTGGGGG + Intergenic
995003982 5:107168835-107168857 TTAACATTTTTTTTTTTTTTTGG - Intergenic
995079150 5:108026878-108026900 TTAATAACATTTCAGTTTGTAGG - Intronic
995101919 5:108321677-108321699 TTTACCACTTTTTTGTTTTTTGG - Intronic
995303985 5:110621856-110621878 TTAACAACACTTTTGTAGGTGGG - Intronic
995322661 5:110854566-110854588 TTAATAAATTTTTTTTTTCTGGG - Intergenic
996880469 5:128291235-128291257 GTCATAGCTTTTTTGTTTGTTGG - Intronic
997768545 5:136529872-136529894 TTATCCAATGTTTTGTTTGTTGG + Intergenic
998067175 5:139169153-139169175 TTAAAAACATTTTTGTTTAGAGG - Intronic
998570936 5:143257075-143257097 TGAACAATTTTTTTCTATGTAGG - Intergenic
998985256 5:147749887-147749909 TTATAAATGTTTTTGTTTGTTGG + Intronic
999166744 5:149555821-149555843 TTTAAAACTTTTTTTTTTCTTGG + Intronic
999173522 5:149615593-149615615 TTAAGAACATTTTTTTTGGTCGG + Intronic
999469570 5:151840743-151840765 TTAAAGACTGGTTTGTTTGTGGG - Intronic
999579768 5:153024752-153024774 TTAAAAATTTTTATTTTTGTAGG - Intergenic
999874912 5:155793412-155793434 TTAAAAACTTTTTTTTATTTTGG - Intergenic
1000832145 5:166116003-166116025 TTAACAACTTTATTTTTTTCTGG + Intergenic
1001896621 5:175387939-175387961 GAAACTAATTTTTTGTTTGTGGG + Intergenic
1001967233 5:175919555-175919577 TTATCAACTTTTTCTTTTATGGG - Intronic
1002281638 5:178133708-178133730 TCAACAATTTTTTTTTTTTTTGG + Intronic
1002870602 6:1164149-1164171 TTACCAATTTTTTTGCTGGTGGG - Intergenic
1004100910 6:12610378-12610400 TTATCAACTTTTTTCTTTTGGGG - Intergenic
1004225555 6:13781350-13781372 TTTACAGGTTTTTTGTTTTTTGG - Intergenic
1004515583 6:16319887-16319909 CAAACCACATTTTTGTTTGTGGG - Intronic
1005051873 6:21692062-21692084 TTAAAGACTTTTTTTTTTTTTGG + Intergenic
1005188264 6:23187355-23187377 TTTGTAACTTTTTTCTTTGTTGG - Intergenic
1005281134 6:24275799-24275821 TTAACAACATTTGTGTTGGTGGG - Intronic
1005320101 6:24645194-24645216 ATCAAAACATTTTTGTTTGTCGG - Intronic
1006080347 6:31561690-31561712 TTAATAATTTTTTTTTTTTTTGG - Intergenic
1007056092 6:38886359-38886381 TTACTAACTGTTTTGGTTGTTGG - Intronic
1008086130 6:47246310-47246332 TTAGCAACTATTTTCTGTGTTGG - Intronic
1008449204 6:51630566-51630588 TAAACAACTTTTGTCTATGTGGG - Intronic
1008655707 6:53611399-53611421 CTAACATCTTGTTTGTTTGGGGG + Intronic
1008790309 6:55223773-55223795 ATAACTACTTTTTTTTTTCTAGG - Intronic
1009662264 6:66629831-66629853 TTAACAATTTTATGGTTTATAGG - Intergenic
1009859607 6:69310017-69310039 TACACAACTTTTATGTTTGTGGG + Intronic
1009894950 6:69736438-69736460 GGATCAACTTTTTTGTGTGTTGG - Intronic
1010196384 6:73243594-73243616 TTAATAACTATTTTGTTTCCAGG - Intronic
1012171576 6:96023181-96023203 TGAACATTGTTTTTGTTTGTTGG + Intronic
1012297176 6:97539441-97539463 TTATTATCTTTTTTATTTGTAGG + Intergenic
1012362486 6:98400428-98400450 TTCACATTTTTTATGTTTGTAGG + Intergenic
1014020634 6:116584611-116584633 TTAATAACCTTTTTCTTTGTAGG + Intronic
1014722440 6:124934384-124934406 TTGACAGCCTTTTTGTGTGTGGG - Intergenic
1015825827 6:137310616-137310638 TTAGCAACTTTTTTTTCCGTGGG - Intergenic
1016114958 6:140269763-140269785 ATAGCAATTTATTTGTTTGTTGG - Intergenic
1017132491 6:151119608-151119630 TTAAAAACATTTTTTTTTTTTGG - Intergenic
1017312765 6:152993126-152993148 TTTAAAACTTTTTTGCTTTTTGG + Intronic
1017366515 6:153647787-153647809 ATAACAACATTTTTGAGTGTGGG - Intergenic
1017419137 6:154254849-154254871 TTAACAACATTTTTATTTTGCGG + Intronic
1018065775 6:160124374-160124396 TAAACAACTTTTTTTTTTTTAGG - Intronic
1018546278 6:164940192-164940214 CTTACAACTTTTCTGTTTGTTGG - Intergenic
1020270807 7:6594309-6594331 TTAACATCTTTTTTTTGTCTTGG + Intronic
1020342291 7:7124947-7124969 TTAGAAACTTTTTTCTTTGATGG - Intergenic
1020478351 7:8626012-8626034 GTAACTACTTTTTTGTTTGTTGG + Intronic
1021182324 7:17521286-17521308 TTAATCACTTTTTTTTTTCTTGG - Intergenic
1021521295 7:21542059-21542081 TCAACAATTTTTTTCTTTGCAGG - Intergenic
1021704633 7:23354678-23354700 TTAAAAAGATTTTTCTTTGTGGG + Intronic
1021718018 7:23477782-23477804 TTTAATACTTTTTTATTTGTAGG + Intergenic
1021981678 7:26061697-26061719 TTAACAAAGTTTTTTTTTATAGG - Intergenic
1022361006 7:29657210-29657232 TTACCAACTTGTATGTTTTTAGG - Intergenic
1022421036 7:30223589-30223611 TTAACATATTTTTTCTTTTTTGG - Intergenic
1022444845 7:30461476-30461498 TTAATAAATTTTTTGTTGATGGG - Intronic
1023022889 7:36026741-36026763 TAAACAATTTTTTTTTTTTTTGG - Intergenic
1023396456 7:39756168-39756190 TTAAAAACTTAATTGTTGGTGGG + Intergenic
1023432249 7:40106401-40106423 TAAATAAGTTTATTGTTTGTAGG - Intergenic
1024412254 7:49058417-49058439 TTTATAGGTTTTTTGTTTGTTGG + Intergenic
1024681983 7:51699929-51699951 TTAACATTTTTTTTTTTTGCAGG - Intergenic
1024742439 7:52369233-52369255 ATAACAAATTTTTTTTTTGCTGG - Intergenic
1025630740 7:63270439-63270461 TTACAAATTTTTTTTTTTGTGGG - Intergenic
1026352859 7:69532772-69532794 TTAAAAAAATTTTTTTTTGTAGG - Intergenic
1026548790 7:71348828-71348850 TAAACAACCTTTGTGTTTCTAGG + Intronic
1026656916 7:72264685-72264707 TTAACAACTTTTAAGTTTAGGGG + Intronic
1027225241 7:76239531-76239553 TTAAAAAAATTTTTTTTTGTAGG - Intronic
1028446672 7:90932379-90932401 TTAACAATTATTTTGTTAATTGG - Intronic
1029820740 7:103144086-103144108 TTAACAACTTTATTGCTTTATGG - Intronic
1029835926 7:103309869-103309891 TTTGCAACTTTTTTGTAAGTTGG + Intronic
1030297320 7:107941994-107942016 TGAAAAACTTTTTTTTTTTTTGG + Intronic
1030902065 7:115136979-115137001 TAAACATTTTTTTTGTGTGTGGG + Intergenic
1031686707 7:124739000-124739022 TTGTTAACTTTTTTGTCTGTTGG + Intergenic
1031946058 7:127841737-127841759 TTAAAAACCTTTTTGTTGGAGGG + Intronic
1032242813 7:130178249-130178271 TTAATAACTTTATTTTGTGTAGG - Intronic
1032815039 7:135464652-135464674 TTAAAAACTTTTAGGTTTGGGGG - Intronic
1033927670 7:146483606-146483628 TTAAAAACTTTTTTTATTCTTGG - Intronic
1034044741 7:147915992-147916014 TTAACTACTTTTTAATATGTGGG + Intronic
1034356605 7:150455156-150455178 TTGACCAGTTTTTTGTTTTTTGG - Intronic
1034669054 7:152843197-152843219 TTATCAACTTTTTTCTTTTATGG + Intronic
1035856720 8:2983695-2983717 TTAAAAACTATTGTGCTTGTAGG - Intronic
1036216964 8:6888803-6888825 ATAACAACCTTTTTGTTGGCCGG + Intergenic
1037066154 8:14580537-14580559 ATTACAATTTATTTGTTTGTTGG - Intronic
1037215007 8:16438672-16438694 TTCACAATTGTTTTGGTTGTTGG - Intronic
1037646593 8:20798041-20798063 ATAGCTGCTTTTTTGTTTGTTGG + Intergenic
1040440057 8:47431654-47431676 TTGTCTACTTTTTTGTTTTTGGG + Intronic
1041975423 8:63794148-63794170 TTAATAACTATTTAGGTTGTTGG + Intergenic
1042112506 8:65395679-65395701 TTATCTACTTATTTGTTTATTGG - Intergenic
1042322080 8:67486865-67486887 TTAACAATTTTTTTTTTTTTTGG + Intronic
1042352394 8:67790544-67790566 TTAACAATTTTTTTTTTTGACGG + Intergenic
1042971274 8:74411718-74411740 TTAGCAATTTTTTTTTTTTTTGG - Intronic
1043413866 8:80028984-80029006 TTTTCTACTTTTTTGTTTTTTGG - Intronic
1043963612 8:86446495-86446517 TTATCAATTTTTGTTTTTGTTGG + Intronic
1044152024 8:88791827-88791849 TTCAAAACTGTTTTGTTTCTTGG - Intergenic
1044259977 8:90107515-90107537 TTAATAATTTTTTTGTCTGCTGG + Intergenic
1044460132 8:92434524-92434546 TGAACAATTTTTTTTTTTTTTGG - Intergenic
1044511803 8:93089873-93089895 ATAACAATTTTTTTTTTTTTTGG - Intergenic
1045576448 8:103426329-103426351 TTAACAGTTTTTTTTTTTTTTGG + Intronic
1045717244 8:105062418-105062440 ATGACAACTTTTTTGTGTGTGGG - Intronic
1045853027 8:106725877-106725899 TTTACTACTTTTTTGTTACTGGG + Intronic
1046221023 8:111214960-111214982 TCAACCACTTTTTCATTTGTGGG + Intergenic
1046280410 8:112021978-112022000 TTAGCAAGTTTTTTTTTTGGGGG - Intergenic
1046746408 8:117880904-117880926 TTATGAACTCTTTTGTTTGTTGG + Intronic
1046980868 8:120335278-120335300 TGAACAAGTGTTTTATTTGTGGG - Intronic
1047360930 8:124168714-124168736 TTATGAAATTTTCTGTTTGTAGG - Intergenic
1047970171 8:130077702-130077724 TTGACTACTTTTTGTTTTGTTGG - Intronic
1048106593 8:131417772-131417794 TCAACATATTTTTTTTTTGTAGG - Intergenic
1048624524 8:136170518-136170540 TTATCAATTTTTTTCTTTTTTGG + Intergenic
1048635711 8:136292998-136293020 TTAATAACATTTATGTTTGGAGG - Intergenic
1048673554 8:136750880-136750902 TTAGCAAGGGTTTTGTTTGTTGG + Intergenic
1049025590 8:139986257-139986279 TTGACAGTTTTTTTGTTTTTTGG - Intronic
1049142717 8:140970901-140970923 TAAGCAAGTTTTTTGTTTTTTGG - Intronic
1049869658 8:144964700-144964722 TTATTAATTTTTTTCTTTGTTGG + Intergenic
1050372573 9:4936674-4936696 TTAAAAACTATTTTTTTTCTGGG - Intergenic
1050646200 9:7722151-7722173 TTAACAACTTTATTGATTCTAGG - Intergenic
1050742323 9:8836410-8836432 TTAAAAACTTTTTTATTTTTAGG - Intronic
1051323470 9:15936888-15936910 TTGACAACTTTTTTTTTAGGTGG + Intronic
1051661665 9:19432907-19432929 TTAACAATTTTTTTCTATGAAGG - Intronic
1051828188 9:21245452-21245474 TTATCATTTTTTTTGTGTGTTGG + Intergenic
1054841211 9:69742543-69742565 TTAAAAACTTTTTGTCTTGTAGG + Intronic
1054846357 9:69802693-69802715 TTAAGTAATTTTTTATTTGTTGG - Intergenic
1055128575 9:72748985-72749007 TTCACAACTATTTTATTTGGAGG - Intronic
1055607439 9:77985324-77985346 CTACAAACTCTTTTGTTTGTTGG - Intronic
1055669942 9:78594752-78594774 ATAGCAACCTTTTTGTCTGTAGG - Intergenic
1056537941 9:87547155-87547177 TCTACAATTTTTTTGTTTTTTGG - Intronic
1057138007 9:92708009-92708031 GAAACAACTTTTGGGTTTGTTGG + Intergenic
1059618487 9:115977034-115977056 TTTAAAACTTTTTTTTTAGTAGG + Intergenic
1060046884 9:120348605-120348627 TTTACAACTTTATTGCTTGGTGG - Intergenic
1060702984 9:125775356-125775378 TTAAAAACTTTTATGGTTTTAGG + Intronic
1186037131 X:5436412-5436434 TAAGCAAATTTTTTGATTGTGGG + Intergenic
1186202988 X:7172794-7172816 TTACCAATTTTGTTATTTGTAGG - Intergenic
1186635899 X:11404594-11404616 TTAAAAAGTTTTGTGTTTGTGGG + Intronic
1187769100 X:22675601-22675623 TAAAGTACTATTTTGTTTGTTGG + Intergenic
1188076071 X:25776462-25776484 ATACCAACTTTTGTCTTTGTGGG + Intergenic
1188562739 X:31488181-31488203 TTAACAACATTATTGTCAGTAGG - Intronic
1188815474 X:34707248-34707270 TTAAACACTTTTTTCTTTTTTGG + Intergenic
1189151223 X:38709106-38709128 ATCATAACTTTTTTATTTGTTGG - Intergenic
1189427518 X:40914572-40914594 TTAACAACTATTTTGCATCTTGG + Intergenic
1189821913 X:44877211-44877233 TGAAAGAATTTTTTGTTTGTAGG + Intronic
1190292991 X:49005324-49005346 TTAACAACTTTTTTGGGTGAGGG + Intergenic
1190543338 X:51499877-51499899 TTAATAACATTTTTGATAGTAGG - Intergenic
1190599176 X:52071849-52071871 TTTAAAACTTTTATGTTTGGGGG + Intergenic
1190609648 X:52182224-52182246 TTTAAAACTTTTATGTTTGGGGG - Intergenic
1192293308 X:69820620-69820642 TGAACATTTTTTATGTTTGTTGG - Intronic
1193479118 X:82005067-82005089 TGAGCAATTTTTATGTTTGTTGG + Intergenic
1193571238 X:83147246-83147268 TTAACAGTTTTTTTTTTTGTTGG + Intergenic
1194088080 X:89553437-89553459 TGTGCAACTTTTTTGGTTGTGGG - Intergenic
1194775646 X:97960630-97960652 TTAACAACTTTTTTTTTTTTTGG - Intergenic
1194998709 X:100620876-100620898 TTATCAATTTTTTTCTTTGATGG - Intergenic
1195074510 X:101313437-101313459 TTAAAAACTTTTTTTTTTCATGG - Intergenic
1195444065 X:104930984-104931006 GGATCAACTTTTCTGTTTGTCGG - Intronic
1195483121 X:105370999-105371021 TGATCATCTTTTATGTTTGTTGG + Intronic
1195604412 X:106786580-106786602 GTATCAACTTTTTTCTTTTTTGG - Intronic
1196539725 X:116893456-116893478 TTAAAAACTCTATTTTTTGTAGG - Intergenic
1196562341 X:117165263-117165285 TTAAGATCTTTTTTTTTTTTTGG - Intergenic
1197011770 X:121572548-121572570 CTTCCAACTTTTTTTTTTGTTGG - Intergenic
1197163728 X:123352479-123352501 TTTACTAATTGTTTGTTTGTGGG - Intronic
1197175028 X:123476606-123476628 ATTACAGCTTTTATGTTTGTTGG + Intronic
1197467873 X:126827879-126827901 TTATCAACTTATATGTTTATTGG - Intergenic
1197899218 X:131351644-131351666 TTATCTACTTTTTTGGTTTTAGG - Intronic
1198742801 X:139858663-139858685 ATAATATCTTTTTTGTTGGTTGG - Intronic
1198995939 X:142574246-142574268 TTGAGAATTTTTATGTTTGTTGG - Intergenic
1200148110 X:153937407-153937429 TTACCTGTTTTTTTGTTTGTTGG + Intronic
1200440537 Y:3207343-3207365 TGTGCAACTTTTTTGGTTGTGGG + Intergenic
1201266211 Y:12209756-12209778 TTGACAACTTTTTTCTTACTTGG + Intergenic
1201567155 Y:15377620-15377642 TTGATAAGTTGTTTGTTTGTAGG - Intergenic
1201773291 Y:17639382-17639404 TTAACATTTTTTTTTTTTTTTGG - Intergenic
1201828264 Y:18266604-18266626 TTAACATTTTTTTTTTTTTTTGG + Intergenic
1201913876 Y:19161507-19161529 TTATGAACTTTTTAGTTGGTAGG - Intergenic
1201964940 Y:19722087-19722109 CTCTCAGCTTTTTTGTTTGTTGG - Intronic
1202585688 Y:26424214-26424236 TTACCAACTCTTTTTTTTCTGGG - Intergenic