ID: 1165032471

View in Genome Browser
Species Human (GRCh38)
Location 19:33008057-33008079
Sequence CTGCGTCTGCCGATCACACC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165032464_1165032471 21 Left 1165032464 19:33008013-33008035 CCTGCGGCTCTCTGAAAGGCATC 0: 1
1: 3
2: 0
3: 11
4: 99
Right 1165032471 19:33008057-33008079 CTGCGTCTGCCGATCACACCGGG 0: 1
1: 0
2: 0
3: 2
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165032471 Original CRISPR CTGCGTCTGCCGATCACACC GGG Exonic
901028761 1:6293887-6293909 CTGCTACTGCAGAACACACCTGG - Intronic
904687967 1:32274335-32274357 CTGTGGCTGCAGCTCACACCCGG + Exonic
908986033 1:70023217-70023239 TTGGATCTGCTGATCACACCTGG - Exonic
922978385 1:229803790-229803812 CTGCCTCTGCTGACCACAGCAGG + Intergenic
923622779 1:235591612-235591634 ATGCGTCTGCACATCCCACCTGG + Intronic
1063053416 10:2477328-2477350 CTGCATCTTCAGCTCACACCAGG + Intergenic
1067112112 10:43408365-43408387 CTGCGTCTCCCGATCCCAGTGGG + Intronic
1067721280 10:48729428-48729450 CTGGGTCAGCCCATCATACCTGG - Exonic
1076508977 10:130998889-130998911 CTGAGTCTGCCCATCACCACTGG - Intergenic
1080268326 11:30424420-30424442 CTCCGACTGCACATCACACCAGG + Intronic
1084170558 11:67398939-67398961 CCTCATCTGCCGAGCACACCAGG - Exonic
1084311161 11:68317102-68317124 CTGCCTCCGCCCATCACACTTGG - Intronic
1085023520 11:73223445-73223467 CTGTGTCTGCCTGTCACAACAGG - Intronic
1085351626 11:75801559-75801581 CTGCATCTGCTGCTGACACCTGG + Intergenic
1085520574 11:77136912-77136934 CTGGGTCTGTCCACCACACCAGG + Intronic
1096543972 12:52324249-52324271 CTGTGCCTGCCCTTCACACCTGG + Intergenic
1102036515 12:109773496-109773518 CTGCGCCTGCCCATCCCTCCCGG + Intergenic
1109397699 13:61782274-61782296 CTGCCTCTGCCAGTCTCACCAGG + Intergenic
1114173989 14:20302650-20302672 CTGAGTCTTCCTGTCACACCAGG + Intronic
1118569904 14:67183985-67184007 CTGGGACTACCCATCACACCTGG + Intergenic
1136848220 16:33593537-33593559 CTGCGTGTGCCGATAGCGCCGGG - Intergenic
1152183738 17:78841103-78841125 CCGGGTCGGCCGAGCACACCTGG + Intronic
1155054238 18:22170764-22170786 CAGCTTCTGCAGATCACCCCTGG + Intronic
1156341770 18:36215741-36215763 CTACGTCTGCCCATGACAGCAGG - Exonic
1165032471 19:33008057-33008079 CTGCGTCTGCCGATCACACCGGG + Exonic
1166902112 19:46072619-46072641 CTCTGTCTCCTGATCACACCTGG - Intronic
927484078 2:23477106-23477128 CTGCGTCTGCATAACACACAGGG + Intronic
938376269 2:130808715-130808737 CTGCCTCTGCAGATCACTCCTGG + Intergenic
1174061836 20:47838553-47838575 CTGCTTCTCCCGTTGACACCGGG + Intergenic
1174069671 20:47890675-47890697 CTGCTTCTCCCGTTGACACCGGG - Intergenic
1175401784 20:58704157-58704179 TTGCGTCTGCGTTTCACACCAGG - Intronic
952324167 3:32306131-32306153 CTGGGTCTGCTGATCTCAGCTGG + Intronic
953244156 3:41175637-41175659 CTGAGGCAGCCGTTCACACCAGG + Intergenic
953760289 3:45681564-45681586 CTGCGTGTGCAGGTCTCACCTGG - Exonic
959459749 3:106610662-106610684 CTGTGACAGCCAATCACACCTGG + Intergenic
959521102 3:107323936-107323958 CTGCCTCTGCCCTTCACTCCTGG + Intergenic
969516195 4:7649440-7649462 CTGCAGCTGCAGAGCACACCTGG - Intronic
974209679 4:58753749-58753771 CTGCACCTGCCTATCTCACCTGG - Intergenic
985497565 5:218290-218312 CTGCGCCTGCGCACCACACCGGG - Exonic
993870627 5:93249873-93249895 CTGCGTATGCCGCTGACGCCAGG - Intergenic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
998518793 5:142781526-142781548 CACCATCTGCCCATCACACCTGG + Intronic
999172104 5:149604197-149604219 CTTCGTCTCCTGATCACACCTGG + Intronic
1001065480 5:168532010-168532032 CTGCCTCAGCCTACCACACCTGG + Intergenic
1022831856 7:34075650-34075672 CTCCCTCTGCCTATCACGCCAGG + Intronic
1029569883 7:101362585-101362607 CTGTGTCTGCCAATTTCACCTGG - Intergenic
1036398263 8:8386586-8386608 TTGCGCCTGCCGCTCCCACCCGG + Intergenic
1036728655 8:11242646-11242668 CTGCCTCTGGAGATAACACCTGG - Intergenic
1038246423 8:25860665-25860687 CTACATCTGCCCACCACACCTGG + Intronic
1045003207 8:97896068-97896090 CTGCTGCAGCCGGTCACACCTGG + Intronic
1047783132 8:128125995-128126017 CTGAGTCTGCAGACCCCACCTGG - Intergenic
1050018254 9:1258679-1258701 ATGCTTCTGCCCATCACAGCTGG + Intergenic
1053017049 9:34667833-34667855 CAGCATCTGCCCCTCACACCAGG - Intergenic
1059448886 9:114357656-114357678 CTGAGCCTGCCCATCACAGCTGG - Intronic
1060950537 9:127599321-127599343 CTGCCTGTGCCGAGCACTCCAGG - Intergenic
1062318606 9:135979792-135979814 CTGGGTCTGCAGACCACCCCAGG + Intergenic
1062395608 9:136351433-136351455 CTGGCTCTGCCCATCACATCTGG + Intronic
1187020773 X:15379186-15379208 CTGCCTCTACCCATCACACTTGG + Intronic
1189701610 X:43719347-43719369 CTGCCCCTGCGGGTCACACCAGG - Intronic
1199623545 X:149720362-149720384 CAGGGTCTGCCGGTCAGACCCGG + Intergenic