ID: 1165035763 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:33032403-33032425 |
Sequence | CCTTCTCCAGAGGTGGTGTA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1165035755_1165035763 | 12 | Left | 1165035755 | 19:33032368-33032390 | CCACTGGTGACTGAGCTCGATCT | No data | ||
Right | 1165035763 | 19:33032403-33032425 | CCTTCTCCAGAGGTGGTGTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1165035763 | Original CRISPR | CCTTCTCCAGAGGTGGTGTA GGG | Intronic | ||