ID: 1165020649

View in Genome Browser
Species Human (GRCh38)
Location 19:32921444-32921466
Sequence GCCAGCATGGGGAGAGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165020649_1165020657 3 Left 1165020649 19:32921444-32921466 CCTGACACTCTCCCCATGCTGGC 0: 1
1: 0
2: 2
3: 22
4: 228
Right 1165020657 19:32921470-32921492 GGCCATCACACTGGAGCAAAGGG 0: 1
1: 1
2: 0
3: 9
4: 137
1165020649_1165020659 30 Left 1165020649 19:32921444-32921466 CCTGACACTCTCCCCATGCTGGC 0: 1
1: 0
2: 2
3: 22
4: 228
Right 1165020659 19:32921497-32921519 TTTCAAATCCCAACAAATGCAGG 0: 1
1: 1
2: 3
3: 10
4: 190
1165020649_1165020656 2 Left 1165020649 19:32921444-32921466 CCTGACACTCTCCCCATGCTGGC 0: 1
1: 0
2: 2
3: 22
4: 228
Right 1165020656 19:32921469-32921491 GGGCCATCACACTGGAGCAAAGG 0: 1
1: 0
2: 1
3: 11
4: 115
1165020649_1165020655 -6 Left 1165020649 19:32921444-32921466 CCTGACACTCTCCCCATGCTGGC 0: 1
1: 0
2: 2
3: 22
4: 228
Right 1165020655 19:32921461-32921483 GCTGGCGTGGGCCATCACACTGG 0: 1
1: 0
2: 2
3: 31
4: 553

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165020649 Original CRISPR GCCAGCATGGGGAGAGTGTC AGG (reversed) Intronic
900380441 1:2381499-2381521 GCCTGCCTGGGGAGGGTGTGCGG + Intronic
902371464 1:16009806-16009828 GGCAGCATGTGGGGAGTGTCCGG + Intergenic
902616411 1:17625870-17625892 CCCAGAATGGGGACAGTGTCTGG + Intronic
906602085 1:47138824-47138846 CCCTGCATGGGGAGAGGGGCGGG + Intronic
908459888 1:64339015-64339037 GCCAGTATGGAGAGAATGGCAGG + Intergenic
912569693 1:110612475-110612497 GGCTGCATGTGGAGTGTGTCGGG - Intronic
912715529 1:111981258-111981280 GGCAGCGTGGGGAGAAGGTCAGG - Intronic
915510993 1:156387020-156387042 GCCAGCAGAGGGAAAGGGTCAGG - Intergenic
917869484 1:179229227-179229249 CCCAGCATGGTGAGTGTGTCTGG - Exonic
918135178 1:181666388-181666410 TCCAGTATGGGGAGAGTCTAAGG + Intronic
919982173 1:202648862-202648884 TCCAGCTTGGGCAGAGTGGCTGG + Intronic
923517160 1:234707517-234707539 GCCAGCAAGGGGAGATTGCGAGG - Intergenic
923541366 1:234890568-234890590 GCCTGCATGGAGAGACTTTCTGG + Intergenic
924717421 1:246590223-246590245 GCAAGCGTGGGGAGCGTGACTGG + Intronic
1062860453 10:805798-805820 GGCAGCATGGGCAGAGAGTGTGG + Intergenic
1063235911 10:4116160-4116182 GTCAGTATGGAGAGAGTTTCTGG + Intergenic
1064020290 10:11803784-11803806 CACAGCATGGGGTGAGTGGCAGG - Intergenic
1064441059 10:15354129-15354151 GCAAGCATGGCGAGAGTTTTGGG - Intronic
1066649610 10:37642278-37642300 GCCACCATTGGGAGAGTGCTGGG + Intergenic
1067539420 10:47140955-47140977 TCCTGCATCTGGAGAGTGTCAGG - Intergenic
1067563242 10:47318804-47318826 GACAGCACAGGGAGAGAGTCAGG - Intergenic
1069793730 10:71039658-71039680 GCCAGCATGGGGAAAGAGGTAGG + Intergenic
1070758863 10:79010806-79010828 GGCAGCGTGGGGTGAGTGACAGG - Intergenic
1073836839 10:107453952-107453974 GCCAGAATGTGGAGAGAGTTTGG - Intergenic
1075161035 10:120024761-120024783 GCCACCATGTGGAAAGGGTCAGG - Intergenic
1075385341 10:122051411-122051433 GCCAACATGGGGAGAGGCCCAGG - Intronic
1076812758 10:132897828-132897850 GCCAGCATGGGGAGAGAGGCTGG + Intronic
1077100700 11:821090-821112 GCCAGCTTGGGGATAGTCCCTGG - Intronic
1077278741 11:1732301-1732323 GGCAGCATGGGGAGAGGGGAGGG + Intergenic
1079080467 11:17410295-17410317 GCCAGGATGGGGAGTGTCTGTGG + Intronic
1079784999 11:24660559-24660581 GATTGCTTGGGGAGAGTGTCTGG + Intronic
1082872715 11:57958405-57958427 GTCAGGATGGGGGAAGTGTCTGG - Intergenic
1083894254 11:65612259-65612281 GCCATGATGGGCAGCGTGTCGGG + Intronic
1084109213 11:67002710-67002732 GTGAGCATGGAGAGAATGTCGGG - Intergenic
1085238140 11:75031053-75031075 GTCATTATGGGGAAAGTGTCTGG + Intergenic
1085772675 11:79339112-79339134 TCCAGCATCAGGAGAGTGGCAGG + Intronic
1089192004 11:116660182-116660204 GCCTTTCTGGGGAGAGTGTCAGG - Intergenic
1090346414 11:126075237-126075259 GACACCATGAGAAGAGTGTCTGG + Intergenic
1091775088 12:3179271-3179293 GTCAGAGTGGGGTGAGTGTCGGG - Intronic
1092265575 12:6978006-6978028 GGCAGCTTGAGTAGAGTGTCTGG - Intronic
1092538129 12:9405128-9405150 GCCAGCGGGGGGAGAGGGGCTGG - Intergenic
1092538509 12:9406087-9406109 GCCAGCGAGGGGAGAGGGGCTGG - Intergenic
1093938326 12:25025385-25025407 GACAGCAAGGCCAGAGTGTCTGG + Intronic
1094450651 12:30580129-30580151 GCCAGCATGGGAACAGAGGCTGG + Intergenic
1095408463 12:41894447-41894469 GGCAGCATAGGTACAGTGTCTGG + Intergenic
1096978268 12:55712971-55712993 GCCAACTCAGGGAGAGTGTCAGG - Intronic
1101264460 12:103068644-103068666 GCCAGCATGGCCAGAGCATCAGG + Intergenic
1102165552 12:110803743-110803765 GCCAGGAATGGGAGAGTGGCGGG - Intergenic
1102547214 12:113665806-113665828 GCCAGGATGGGGAGAGGTTGGGG - Intergenic
1103620874 12:122186381-122186403 GCCAGCATGGGTGGAGGGTAAGG + Intronic
1104912503 12:132245971-132245993 GACAGCCTGGGGAGGGTGCCGGG - Intronic
1108472739 13:50783842-50783864 GCCAGCATGGGGAGAGCCTATGG - Intronic
1109546520 13:63841459-63841481 GCCAGCGGGGGAAGAGTGGCTGG - Intergenic
1110533794 13:76627799-76627821 TCGAGGATGGGGACAGTGTCAGG + Intergenic
1112316789 13:98370274-98370296 GCCAGCATGGCAGGAGTGTTGGG + Intronic
1118309228 14:64680520-64680542 GTCAGAATGGGGAAAGTGACTGG - Intergenic
1118603570 14:67487264-67487286 GCCAGGGTGGGATGAGTGTCTGG - Intronic
1118819307 14:69334693-69334715 GGCACCAGGTGGAGAGTGTCAGG + Intronic
1120649375 14:87113128-87113150 GCCAACATGGGAAATGTGTCTGG - Intergenic
1121525599 14:94616983-94617005 GCCAGAATGGGGAGAGAGATAGG - Intronic
1121615131 14:95308655-95308677 GCGATCATGGGGAGTGTGTGCGG - Intronic
1121977380 14:98417791-98417813 GCCACCTTGAGGAGAGTCTCAGG - Intergenic
1122052582 14:99070149-99070171 GTGAGCATGGAGAGAGAGTCAGG - Intergenic
1122116710 14:99531205-99531227 GCCAGCTTGGGGAGCGAGGCTGG - Intronic
1123070719 14:105641332-105641354 GACAGCATGGGGACAGTGACAGG + Intergenic
1123075550 14:105665838-105665860 GAAAGCATGGGGACAGTGTCAGG + Intergenic
1123075565 14:105665905-105665927 GACAGCATGGGGACAGTGTTGGG + Intergenic
1123075773 14:105666753-105666775 GACAGCCTGGGGACAGTGTCAGG + Intergenic
1123096109 14:105767729-105767751 GACAGCCTGGGGACAGTGTCAGG + Intergenic
1125106207 15:35974430-35974452 GGAAGAGTGGGGAGAGTGTCGGG - Intergenic
1126927021 15:53600713-53600735 GCCAGCATGAGCAGAGTGTTGGG - Intronic
1128720069 15:69941619-69941641 GCCGTCATGGGGACATTGTCTGG + Intergenic
1129749374 15:78049905-78049927 GGCAGCATGGGGAGAGCTTATGG - Intronic
1131548778 15:93338574-93338596 GCCTGCCTGGGCAGAGTCTCAGG - Intergenic
1132671437 16:1103651-1103673 GCCAGCCGGGGGTGAGGGTCAGG + Intergenic
1133062986 16:3187399-3187421 GCTTGCATGGGAAGAGTTTCGGG - Intergenic
1133193606 16:4152636-4152658 GCCAGAATGGAGGCAGTGTCTGG + Intergenic
1134468636 16:14501665-14501687 GCCATCATGGTGAGAGTTCCTGG + Intronic
1136991130 16:35152005-35152027 GCCAGCCTGTGGAGAGTGGATGG - Intergenic
1138189814 16:55005355-55005377 GGCAGCATGGGGAGGTTGTAGGG - Intergenic
1139523523 16:67499152-67499174 GCCAGGTTGGGGAGGGAGTCTGG - Intergenic
1140857301 16:78989436-78989458 GCCAGCATGGGCAGGATGCCTGG - Intronic
1141360106 16:83387800-83387822 GACAGCAAGGGGAAAGTGCCAGG - Intronic
1141462105 16:84183708-84183730 GGCAGCATGGGGAGAGGCCCAGG + Exonic
1141647131 16:85373599-85373621 CCCAGCCTGGAGTGAGTGTCTGG + Intergenic
1142197373 16:88745068-88745090 ACCTGCAGGGGGAGAGTGACGGG - Intronic
1142618046 17:1148035-1148057 ACCAGCCTGGGGAGAGTGGGTGG - Intronic
1142756392 17:2018865-2018887 GGCAGCATGTGGACAGTGACGGG + Intronic
1142982226 17:3678914-3678936 GCCTGCGTGGGGAGGGCGTCTGG - Intronic
1143184996 17:5004674-5004696 GGCAGCATAGGAAGAGTGCCAGG + Intronic
1144550417 17:16236341-16236363 GCCAACATGGAGAGACTCTCTGG - Intronic
1144950033 17:18989072-18989094 GGCAGCAAGGGGAGGGAGTCAGG + Intronic
1145017982 17:19411381-19411403 GCTGGGATGGGGAGAGGGTCCGG - Exonic
1147199554 17:38791174-38791196 GCTAGCATGGCCAGAGGGTCAGG + Intronic
1147327419 17:39676175-39676197 GTCAGCATGGGGAGAGGAGCAGG + Intronic
1148144760 17:45356118-45356140 GCCAGCCTGGGATGAGTGTCTGG + Intergenic
1148577624 17:48722864-48722886 CCCAGCCTGGGGGGAGGGTCAGG - Intergenic
1150483439 17:65528102-65528124 CCCAGAATGGGGAGGGTGCCTGG + Intergenic
1151974181 17:77475247-77475269 ACCATCGTGGGGAGACTGTCTGG + Intronic
1152228575 17:79103717-79103739 GGCAGGCTGGGGAGGGTGTCCGG - Intronic
1153490814 18:5646146-5646168 GCCAGCATGTGGTGGGTGGCAGG + Intergenic
1153968180 18:10200875-10200897 TCCAGCATGGGGAGGGTGTGTGG + Intergenic
1155403963 18:25467553-25467575 GCCAGCATGGGCAGAGCTCCTGG - Intergenic
1155830981 18:30514309-30514331 GCCAGCATGATGACAGTGGCAGG + Intergenic
1157399768 18:47377671-47377693 GAGAACATGGGGTGAGTGTCAGG + Intergenic
1157607828 18:48937376-48937398 GCCAGCAAAGGGAGAGGGCCAGG - Intronic
1159895479 18:73991753-73991775 TGCAGGATGGGGAGAGTGCCTGG - Intergenic
1160617269 18:80140826-80140848 GCCACAATGGGGAGAGAGTAGGG - Intronic
1161220377 19:3115630-3115652 GCCAGCATGGGGCTGGGGTCTGG + Intronic
1162327049 19:10005773-10005795 GTGAGCATGGGGAGAGTGGGCGG - Intronic
1165020649 19:32921444-32921466 GCCAGCATGGGGAGAGTGTCAGG - Intronic
1166096600 19:40543152-40543174 GCGAAAATGGGGAGAGTGGCCGG + Intronic
1166837843 19:45678071-45678093 GCCAGCCTGGGGAGAGAGGGCGG - Exonic
1167288944 19:48614298-48614320 GCCAGCCTGAGGAGGGTGGCTGG - Intronic
925754104 2:7117307-7117329 GCTAGCATGGGGGGAGTGTGTGG + Intergenic
927322903 2:21769050-21769072 GCCAGCTTGGGGAAATTGACCGG + Intergenic
932300647 2:70664496-70664518 GCCTGGATGGGGTGAGAGTCAGG + Intronic
932770258 2:74497125-74497147 GGCAGGATGGGGAAAGGGTCAGG + Intergenic
934615702 2:95769361-95769383 CCCAGTATGGGGAGAGAGGCTGG + Intergenic
935407286 2:102722333-102722355 GCCAGCATGGCCAGAATGTATGG + Intronic
936507304 2:113117799-113117821 GCCAGCATGAGGAGATGGGCCGG - Intronic
936525708 2:113240224-113240246 AGCAGCATGGGGAGAGGGCCTGG - Intronic
938296785 2:130183655-130183677 GCCTTCATGGGGGGAGTGCCAGG + Intronic
938611919 2:132956894-132956916 CTGAGCCTGGGGAGAGTGTCTGG - Intronic
938797970 2:134734699-134734721 CTGGGCATGGGGAGAGTGTCAGG - Intergenic
939172363 2:138710859-138710881 GCCAGCTTGGGTAAAGTGTTTGG - Intronic
941012655 2:160319102-160319124 GCCACTATGGAGAGAGTGTGGGG - Intronic
942611059 2:177742918-177742940 GCCAGCAAGAGGAAAGTGTTAGG + Intronic
943177010 2:184489486-184489508 GCCATCATGAGGAGAGTTTGTGG - Intergenic
947294699 2:228617613-228617635 TCCAGGAAGGGGAGAGTGACTGG + Intergenic
947825893 2:233105783-233105805 GCCAGCAAGTGGAGGGTGCCAGG + Intronic
948084956 2:235239706-235239728 GACAGCAAGGGAAGTGTGTCTGG - Intergenic
948388061 2:237593897-237593919 GCCTTCATGAGGAGGGTGTCAGG - Intronic
1168890933 20:1295037-1295059 TCCAGCATGGGGAGAGGTCCAGG + Intronic
1169193071 20:3669900-3669922 GCCAGCATCTGGAGAGTGCCAGG - Intronic
1170001610 20:11621076-11621098 TCCAGCATGGCCAGAGTGCCTGG + Intergenic
1170519458 20:17168988-17169010 GGCAGCAAGAGGAGAGTGGCTGG - Intergenic
1170843605 20:19943790-19943812 CCCAGCATGGGAAGAGTGGTGGG - Intronic
1171327117 20:24304579-24304601 GCCAGCATGGGGTCAGTACCTGG + Intergenic
1171424092 20:25038865-25038887 GCCAGCAGGGGGGCAGTGACAGG - Intronic
1171966804 20:31536651-31536673 GGGAGCATGGGGACAGTGTCAGG - Intronic
1172842715 20:37911659-37911681 GCCAGGATGGGGAGAGGGGCTGG + Intronic
1174379914 20:50149778-50149800 GCCAGCCAGGGGTGAGTGTGTGG - Intronic
1175756893 20:61535788-61535810 GCCGCCATGGGGAGAGTGTGGGG + Intronic
1176020787 20:62961453-62961475 GCCAGCATCGCTAGAGGGTCTGG - Intronic
1176282636 20:64322999-64323021 CCCAGCAGGGAGAGAGTTTCTGG - Intergenic
1176389278 21:6155271-6155293 GCCAACAAGGGGAGGGTGCCTGG - Intergenic
1176722043 21:10401228-10401250 GCCAGCCTCGGGAGGCTGTCGGG + Intergenic
1177882154 21:26707088-26707110 GCCAGAATGGAGGGTGTGTCAGG + Intergenic
1179734192 21:43382967-43382989 GCCAACAAGGGGAGGGTGCCTGG + Intergenic
1179909931 21:44442253-44442275 GCCCTCTTGGGGAGAGTGGCAGG - Exonic
1180119102 21:45734641-45734663 TACAGCCTGGGGAGAGTGCCTGG - Intronic
1182900508 22:33894497-33894519 GACAGCAGTGGGACAGTGTCGGG - Intronic
1183585651 22:38751513-38751535 GCCAGCATTGGGAGAGTCAGGGG - Intronic
1183983744 22:41557889-41557911 GCCAGCAGAGGGGGAGTGGCTGG - Intergenic
1184266854 22:43352152-43352174 GCCCGCATGCCGAGAGTGGCTGG + Intergenic
1184608681 22:45588914-45588936 GCCAGCACCGGGAGGATGTCAGG + Intronic
1184985901 22:48134011-48134033 GCCAGGATGGGGTGAGGGTGGGG - Intergenic
949883609 3:8678928-8678950 GCCAGGAGGGGAAGAGTGGCTGG - Intronic
950181697 3:10918066-10918088 GCCAGCATGGGAAGGGAGGCTGG - Intronic
950288303 3:11762662-11762684 GCCAGGATAGGGAGAGAGTCAGG - Intergenic
951810353 3:26691807-26691829 GCCAGCATGTGGATAGTATAAGG - Intronic
952425355 3:33169617-33169639 GACAGCATGGAGTGAGTGTTTGG + Intronic
953547271 3:43872700-43872722 GCCAGCATTGGGAGAGGTTTGGG - Intergenic
956603806 3:71051427-71051449 GGCAGCAAAGGGAGAATGTCTGG + Intronic
956735396 3:72233895-72233917 CCCAGCAAGGGGACAGTGACAGG + Intergenic
960218718 3:115077029-115077051 CCCAGCAGGAGGTGAGTGTCCGG - Intronic
961347098 3:126270369-126270391 GCCCGCCTGGGGAGGGTGCCAGG - Intergenic
961434246 3:126905652-126905674 GCCAGGATGGGGGGTGTGTGAGG + Intronic
961600463 3:128057359-128057381 GCAAGGCAGGGGAGAGTGTCTGG + Intronic
962957010 3:140275648-140275670 ACCAGCATGGGTAGAGAGTCAGG - Intronic
966169198 3:177058745-177058767 GCCAGCATAGCGAGAGTATAAGG - Intronic
968463563 4:738048-738070 GCCACCACCGTGAGAGTGTCGGG - Intronic
968626177 4:1627681-1627703 GCCTGCAGGGGAAGGGTGTCGGG + Intronic
969720365 4:8890175-8890197 GCCAGGCAGGGGTGAGTGTCAGG - Intergenic
972335636 4:38105168-38105190 CGCACCATGGGGAGAGTGTGGGG - Intronic
972597430 4:40542332-40542354 CCCAGTATGGAGAGAGTGTTGGG - Intronic
972663097 4:41135972-41135994 ACCAGAATGAAGAGAGTGTCAGG - Intronic
975662192 4:76698996-76699018 GTCACCATGGGGAGGGTGACAGG - Intronic
975766811 4:77677147-77677169 GCCAGCATGGGGAGAGTGAGAGG - Intergenic
978100551 4:104835145-104835167 GACAGCATGGGGAGAGTTATCGG + Intergenic
978363116 4:107951768-107951790 GCCAGCATGAGGAAAGGTTCAGG - Exonic
979718690 4:123872324-123872346 GCCAGCATGAAGAAAGTGGCAGG - Intergenic
980157819 4:129128344-129128366 GCCAGGATGGGGACAGAATCTGG - Intergenic
983210602 4:164954092-164954114 GTCAGCATGGGGGAAGTGACAGG - Intergenic
984785807 4:183566303-183566325 GCCGGCATGGGCAGAGAGGCAGG + Intergenic
984846879 4:184115687-184115709 GCCAGGGTGGGGAGCTTGTCTGG + Intronic
987246753 5:16056845-16056867 GCGAGCAGGGGGATAGGGTCAGG - Intergenic
989110291 5:37900813-37900835 GCCAGCCTGGGCATATTGTCAGG - Intergenic
989558983 5:42829573-42829595 ACCAGGATGGGGACACTGTCTGG - Intronic
993955259 5:94224937-94224959 GTCAGAATGGGGAAAGTGGCAGG - Intronic
995114509 5:108464291-108464313 GGGAGCAGGGGGAGAGTGTGTGG + Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
996000387 5:118354927-118354949 GCCAGCATGAGGAGAATGAGAGG + Intergenic
997103455 5:130993708-130993730 GTCAGGAAGGAGAGAGTGTCAGG + Intergenic
997250731 5:132386776-132386798 GCCAGCATGGGGATGCCGTCAGG + Intronic
997468804 5:134105175-134105197 GCCAGCAGGGGGACAGAGCCTGG - Intergenic
997663658 5:135609299-135609321 GGCAGCATGTGGAGGGTGCCAGG + Intergenic
997998363 5:138604538-138604560 GTGAGCATGGGGAGAGAGTGAGG + Intergenic
1001551256 5:172603735-172603757 GTCAGCTTGGGGAGGGTGGCTGG + Intergenic
1004855864 6:19749147-19749169 CCAAGTATAGGGAGAGTGTCAGG + Intergenic
1005823958 6:29621087-29621109 TCCAACATGGTGAGAGTGTGGGG - Exonic
1006475214 6:34248764-34248786 GCCAGGGTGGGGAGGGCGTCAGG + Intronic
1006726341 6:36201724-36201746 GCAAGCATGGGGAGAGTGGAGGG - Exonic
1006801340 6:36761575-36761597 GCTAGCATGAGGACAGTGCCAGG + Intronic
1007408465 6:41648175-41648197 GCCAGCATGGGGGCAGAGGCTGG - Intronic
1008464162 6:51812066-51812088 GCCAGCATGGAGAGAGCAGCAGG + Intronic
1011507063 6:88057022-88057044 GGAAGCATGGGGAAAGTTTCTGG - Intronic
1012429330 6:99147785-99147807 GCCAGCATGGTGAGAGCTGCAGG - Intergenic
1018631166 6:165824144-165824166 GACATCATGCGGAGAGTGCCTGG + Intronic
1019390910 7:786692-786714 GCCAGCCTTGGGGGGGTGTCAGG + Intergenic
1019912532 7:4109532-4109554 GCAAGCATGGAGAGCATGTCAGG - Intronic
1020080808 7:5284733-5284755 TCCACCATGGGGACAGTGGCTGG + Intronic
1023656100 7:42422419-42422441 CCCAGGCTGGGGTGAGTGTCAGG + Intergenic
1026281036 7:68921941-68921963 ACCAGCGAGGGCAGAGTGTCAGG - Intergenic
1026638381 7:72104024-72104046 GCAAGAATGGGGACAGTGACTGG + Intronic
1026898749 7:74025830-74025852 TCCAGGACGGGGAGAGAGTCCGG - Intergenic
1027693808 7:81382803-81382825 GCCAAGATAGGGAGAGTGTGAGG + Intergenic
1029179268 7:98688245-98688267 ACCAGCCTGGGGAAAGTCTCCGG + Intergenic
1031949291 7:127875397-127875419 ACCGGCATGGGGAGAATGCCAGG + Intronic
1032679162 7:134163945-134163967 GCCATGATGGGGGGAGTGTTGGG + Intronic
1034304537 7:150038757-150038779 GCCAGGAGGGGAAGAGGGTCTGG + Intergenic
1034352811 7:150428355-150428377 ACCAGCTGGGGGAGAGTCTCAGG - Intergenic
1035307297 7:157941717-157941739 CCCAGCATAGGGAGTGTGGCTGG - Intronic
1037760632 8:21739304-21739326 GCCAGCATTAGAGGAGTGTCAGG - Intronic
1038934257 8:32231007-32231029 GCCAGCATGGGGAGAAGGTGGGG - Intronic
1039436238 8:37561261-37561283 GCCTTGATGGGGAGAGGGTCTGG + Intergenic
1041770522 8:61467679-61467701 GCCAGCAGGGGGAGAAAGTGGGG + Intronic
1042363481 8:67909151-67909173 GCCAGGATGTGGAGTGAGTCAGG + Intergenic
1045917301 8:107487203-107487225 GCCAGCATGGGGAGGATCACAGG + Intronic
1048488610 8:134871166-134871188 GCCAGCCTGGGGATAATCTCCGG - Intergenic
1053042476 9:34886163-34886185 GACAGCAAGGGGAGAATTTCTGG - Intergenic
1053157726 9:35792108-35792130 GCCAGGATGGGGACAGTGCGAGG - Intergenic
1055831401 9:80383314-80383336 GCCAGCCTTGGAACAGTGTCTGG + Intergenic
1056544857 9:87605191-87605213 GCCAGGCTGGGGAGAGGGTGTGG + Intronic
1057221272 9:93259189-93259211 GCCAGCAGGGGGATAGTGGCCGG - Exonic
1057293940 9:93824620-93824642 GCCAGCATGGTTAGAGGGTGGGG + Intergenic
1057487107 9:95494293-95494315 TCCAGCGTGGGCAGAGTGCCGGG - Intronic
1059304382 9:113342285-113342307 GCCAGCATGGGAAGAGGACCAGG + Intergenic
1061849089 9:133404027-133404049 GCCAGCCTGGTGAAGGTGTCAGG + Exonic
1062340738 9:136092937-136092959 GGCAGCCTGGGGACAGTGTGTGG + Intronic
1062543408 9:137051471-137051493 GCCATCATGGGGACAGGGCCAGG + Intronic
1186957440 X:14698899-14698921 ACATGCATGGGAAGAGTGTCTGG + Intronic
1187126032 X:16455341-16455363 GCTAGCATGGTGAGTGTGTTGGG - Intergenic
1188008726 X:25037102-25037124 TCCAGCATGTGGACAGTGTAGGG + Intergenic
1189107644 X:38254230-38254252 TTCAGCATGGGGTCAGTGTCAGG - Intronic
1192382619 X:70634464-70634486 GACAGCATGGGAATAGTGTAAGG + Intronic
1196424663 X:115558234-115558256 GCTAGACTGGGGAGAGTGTTGGG + Intergenic
1196459074 X:115911494-115911516 CCCAGTATGGGGAGAGGGTGAGG + Intergenic
1198469296 X:136931028-136931050 GCAAGCATGGGGAACGTGACTGG + Intergenic
1200158387 X:153990668-153990690 GCCAGGGTGGGGAGAGTGGTGGG + Intergenic
1202180460 Y:22135454-22135476 TCCAGCAAGAGGAGAGTGCCTGG - Intergenic
1202210900 Y:22450945-22450967 TCCAGCAAGAGGAGAGTGCCTGG + Intergenic