ID: 1165016293

View in Genome Browser
Species Human (GRCh38)
Location 19:32882653-32882675
Sequence TTAGGTTACCAGTTGATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165016293_1165016296 -4 Left 1165016293 19:32882653-32882675 CCCTGCATCAACTGGTAACCTAA 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1165016296 19:32882672-32882694 CTAAGAACTAATGCTGCCACTGG 0: 1
1: 0
2: 1
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165016293 Original CRISPR TTAGGTTACCAGTTGATGCA GGG (reversed) Intronic
904407871 1:30305265-30305287 TGTGGTCACCAGATGATGCAGGG - Intergenic
909353461 1:74680308-74680330 TTAGGTTATAAGTAGATTCATGG + Intergenic
910782844 1:90959692-90959714 TTACTTTACCAGGTGATGGAAGG + Intronic
913659649 1:120994858-120994880 TGTGGTCACCAGATGATGCAAGG + Intergenic
914011010 1:143777982-143778004 TGTGGTCACCAGATGATGCAAGG + Intergenic
914166820 1:145183125-145183147 TGTGGTCACCAGATGATGCAAGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
914649630 1:149686637-149686659 TGTGGTCACCAGATGATGCAAGG + Intergenic
1065918473 10:30371076-30371098 TCAGGGTAGCAGATGATGCAGGG + Intronic
1068911706 10:62385211-62385233 TTAGGTTAGCAGTTTGTGCCAGG + Intronic
1075293766 10:121254166-121254188 TGAGGTCACCAGTTGCTGGAAGG - Intergenic
1076262849 10:129082882-129082904 TTATGTTACAAAATGATGCATGG - Intergenic
1080014638 11:27491573-27491595 TTAGGTTGTCAGTTACTGCATGG - Intergenic
1082722678 11:56697446-56697468 TTAGGTTAGCAGTTGCTGTTGGG - Intergenic
1084606120 11:70173050-70173072 TTTGGTCACCAGTGGATGCTGGG - Intronic
1087543606 11:99553374-99553396 TTAGGTTCCTACTAGATGCAAGG - Intronic
1087733612 11:101806796-101806818 TTAGATTTCCAGTTGCTGGATGG + Intronic
1089241472 11:117084961-117084983 TTTGTTAACCTGTTGATGCAGGG - Intronic
1091643268 12:2253722-2253744 GTAGGTTACCAGTGGATGGACGG - Intronic
1091975038 12:4817513-4817535 TTAGGGTACCAGGTGAAGCCAGG - Intronic
1094253418 12:28393641-28393663 TTAGTTTACTACTTGCTGCAAGG + Intronic
1098374720 12:69802814-69802836 TTAGGTGACCATTTGTTGGAGGG + Intronic
1101401123 12:104387997-104388019 TTACCTTACCATTTGATGAAGGG + Intergenic
1107791365 13:44005399-44005421 TCGGGTTACCTGTTGAGGCAAGG - Intergenic
1108246032 13:48515196-48515218 CTAGGTTACCTGTTGTTGCAAGG + Exonic
1110281554 13:73699559-73699581 TTTGGTTACCAGGTGAAGTATGG - Intronic
1114767919 14:25395436-25395458 TGAGGTTTCCTGTTGCTGCAAGG + Intergenic
1120443656 14:84566926-84566948 TTAGGTTTCCACTTCATGGAAGG - Intergenic
1121499770 14:94425459-94425481 GTAGGTTATCAGTAGATGGAGGG + Intergenic
1129029337 15:72607297-72607319 TTAGGGTAGCAGATGATGCAGGG - Intergenic
1132649987 16:1016264-1016286 CAAGGTCACCAGTTGATACACGG - Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1141602244 16:85133893-85133915 TTAGGTTCCCAGTGGGTGAAAGG - Intergenic
1142227179 16:88883227-88883249 TGAGGTTACCCATTGATTCACGG - Intronic
1156235256 18:35197065-35197087 TTAGATTGCCAGTTGATGCTCGG - Intergenic
1156565090 18:38178993-38179015 TTAAGATACCACTTGATGAATGG + Intergenic
1158881553 18:61783886-61783908 TTAGGCTACCATTTCATCCATGG - Intergenic
1161272698 19:3398752-3398774 TTATGTAACCAGTTTATGCAAGG + Intronic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
930105265 2:47634256-47634278 TTAGGTTGCTAGTTGATCCTGGG - Intergenic
930764218 2:55068300-55068322 TGATGTTACTAGATGATGCATGG - Intronic
943508244 2:188789977-188789999 TTAGCTTAACAACTGATGCAGGG + Exonic
945619670 2:212119109-212119131 TTTATTTAACAGTTGATGCATGG - Intronic
1170237496 20:14123481-14123503 CTAGGTGACCAGGTGAAGCATGG - Intronic
1180227736 21:46406038-46406060 TTAGGTTTCCAGTTATTTCAAGG + Intronic
1184946142 22:47805482-47805504 TTAGGTGACTGGTTGTTGCATGG + Intergenic
951076568 3:18400853-18400875 TTAAGTTACAAGTTGGTACAAGG + Intronic
955042456 3:55331355-55331377 TTACCTTACCAGTTGTTGTAAGG - Intergenic
956309025 3:67858739-67858761 TTTGGGTACCAGTTTGTGCAAGG + Intergenic
957833655 3:85555704-85555726 TTAGGTTGCCATTTGTTCCAAGG + Intronic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
961907556 3:130278053-130278075 TTAGGCTACCAATTGAATCATGG - Intergenic
967122526 3:186395775-186395797 ACAGGTAACCAGTAGATGCAGGG - Intergenic
971201110 4:24509854-24509876 AAATGTTAACAGTTGATGCAGGG + Intergenic
975461765 4:74661671-74661693 TTATGTTACCAGTAGAACCATGG - Intergenic
976213103 4:82691770-82691792 TTAGGAAACCAGCTGGTGCAAGG - Intronic
976851513 4:89552192-89552214 TTAGAATACCAGTTGAGTCAAGG + Intergenic
979149694 4:117295173-117295195 TTTCCATACCAGTTGATGCAAGG + Intergenic
981941791 4:150288813-150288835 TTAAGTTACCATTTCATGGATGG + Intronic
985768400 5:1794145-1794167 CTTGGTTACCATTTGTTGCAGGG + Intergenic
988895640 5:35670806-35670828 TTAGGTGACCAGTTCATTAAGGG + Intronic
993603241 5:89954850-89954872 TTAGGTTTCCAATTAATTCAAGG + Intergenic
994922857 5:106072932-106072954 TCAGTTGACCAGTTAATGCAAGG + Intergenic
996579411 5:125014613-125014635 TTAGGTTACCTGTCCATCCAGGG + Intergenic
998055057 5:139067717-139067739 TTAGGATGCCGGTTGCTGCAAGG - Intronic
1000153253 5:158524463-158524485 TTTGGTTGGCAGATGATGCAAGG + Intergenic
1014832294 6:126117022-126117044 CTAGGCTACCAGTTGATCCTGGG - Intergenic
1016461226 6:144282304-144282326 TTGGGTTACCAGTAGACCCAGGG + Intergenic
1017422370 6:154285866-154285888 TTATGTTACCAAGTGATTCAAGG - Intronic
1018183534 6:161245045-161245067 ATAAGTTGCCAGTTGGTGCACGG - Intronic
1019175170 6:170155722-170155744 CTAGGTGAGCAGTGGATGCAGGG + Intergenic
1021459774 7:20873038-20873060 TCAAGTTCCCAGATGATGCAGGG + Intergenic
1022839730 7:34151716-34151738 TTTAGTTAACAGTTGAGGCAGGG + Intronic
1027894321 7:84021641-84021663 TTAGTTTACAAGATGATGGAGGG - Intronic
1030582781 7:111380827-111380849 TAAGGTTAGCAGTTTATGCCTGG - Intronic
1031472399 7:122182547-122182569 TTAAGTTAGCAGGTGATGAATGG - Intergenic
1043982754 8:86659857-86659879 TCAGGTTAGCAGATGATGCAGGG + Intronic
1048700376 8:137082017-137082039 TCTGGTTACCAGGGGATGCAAGG - Intergenic
1050494115 9:6221700-6221722 AGAGGTTACTAGTTGCTGCATGG - Intronic
1056372310 9:85968770-85968792 TTAGATTACTAGTTGGGGCAAGG - Intronic
1061064244 9:128267469-128267491 TCAGGTTAGCAGACGATGCAGGG + Exonic
1190536810 X:51437067-51437089 TGAGGTTACAAGATCATGCATGG - Intergenic
1193563132 X:83044505-83044527 TTAGGTTTCCTGTTCTTGCAGGG + Intergenic
1195675168 X:107502391-107502413 TGAGGAAACCAGTTGTTGCAGGG + Intergenic
1198928500 X:141825800-141825822 ATTGGTCACCAGGTGATGCAGGG + Intergenic