ID: 1165015903

View in Genome Browser
Species Human (GRCh38)
Location 19:32879825-32879847
Sequence GGTCACAGTGGACAAGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165015903_1165015908 5 Left 1165015903 19:32879825-32879847 CCGTCTGCTTGTCCACTGTGACC 0: 1
1: 0
2: 1
3: 24
4: 249
Right 1165015908 19:32879853-32879875 AGCACTCAGTGACCTTCCACAGG 0: 1
1: 0
2: 1
3: 14
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165015903 Original CRISPR GGTCACAGTGGACAAGCAGA CGG (reversed) Intronic
900868662 1:5286435-5286457 AGTCACAGTGGGCCAGCAGAGGG + Intergenic
901415133 1:9111227-9111249 GGGCACAGCGGCCATGCAGAGGG + Intronic
902400393 1:16154061-16154083 GGACACAGGGGACAAGGACAAGG + Intronic
904026635 1:27508026-27508048 GGTTCCAGTGGACAAGTGGAGGG - Intergenic
904054398 1:27660475-27660497 GCTCCCTGAGGACAAGCAGAGGG - Intergenic
904269048 1:29337177-29337199 GGGCCCATTGGACAAGCATAGGG - Intergenic
904584137 1:31569802-31569824 GAGCATAATGGACAAGCAGAGGG - Intergenic
905004152 1:34696862-34696884 GGTCGCAGTGGCCAAGAAGAAGG - Intergenic
905608366 1:39325607-39325629 GGTCCCAGTGGACATGCAAGAGG + Intronic
906168585 1:43706051-43706073 GGTCAAAGTGGACAAGGATGGGG + Intronic
906960010 1:50414526-50414548 GGTCCCGCTGGACTAGCAGATGG - Intergenic
907469814 1:54665970-54665992 GAACACAGTGGACAACTAGAAGG - Intronic
908860475 1:68480985-68481007 GGTCATCGTGGACAAGAAGTTGG - Intronic
910529332 1:88217628-88217650 GGTATCATTTGACAAGCAGATGG - Intergenic
910772279 1:90842375-90842397 GGTCCCAATGCAAAAGCAGAAGG + Intergenic
912383614 1:109260623-109260645 GGTAAATGTGCACAAGCAGATGG - Intronic
913182775 1:116338243-116338265 AGTCTCAGTAGAGAAGCAGAAGG + Intergenic
913594437 1:120359782-120359804 TGTCACAGTGTACACACAGATGG - Intergenic
914092825 1:144519202-144519224 TGTCACAGTGTACACACAGATGG + Intergenic
914305703 1:146414671-146414693 TGTCACAGTGTACACACAGATGG - Intergenic
914596352 1:149158135-149158157 TGTCACAGTGTACACACAGATGG + Intergenic
916091063 1:161308360-161308382 GGCCACAGTGGCCAAGAGGAAGG - Intronic
916541461 1:165759570-165759592 GTTTACAGTGGAAAAGAAGAAGG - Exonic
919742733 1:200990519-200990541 GGTGTCAGAGGACAGGCAGAGGG + Intronic
919831097 1:201540409-201540431 GTTCACTGTGCAAAAGCAGAGGG + Intergenic
920076830 1:203343324-203343346 TGTCAAAGAGGACAACCAGAGGG - Intronic
921463511 1:215457592-215457614 GGTCACAGTCAAAATGCAGATGG - Intergenic
923170676 1:231414186-231414208 GGGCACAGTGGAAAAGAAGGTGG + Intronic
924721565 1:246627779-246627801 GGTGACAGTGGAAATGGAGAGGG + Intronic
1063542015 10:6943431-6943453 GGTCACAGTGGTCAGGCAAGTGG + Intergenic
1064223117 10:13458726-13458748 GGTCCCAGGGGACAAGCAGAGGG + Intronic
1066477674 10:35763806-35763828 GGTAACAGTGGAAAAGCTGGGGG + Intergenic
1066695044 10:38069775-38069797 GGTCACAGGGGAGAAGGAGATGG + Intergenic
1066997468 10:42577404-42577426 GGTCACAGGGGAGAAGGAGACGG - Intronic
1067762082 10:49056110-49056132 GGGCACTGTGGACAGGGAGATGG - Intronic
1068044596 10:51870417-51870439 GGACAAAATGGCCAAGCAGATGG - Intronic
1069566498 10:69466875-69466897 TGTCACAGTGGAGAGGCAGTTGG + Intronic
1070278214 10:75028682-75028704 GGTAACAGTGGAAGAACAGAAGG + Exonic
1072564073 10:96602880-96602902 GGGGACTGTGGAGAAGCAGAAGG + Intronic
1073028780 10:100508226-100508248 GGTATCAGTGTAGAAGCAGAGGG + Intronic
1075514782 10:123100200-123100222 AATCATAGTGGCCAAGCAGATGG - Intergenic
1076148522 10:128144549-128144571 GGCCACTGTGCAAAAGCAGAAGG + Intergenic
1077189916 11:1251624-1251646 GGACACAGTGGACACGCTGAAGG - Exonic
1078938891 11:15978029-15978051 AGTTTCAGTGCACAAGCAGAGGG - Intronic
1080940821 11:36915730-36915752 GGACACAGGGGAGAAGAAGATGG + Intergenic
1081986518 11:47308760-47308782 GGTCACACTGAACAAGTAGCTGG + Intronic
1083664684 11:64268086-64268108 GGGCAGAGGGCACAAGCAGAAGG - Intronic
1083765930 11:64841712-64841734 GGTCACCGTGGTGAGGCAGAGGG - Exonic
1085055231 11:73399334-73399356 GGTCACAGTGGCAGAGCTGAGGG - Intergenic
1085414237 11:76309771-76309793 GGTGACAGGCGACATGCAGAAGG - Intergenic
1085822414 11:79806813-79806835 GGTCACAGATGAAAACCAGACGG + Intergenic
1087113509 11:94497402-94497424 GGTGGAAGTGGCCAAGCAGAGGG - Intronic
1088957050 11:114622431-114622453 GGTAACAGTGGTTACGCAGAAGG - Intergenic
1088972182 11:114783311-114783333 GGGAACAGTAGAGAAGCAGATGG - Intergenic
1089543750 11:119206561-119206583 GGGGACGGTGGACAAGAAGATGG + Exonic
1089971553 11:122697648-122697670 ATTCACATTGGACAAGAAGATGG - Intronic
1091044653 11:132314803-132314825 GGTATCAGTGGACATGGAGAGGG + Intronic
1091640836 12:2235851-2235873 GTACACAGTGGGCAGGCAGATGG - Intronic
1096644220 12:53020519-53020541 GGGCAGTGTTGACAAGCAGAAGG - Intronic
1097188083 12:57206261-57206283 GGTCACAGTGGATCAGCTCAGGG + Intronic
1097226063 12:57477425-57477447 GGGGACAGTGGAGAAGCAGGAGG + Intronic
1099677558 12:85781904-85781926 GGCTACATTGGACCAGCAGATGG - Intergenic
1103638363 12:122328018-122328040 GGACACAGAGGACAAGCTGAAGG - Exonic
1103915393 12:124373259-124373281 GGGCACAGTGGACAATCATGAGG + Intronic
1103915403 12:124373303-124373325 GGGCACAGTGGACAATCATGAGG + Intronic
1103915414 12:124373348-124373370 GGGCACAGTGGACAATCATGAGG + Intronic
1103915425 12:124373393-124373415 GGGCACAGTGGACAATCACGAGG + Intronic
1103915494 12:124373648-124373670 GGGCACAGTGGACAATCATGAGG + Intronic
1103915505 12:124373693-124373715 GGGCACAGTGGACAATCATGAGG + Intronic
1103915516 12:124373738-124373760 GGGCACAGTGGACAATCATGAGG + Intronic
1104965336 12:132506450-132506472 AGTCAGAGGGGACAGGCAGAGGG - Intronic
1105999248 13:25704270-25704292 GGCCACGCTGGACAAGCAGATGG - Intronic
1106679600 13:31996647-31996669 GCTCACACTGGAAGAGCAGATGG + Intergenic
1109513550 13:63410482-63410504 GGTCCCAGTTTACATGCAGAGGG + Intergenic
1112419853 13:99238449-99238471 GGGCACTGGGGACCAGCAGAAGG - Exonic
1117071259 14:52058798-52058820 GGTCACAATGGCCAAGCACATGG - Intronic
1120451955 14:84680014-84680036 GAGCACAGTTTACAAGCAGAAGG + Intergenic
1120501149 14:85298862-85298884 GGTGACAGTGGACAGGAAGCAGG - Intergenic
1121904642 14:97728495-97728517 GCTCACAGCTGACAAGCAGCAGG - Intergenic
1125095243 15:35842849-35842871 GGTCACAGTAGAGAAGCAGCAGG + Intergenic
1125926194 15:43565153-43565175 AGTCACAGTGGGCAAGCAAAAGG + Intronic
1125939338 15:43664704-43664726 AGTCACAGTGGGCAAGCAAAAGG + Intronic
1129467811 15:75733694-75733716 GGTCACAGTGGACTGTCATATGG - Intergenic
1129719406 15:77869892-77869914 GGTCACAGTGGACTGTCATATGG + Intergenic
1130031320 15:80317048-80317070 GGTCACAGTGAATTAGCAGGTGG + Intergenic
1130459518 15:84150859-84150881 GGTCACAGTGGACTGTCATATGG - Intergenic
1132700934 16:1221850-1221872 GGACACAGGAGACTAGCAGAAGG + Exonic
1132956292 16:2595829-2595851 GGGCCCAGTGGATAAGCGGAAGG + Exonic
1133475889 16:6121560-6121582 AGGCACAGTGTACAAGCAAATGG - Intronic
1133833397 16:9344985-9345007 GGGAACAGTGGAAAAGCAGAAGG + Intergenic
1135425377 16:22330593-22330615 AGTCTCACTGGAGAAGCAGAGGG - Intronic
1136013300 16:27378827-27378849 GGACACAGTGGCCAGGAAGAGGG - Intergenic
1136144173 16:28306071-28306093 AGTCACAGTGACCTAGCAGATGG - Intronic
1136296822 16:29308719-29308741 GGGCAGAGGGGACAGGCAGAGGG - Intergenic
1137821227 16:51447965-51447987 GGGCACAGTGGATAAGGACAAGG + Intergenic
1140523653 16:75603875-75603897 GGTCACTGTGTCCAAGCTGAGGG - Intronic
1142236502 16:88924992-88925014 GGTCACCGTGGCCAAGCCCAGGG + Intronic
1143282325 17:5764279-5764301 GGTCACAGTGGAATAGATGATGG - Intergenic
1143485675 17:7252304-7252326 GGTCACAGTGAAAATGTAGACGG + Exonic
1143737103 17:8919416-8919438 AGTCACAGTGGACTAGCGCAAGG + Intronic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147947159 17:44086666-44086688 GGGCACAGTGGCCAGGCTGAGGG + Exonic
1148235743 17:45967896-45967918 GGTCATGATGGACAAGCTGATGG - Intronic
1149394386 17:56224638-56224660 GGTTACAGATGACAACCAGATGG + Intronic
1150468693 17:65417306-65417328 GGTCAAAGTGGGCCAGCAGGAGG + Intergenic
1150606915 17:66699840-66699862 GGGCACAGTGGCCCAGCAAAGGG - Intronic
1151190467 17:72394359-72394381 GGGCAAAGTGGTGAAGCAGAAGG - Intergenic
1151784182 17:76266929-76266951 AGTCACAGAGGACAAGTAGAGGG + Intronic
1151816411 17:76473561-76473583 GGTGACGGTGGAGGAGCAGAGGG + Intronic
1151999281 17:77635262-77635284 GGTCACAGTGGCCCAGGAGCTGG + Intergenic
1153092000 18:1357790-1357812 GGTGACTGTGGAAAGGCAGATGG - Intergenic
1154974269 18:21441964-21441986 GGTCAAAGTGGACAAGGTCAGGG + Intronic
1155815374 18:30301401-30301423 AGTAAGAGAGGACAAGCAGATGG - Intergenic
1156144291 18:34157700-34157722 GGTCAGAGAGCACAAGAAGATGG + Intronic
1156536662 18:37870997-37871019 GGTCAGAGTGGACAAGGACCTGG + Intergenic
1157645645 18:49266892-49266914 GCTTACAGTGGAAAAGCAGAAGG + Intronic
1157933120 18:51845069-51845091 GGACAGTGTGGCCAAGCAGATGG - Intergenic
1158121976 18:54058512-54058534 GGTTAGAGTGGAAAAACAGATGG - Intergenic
1161613807 19:5258361-5258383 ACTCACAGTGGAAAAGCAGCTGG + Intronic
1162873023 19:13600111-13600133 GCTCACAGAGGGCAAGGAGAAGG + Intronic
1165015903 19:32879825-32879847 GGTCACAGTGGACAAGCAGACGG - Intronic
1165151738 19:33764615-33764637 GGTCACAGTTTACAAGCACAGGG - Intronic
1166254981 19:41597522-41597544 GGTCACAGATGCCAACCAGAAGG - Intronic
1167566866 19:50262117-50262139 GGCCACACCGGACAAGCAGGTGG + Intronic
1167608257 19:50493202-50493224 GGTCACAGAGGAGAGGTAGAAGG + Intergenic
1167732969 19:51272311-51272333 GATCAGAATGGAAAAGCAGAGGG + Intergenic
1168020660 19:53606610-53606632 GGTCACAGTGCCCAAGGGGATGG + Intergenic
925603127 2:5629136-5629158 TGTCACAGTGTACACACAGATGG - Intergenic
927107294 2:19839168-19839190 GGTCACAATGGAGAATGAGAAGG - Intergenic
927966392 2:27272334-27272356 GGTTACATTGGATCAGCAGACGG + Intronic
927997146 2:27494565-27494587 GGTCACAGCTGACCAGCAGGAGG + Exonic
928366237 2:30705695-30705717 GGTGGCAGGGGAGAAGCAGAGGG - Intergenic
929605775 2:43233163-43233185 GGTGACACTGGAGGAGCAGAGGG - Intronic
929953834 2:46439992-46440014 GGTCTCAGGGGAAATGCAGAGGG + Intronic
931067829 2:58606785-58606807 AGTGACTGTGGAAAAGCAGAGGG + Intergenic
932180526 2:69642884-69642906 GGTCACAGTGGACGAGGTGTTGG - Exonic
932750834 2:74370729-74370751 GGCCACTTTGGACAAGGAGATGG - Exonic
934058665 2:88274045-88274067 GGACACAGTGGATACGCAAAAGG + Intergenic
935574610 2:104695863-104695885 GGTCACAGTGCAAAAGAGGATGG + Intergenic
936757277 2:115730289-115730311 GGTCTTAGTGGCTAAGCAGATGG + Intronic
936966855 2:118135381-118135403 GGGCACAGAGGAAAAGGAGAAGG - Intergenic
937144057 2:119627186-119627208 GGTCTCAGTGGAGTGGCAGACGG - Intronic
937547292 2:123038107-123038129 GTTCAAAGTGGAAAAGCAAATGG + Intergenic
938604509 2:132878368-132878390 GTTCACAGTTGGCAACCAGAGGG - Intronic
941166235 2:162086110-162086132 GGTCATAGTGGAGGAGCAGAGGG + Intergenic
941714329 2:168748242-168748264 GGTTACAGTCAACAAGCTGAAGG - Intronic
942460472 2:176164855-176164877 GGTGGCAGTGGAAAAGCTGAGGG - Intronic
942731748 2:179067610-179067632 GGTCACATGGGAAAAGCAGGAGG - Intergenic
943622046 2:190159267-190159289 GGTGACAGTGGTGGAGCAGAAGG + Intronic
944082143 2:195799872-195799894 TGTCACTGTGGAAAAGAAGAAGG + Intronic
945646002 2:212495281-212495303 GGGCACAGAGGAAAAGCACATGG - Intronic
947671434 2:231938970-231938992 AGTCACTGTGGCCAAGGAGATGG + Intergenic
948314418 2:237016141-237016163 GGCCACAGAGGACAAGAAGGAGG + Intergenic
1169136849 20:3202996-3203018 GCTCTCAGTGTCCAAGCAGAGGG - Intronic
1170778740 20:19404409-19404431 GGTAAAAGTGGAAAAGCAAATGG + Intronic
1172857237 20:38014802-38014824 GCTGACAGTGAACAAGGAGAAGG + Intronic
1173432065 20:42997178-42997200 AGTCACAGTGTAGAAGCAAATGG - Intronic
1173537022 20:43823267-43823289 GTTCACACTGGAGAAGCTGAGGG + Intergenic
1173857360 20:46258867-46258889 GGTCCCAGGGGCCAAGAAGAGGG + Intronic
1174088727 20:48029459-48029481 GGTCACTGTGCACTGGCAGAGGG - Intergenic
1174857722 20:54063048-54063070 GTTCACAGTTGGCAAGAAGATGG + Intronic
1177287018 21:19064858-19064880 GCTCACAGTGGAGAAGCAGGTGG - Intergenic
1177363916 21:20109159-20109181 GGTCAGAGTGCACAAAGAGAGGG + Intergenic
1180709142 22:17827986-17828008 GGTCACACTGAATGAGCAGAAGG - Intronic
1184289167 22:43489153-43489175 GGTCTCACTGGACATGGAGAGGG + Intronic
1184853831 22:47135948-47135970 GGTCACTGTGGCCGAGTAGATGG + Intronic
1185222506 22:49636103-49636125 GGTCCCAGTGCAGAAGCAGGTGG - Intronic
1185310845 22:50153452-50153474 GGTCACAGCAGACAAGCACTGGG + Intronic
951280419 3:20742129-20742151 GGTTAGAGTGGGAAAGCAGAGGG - Intergenic
953094229 3:39759092-39759114 GGTCACAGTGGCTAAGCAGCTGG - Intergenic
954420730 3:50417732-50417754 GGTGCCAGAGGACAAGCAGCAGG - Intronic
954898442 3:53997250-53997272 GGTGCCAGTGGAAAAGGAGACGG - Intergenic
955577923 3:60386878-60386900 GCTCAGAGTGGACAAGCAACTGG + Intronic
955937100 3:64112478-64112500 GGGTACAATGGACAAGAAGATGG + Intronic
959958106 3:112262956-112262978 GATCAGAGTAGGCAAGCAGAAGG + Exonic
960316295 3:116181748-116181770 GGTCACAGTGGCAATGAAGATGG - Intronic
962199798 3:133391849-133391871 GGTCACAATGAAAAAGCACAGGG - Intronic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
964264810 3:154882859-154882881 TTTCACAGTAGAGAAGCAGAGGG + Intergenic
965353109 3:167640194-167640216 TGTCACAGGGGAGAAGGAGATGG - Intronic
968545597 4:1196106-1196128 GTTCACAGGGGAGAGGCAGAGGG - Intronic
969297143 4:6276875-6276897 GGTGACAGTGGCCAAGGAGCAGG - Intronic
969401899 4:6961367-6961389 GGTCACAGTTGACAAGAATGGGG - Intronic
975798634 4:78035524-78035546 GGTCACAGTGGGAAAGAGGAAGG + Intergenic
978540118 4:109807606-109807628 GGACACAGTGGACAACTAGAAGG - Intergenic
980278934 4:130692913-130692935 GGTCAAAATGGACAAGTTGAGGG - Intergenic
981661123 4:147167715-147167737 AGACACAGTGGATAAACAGAAGG - Intergenic
983491575 4:168396434-168396456 GAGCACAGTGGAAAAGCAAAGGG + Intronic
984634160 4:182092949-182092971 GCACACAGTGGACAAGGAGTGGG - Intergenic
984883076 4:184427261-184427283 GGTCACAGGAAATAAGCAGATGG + Intronic
985472805 5:56267-56289 AGTGACAGTTGACAAGCAAAAGG + Intergenic
985501677 5:251629-251651 GGTCACAGTGATCCAGAAGATGG - Intronic
985559529 5:575891-575913 GGTCACAGTGCACAGGCACGTGG + Intergenic
986762911 5:10896502-10896524 GGTCAAAGAGGAAAAGCAGATGG + Intergenic
989383273 5:40830134-40830156 GGACAGAGTTGAAAAGCAGATGG + Exonic
990319148 5:54612717-54612739 GGTGACAGTGGAGAAGGAAAAGG - Intergenic
990717064 5:58649167-58649189 GCTCCCAGTGGACCAGCAGGTGG - Intronic
992388666 5:76310505-76310527 GGTCAGAGTGGACAATAAAAGGG + Intronic
993092963 5:83449875-83449897 GGTTACAGTGGACCAGAGGATGG - Intergenic
995071682 5:107930000-107930022 GGTGACAGTGGCCATGGAGATGG - Intronic
996035087 5:118750116-118750138 GGTAACTGTGGATAGGCAGATGG - Intergenic
998546851 5:143036196-143036218 GGTCAGAGTGGAAAAGAAAATGG - Intronic
999266717 5:150271318-150271340 GGTCAAAGAGGATCAGCAGAGGG - Intronic
1001661334 5:173395774-173395796 TGTCAGAGAGGACAAGGAGAGGG - Intergenic
1001987734 5:176089877-176089899 GGTGACATTAGAAAAGCAGATGG - Intronic
1002229133 5:177748263-177748285 GGTGACATTAGAAAAGCAGATGG + Intronic
1002254602 5:177949872-177949894 GGCCCCCGTGGACCAGCAGAGGG + Intergenic
1002266210 5:178035510-178035532 GGTGACATTAGAAAAGCAGATGG - Intronic
1002483390 5:179517940-179517962 GGCCCCCGTGGACCAGCAGAGGG - Intergenic
1002583579 5:180226445-180226467 GGACATTGTGGCCAAGCAGATGG - Intergenic
1004427220 6:15514483-15514505 GCCCACCATGGACAAGCAGAGGG - Intronic
1005834379 6:29696724-29696746 GGTCTCAGAGAACCAGCAGAGGG - Intergenic
1006608334 6:35275927-35275949 AGTCACAGTGAATTAGCAGAAGG + Intronic
1006615157 6:35321230-35321252 AGTCACGGTGGGCAAGCAGAGGG - Exonic
1006803537 6:36774550-36774572 GTTCCCAGTGGAGGAGCAGATGG - Intronic
1007486806 6:42186032-42186054 GCTCACAGTGGAAATGCAAATGG - Intronic
1009578250 6:65494923-65494945 AGTCCCAGTGGACAAGGTGATGG + Exonic
1009651310 6:66480724-66480746 GGAAACACTGGACAACCAGAGGG - Intergenic
1010815285 6:80351536-80351558 AGTCACAGTGGCCAAGGAGATGG - Intergenic
1013816877 6:114109424-114109446 GGTCCCACTGAACAGGCAGATGG - Intronic
1014005368 6:116411805-116411827 GGTTATAGTAGAAAAGCAGAAGG - Intronic
1014268760 6:119312670-119312692 GGTCACAGTGGATAAGCCTGAGG + Intronic
1014284139 6:119477360-119477382 AGTCACAGTTTACAAGTAGATGG - Intergenic
1014308518 6:119770656-119770678 GGCCCCAGTGGACTATCAGAGGG + Intergenic
1015356650 6:132285286-132285308 GTTCTCAGTGGAAAAGCACAAGG - Intergenic
1016986805 6:149901317-149901339 GGTCACAGTGGGAGAGCAGTGGG + Intergenic
1019074427 6:169376637-169376659 GGCCACAGTGGAGAGGAAGATGG - Intergenic
1019957057 7:4423961-4423983 GGCCACCATGGACAAGCAGAGGG + Intergenic
1021944613 7:25714471-25714493 GATCACAGTGGCCAATAAGATGG - Intergenic
1022025212 7:26441936-26441958 TATCACAGTGGCTAAGCAGATGG + Intergenic
1022493301 7:30837219-30837241 GGTCACAGGGGACCAGGAGCAGG + Intronic
1028487773 7:91378749-91378771 GTGCTCAGAGGACAAGCAGAGGG - Intergenic
1028668625 7:93375461-93375483 AGTCACAGTTGGGAAGCAGAAGG - Intergenic
1032838262 7:135693634-135693656 GGTCCCTGTGGAAAAGCTGATGG + Intronic
1033859106 7:145603048-145603070 GGTCACAATGGAAAAGCTGGTGG - Intergenic
1035561212 8:604952-604974 GGTCTCTGTGCACAAGCAGTGGG - Intergenic
1036703740 8:11031278-11031300 GGTCACTGTGGATTAGGAGATGG - Intronic
1038432508 8:27511503-27511525 GGTCACACTGGACACCCAGCTGG + Intronic
1039272659 8:35899797-35899819 GGTAACAGTGGACAGGAGGAAGG + Intergenic
1039626493 8:39059824-39059846 GGTGACAGTAGAAAAGAAGACGG - Intronic
1039785207 8:40828800-40828822 GGTCACTTTAGACAACCAGAGGG + Intronic
1039954202 8:42194941-42194963 GATCACAGAGGAGAGGCAGATGG - Intronic
1042105857 8:65325777-65325799 GGCCACAGTGGCCAAGCACCAGG + Intergenic
1047462508 8:125080529-125080551 GGACAAAGTAGACAAGGAGAAGG - Intronic
1048280351 8:133101231-133101253 GGGCACAGTGGACAACCAAGTGG + Intronic
1048849337 8:138629618-138629640 GGTCAATGTGGAATAGCAGAGGG + Intronic
1051155047 9:14133580-14133602 GTTCCCAGAGGACAAGGAGAAGG + Intronic
1051823040 9:21191193-21191215 GGCCACAGTGGCAAAGCAGCAGG + Intergenic
1051824868 9:21209728-21209750 GGCCACAGTGGCAAAGCAGCAGG + Intronic
1051826864 9:21231805-21231827 GGCCACAGTGGCAAAGCAGCAGG + Intronic
1052074738 9:24127349-24127371 GGTGAAAGTGGCAAAGCAGAAGG - Intergenic
1053203756 9:36169739-36169761 GGTCACAGTGGACCAGCTTCTGG + Exonic
1053271859 9:36755527-36755549 GGGCACTGTGGAAAAACAGAGGG + Intergenic
1057429993 9:94984943-94984965 GTTCACAGTAGACATTCAGAGGG + Intronic
1058871012 9:109201757-109201779 GGTCTCAGTGGAAGAGCAGAGGG + Intronic
1059315731 9:113424412-113424434 GTTCAGAGTGGAAAGGCAGAAGG - Intronic
1059584411 9:115590624-115590646 GGGTACAGGGGACAAGGAGATGG - Intergenic
1060413628 9:123415787-123415809 GGGCACAGTGGACACGCTGCTGG + Intronic
1060888187 9:127170828-127170850 GGTCAAAGTGGACAAACCCAGGG + Intronic
1061743686 9:132724849-132724871 TGCCACATTGGACAGGCAGATGG + Intergenic
1062331747 9:136047948-136047970 GGTCACATTGGAGCAGCAGGGGG + Intronic
1187018040 X:15350155-15350177 GCTCACAGGGGCAAAGCAGAAGG - Intronic
1188010316 X:25048372-25048394 GGCCACAGTGGAACAGCAAAAGG + Intergenic
1192602989 X:72484694-72484716 GTTCAGAGTGGACAAGTAGTTGG + Intronic
1193352114 X:80475452-80475474 GACCACAGAGGGCAAGCAGAAGG - Intergenic
1198257619 X:134938343-134938365 ATTCACAGTGGCCAATCAGAAGG + Intergenic
1198639133 X:138736907-138736929 AGTAATTGTGGACAAGCAGAGGG + Intronic
1198788558 X:140317395-140317417 TGTGACAGTGGACAAGCCAATGG - Intergenic
1200138991 X:153888233-153888255 GGGCATCGTGGTCAAGCAGAAGG - Intronic
1200210536 X:154344996-154345018 GGTCACAGAGGACAGCCAGCAGG - Intergenic
1200220316 X:154387096-154387118 GGTCACAGAGGACAGCCAGCAGG + Intergenic
1200692076 Y:6316428-6316450 GGGCACAGTGTACATGGAGATGG + Intergenic
1200713638 Y:6512511-6512533 GGGCACAGTGTACATGGAGATGG - Intergenic
1201020289 Y:9649530-9649552 GGGCACAGTGTACATGGAGATGG + Intergenic
1201043196 Y:9858299-9858321 GGGCACAGTGTACATGGAGATGG - Intergenic