ID: 1165016296

View in Genome Browser
Species Human (GRCh38)
Location 19:32882672-32882694
Sequence CTAAGAACTAATGCTGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165016291_1165016296 12 Left 1165016291 19:32882637-32882659 CCAGGACAACTCTTATCCCTGCA 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1165016296 19:32882672-32882694 CTAAGAACTAATGCTGCCACTGG 0: 1
1: 0
2: 1
3: 7
4: 91
1165016293_1165016296 -4 Left 1165016293 19:32882653-32882675 CCCTGCATCAACTGGTAACCTAA 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1165016296 19:32882672-32882694 CTAAGAACTAATGCTGCCACTGG 0: 1
1: 0
2: 1
3: 7
4: 91
1165016294_1165016296 -5 Left 1165016294 19:32882654-32882676 CCTGCATCAACTGGTAACCTAAG No data
Right 1165016296 19:32882672-32882694 CTAAGAACTAATGCTGCCACTGG 0: 1
1: 0
2: 1
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165016296 Original CRISPR CTAAGAACTAATGCTGCCAC TGG Intronic
901366033 1:8749313-8749335 CTGAGAATTATTCCTGCCACTGG + Intronic
906223843 1:44104662-44104684 CTAAGAGCTGATGCAGGCACTGG + Intergenic
909402129 1:75245562-75245584 GAAAGAACTAATGCTTTCACAGG + Intronic
910037806 1:82809274-82809296 GTAAGAACTAGTGCTGCAGCAGG - Intergenic
910651920 1:89578004-89578026 CTAAGAAATAAAGTTGCAACTGG - Intronic
916080515 1:161229239-161229261 CTCAGAACTGGAGCTGCCACAGG + Exonic
916318055 1:163472320-163472342 TTAAGAAAAAATGCTGGCACGGG + Intergenic
918825061 1:189313680-189313702 CTAAGAAATAAATCTGGCACAGG + Intergenic
919527246 1:198668803-198668825 CTAAAGACTAATCCTTCCACAGG - Intronic
919698439 1:200605344-200605366 CAAAGAGCTACTGCTGCTACTGG - Exonic
922609164 1:226911588-226911610 CTAAGAACTAACTCTGGCTCAGG - Intronic
1067809821 10:49417959-49417981 CCAAGGACCAACGCTGCCACAGG - Intergenic
1078779400 11:14422633-14422655 CTGAGAACGAGTGCTGCCCCTGG - Intergenic
1082063548 11:47880808-47880830 CTAAGAGCTAAAGCTGCCCTGGG + Intergenic
1084658304 11:70532174-70532196 CTGAGAACAGCTGCTGCCACAGG - Intronic
1088369833 11:109076991-109077013 CAAAGAACTAAAGCTCCTACAGG - Intergenic
1090729811 11:129560354-129560376 CAATGATCTAATGCTGCCAGTGG - Intergenic
1096378780 12:51137600-51137622 CCTAGTACTAATGATGCCACAGG - Intronic
1101135790 12:101741730-101741752 CTAAGAATGAATGCTGAGACAGG - Intronic
1102943491 12:116964257-116964279 CTCAGAACTAATGGTCTCACAGG - Intronic
1105842339 13:24265639-24265661 CCAAGAACCAAGGCTGCCACGGG - Intronic
1110578200 13:77085071-77085093 ATAAGAACTAATGCTGACACTGG + Intronic
1112094222 13:96114689-96114711 CTAATAGCTAATACTGGCACAGG - Intronic
1114812818 14:25920172-25920194 CTAAAAAGTAATGCTACCTCTGG + Intergenic
1120022276 14:79544192-79544214 CTAAGTAGTAATGGTGCCTCAGG + Intronic
1123953674 15:25311414-25311436 CCAAGATCTCATGTTGCCACGGG + Intergenic
1124347012 15:28929778-28929800 ATAAGAACTGATGCTGGCAGTGG - Intronic
1125039583 15:35169312-35169334 CCCAAAACTAAAGCTGCCACAGG + Intergenic
1130373604 15:83308479-83308501 TTAAAAAATAATGCTGCCATTGG + Intergenic
1131902651 15:97105040-97105062 CTAAGAACCAAGGGAGCCACTGG - Intergenic
1132892621 16:2211711-2211733 CTCAGAAGTAATGCTGGCCCGGG - Exonic
1132916787 16:2352454-2352476 CTAGAAAATAATGTTGCCACTGG + Intergenic
1133115784 16:3577267-3577289 CTGAGAACTCAGGCTGGCACAGG - Exonic
1135413528 16:22252247-22252269 CTGAAAAATAATGCTGCCACAGG + Intronic
1135801273 16:25499037-25499059 CTCAGAAATATTGCTGTCACTGG + Intergenic
1138079235 16:54072909-54072931 TTAAGAACTAGTCCAGCCACAGG - Intronic
1149962142 17:61122546-61122568 CTGAGTACTAATGCTCACACGGG - Intronic
1151852554 17:76699623-76699645 CTAAGAACCGAGGGTGCCACTGG + Intronic
1152018452 17:77767718-77767740 CCAAGAACCAATGGTGGCACTGG + Intergenic
1153063854 18:1022699-1022721 CTAATAACTAGTCCTGCCAAGGG - Intergenic
1156330673 18:36118690-36118712 CCAAAAACTAATGGAGCCACTGG + Intronic
1158855303 18:61538208-61538230 CAAAGAACTGATGATTCCACAGG + Intronic
1165016296 19:32882672-32882694 CTAAGAACTAATGCTGCCACTGG + Intronic
925283097 2:2698475-2698497 TTAAAAACAGATGCTGCCACGGG - Intergenic
926999062 2:18773243-18773265 TTAAGATCTGATGCTGCCAATGG + Intergenic
931466679 2:62494322-62494344 CTAAAAACTATTGCTCCCAGTGG - Intergenic
940780728 2:157930981-157931003 CTAATAAATAATGCTGGCAATGG + Intronic
941416850 2:165231612-165231634 CTGAGAACTAAGGGGGCCACTGG + Intergenic
942156104 2:173129420-173129442 CTAAGAAAAAATGCTGCCAATGG + Intronic
942455982 2:176138736-176138758 ATAAGAATTAATGCTACCACGGG - Intergenic
944492261 2:200269441-200269463 CTAAGAACTGTTGATGCCCCAGG - Intergenic
944888510 2:204090845-204090867 CTATTAACTGATGCTGCTACTGG - Intergenic
945921457 2:215759242-215759264 CTAAGCACTAATGAAGACACAGG + Intergenic
946477260 2:220019217-220019239 CTAACATCTAATGCTCCCAGAGG + Intergenic
1171118521 20:22548207-22548229 CTGAGGATCAATGCTGCCACCGG - Intergenic
1177499948 21:21941284-21941306 CTAAGAGAAAATGCTGCCAGAGG + Intergenic
1178295597 21:31407474-31407496 CCAAGCACTACTGCTACCACTGG + Intronic
1178883053 21:36463795-36463817 TTAATAACTGATGCTTCCACTGG + Intronic
950567199 3:13777034-13777056 CAAGGAACAAATGCTCCCACTGG + Intergenic
959576530 3:107940272-107940294 CTAAGTAATAAAGCAGCCACGGG - Intergenic
967900720 3:194448975-194448997 CTAAGAACTAATGGTAACAGTGG + Intronic
974535421 4:63167847-63167869 CTAAGATATAATGGTGGCACAGG - Intergenic
975977439 4:80115554-80115576 CTGAGACCTAATGGAGCCACAGG + Intronic
976069582 4:81225762-81225784 CTAAGAACTAGTTCTTCCTCTGG + Intergenic
980831958 4:138140809-138140831 CTAAGAACTAATGAAAGCACTGG - Intergenic
980919877 4:139073549-139073571 CTGTGAACTGATGCTTCCACTGG + Exonic
981009705 4:139912933-139912955 CTAGGAACTAATATAGCCACAGG + Intronic
986308200 5:6531263-6531285 ATGGGAACTAAGGCTGCCACTGG + Intergenic
989172239 5:38483894-38483916 CTAAGCATGAATGCAGCCACTGG + Intronic
989510563 5:42282266-42282288 CAAAGAACTAATGATGTAACTGG - Intergenic
992932804 5:81667373-81667395 CAAAGAACCATTGCTCCCACAGG + Intronic
994644742 5:102454089-102454111 CTAACAACTATTGCTGCCTCTGG + Intronic
995214550 5:109580780-109580802 CAAGGAACTCATGCTACCACAGG + Intergenic
999335238 5:150710354-150710376 CCAGGGATTAATGCTGCCACAGG - Intronic
1002214450 5:177620117-177620139 CTAAGAACTTTGGCTGCTACAGG + Intergenic
1008837215 6:55848895-55848917 CTAAGAAATTAGGCTGTCACTGG + Intronic
1009837471 6:69021619-69021641 CTTAGAACTAATGCTCTCAAAGG - Intronic
1010635378 6:78252983-78253005 CTAAGAACAAATGCTGCTGATGG + Intergenic
1012055388 6:94400739-94400761 CTACAAACTAATGCTACCAAGGG - Intergenic
1013296922 6:108766011-108766033 TCAAGAACAAATGCTGTCACTGG - Intergenic
1016672632 6:146726781-146726803 CAAAGAACCAATGATGCCATGGG - Intronic
1020646394 7:10819443-10819465 CTTAGCACAAATGCAGCCACAGG + Intergenic
1023744994 7:43314959-43314981 CTCAGGACTCATGCTGCCACAGG + Intronic
1028910135 7:96198676-96198698 CTACTAACTTATGCTGCCTCAGG + Intronic
1032308328 7:130757483-130757505 CTACTAACTACTGTTGCCACTGG + Intergenic
1034811857 7:154139300-154139322 CTAAGAACTTGGGGTGCCACTGG + Intronic
1039979617 8:42397045-42397067 CTAAGAATTGATGCTGACAAGGG + Intronic
1045546832 8:103137070-103137092 CTAAGGAGAAATGCTGCAACAGG - Intronic
1049229197 8:141473354-141473376 CTGAGGACTAAGGCAGCCACAGG - Intergenic
1049327252 8:142029229-142029251 CTACGCCCTGATGCTGCCACAGG - Intergenic
1050396245 9:5200013-5200035 CTAAGCACTAATCCTGCCCAGGG + Intergenic
1050402853 9:5274630-5274652 CTAAGAATTAACGCTTCCATGGG + Intergenic
1052418962 9:28216719-28216741 CTAAGAAATATTGCTGCCAGTGG - Intronic
1057454323 9:95193866-95193888 GCCAGAACGAATGCTGCCACAGG + Intronic
1060628844 9:125138047-125138069 CCATGCACTAATTCTGCCACTGG + Intronic
1062199518 9:135294486-135294508 CTAAGAGCTAATTGTTCCACGGG - Intergenic
1192027156 X:67466028-67466050 TTAGCAACCAATGCTGCCACAGG + Intergenic
1194352247 X:92834892-92834914 TTAAGAGCTAGTGCGGCCACAGG + Intergenic
1196399720 X:115301031-115301053 CTTAGTACTAGTGCTGCCTCAGG - Intronic
1200660556 Y:5951630-5951652 TTAAGAGCTAGTGCGGCCACAGG + Intergenic