ID: 1165026069

View in Genome Browser
Species Human (GRCh38)
Location 19:32962504-32962526
Sequence ATTTTCTTCTAGAAGTGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4041
Summary {0: 1, 1: 13, 2: 77, 3: 566, 4: 3384}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165026069_1165026070 4 Left 1165026069 19:32962504-32962526 CCATAACACTTCTAGAAGAAAAT 0: 1
1: 13
2: 77
3: 566
4: 3384
Right 1165026070 19:32962531-32962553 GAGAAAACCTTTGTGACCTTAGG 0: 2
1: 23
2: 126
3: 376
4: 1011
1165026069_1165026071 9 Left 1165026069 19:32962504-32962526 CCATAACACTTCTAGAAGAAAAT 0: 1
1: 13
2: 77
3: 566
4: 3384
Right 1165026071 19:32962536-32962558 AACCTTTGTGACCTTAGGTTAGG 0: 1
1: 9
2: 84
3: 347
4: 920

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165026069 Original CRISPR ATTTTCTTCTAGAAGTGTTA TGG (reversed) Intronic
Too many off-targets to display for this crispr