ID: 1165014907

View in Genome Browser
Species Human (GRCh38)
Location 19:32873785-32873807
Sequence CTGCTGATTTTGGGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165014901_1165014907 11 Left 1165014901 19:32873751-32873773 CCACGGTGGCCACACATGATGAA No data
Right 1165014907 19:32873785-32873807 CTGCTGATTTTGGGGAAAGAGGG No data
1165014902_1165014907 2 Left 1165014902 19:32873760-32873782 CCACACATGATGAAAGTTGTGAT No data
Right 1165014907 19:32873785-32873807 CTGCTGATTTTGGGGAAAGAGGG No data
1165014900_1165014907 24 Left 1165014900 19:32873738-32873760 CCTCTTTTCTCAACCACGGTGGC No data
Right 1165014907 19:32873785-32873807 CTGCTGATTTTGGGGAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165014907 Original CRISPR CTGCTGATTTTGGGGAAAGA GGG Intergenic
No off target data available for this crispr