ID: 1165035763

View in Genome Browser
Species Human (GRCh38)
Location 19:33032403-33032425
Sequence CCTTCTCCAGAGGTGGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165035755_1165035763 12 Left 1165035755 19:33032368-33032390 CCACTGGTGACTGAGCTCGATCT 0: 1
1: 1
2: 3
3: 25
4: 118
Right 1165035763 19:33032403-33032425 CCTTCTCCAGAGGTGGTGTAGGG 0: 1
1: 0
2: 1
3: 10
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165035763 Original CRISPR CCTTCTCCAGAGGTGGTGTA GGG Intronic
900605593 1:3522298-3522320 CCTTCTCCAGGGCTGGTGCCCGG - Intronic
901687286 1:10949899-10949921 CCTTTTCCACAGGTGGGGAACGG + Intronic
902219057 1:14953175-14953197 CCTTCTCCAGGGGCTGTGTGGGG + Intronic
902409038 1:16202196-16202218 CCTGCCCCACAGGTGGTGTCAGG - Intronic
904302112 1:29561196-29561218 CCTTCTCCAGAGATTGTTTTAGG - Intergenic
904455175 1:30643095-30643117 CCTTCTCCAGAGATTGTTTTAGG + Intergenic
904469178 1:30725489-30725511 TCTTCTCCAGAGATGCTGCAAGG + Intergenic
908511003 1:64850077-64850099 CCATCTCCCGAGGTGGTGAGTGG + Intronic
911812037 1:102295322-102295344 CCTTCTAGAGACTTGGTGTATGG + Intergenic
913036473 1:114970796-114970818 CCTTCTCCAGTGGAGGTGGCAGG + Intronic
915228574 1:154429186-154429208 CCTCCTCCAGAGGTGGCGAGAGG + Exonic
918214702 1:182383511-182383533 CCTTCTCCAGAGGGTGGGCAGGG + Exonic
918229097 1:182512411-182512433 CCTTCTGCAGAGGGGGGGTCAGG - Intronic
921095605 1:211884850-211884872 TCTTCTCCCGGGGTGGGGTAGGG + Intergenic
1063018381 10:2101294-2101316 CCAACTCCAGAGGTGGGGTTCGG + Intergenic
1063908239 10:10802631-10802653 CCTTCCCCAGAGGTGACTTAGGG - Intergenic
1063961517 10:11309924-11309946 CCTGCTCTGGAGGTGGTGCAGGG + Intronic
1066561162 10:36671309-36671331 CCATCTTCAGAGGTGCTGTGTGG - Intergenic
1070477448 10:76843926-76843948 ACTTCTCCAGAGGTGAGGTGGGG - Intergenic
1071752950 10:88502282-88502304 CCTTTAGCAGAGGTGGGGTAGGG + Intronic
1074438110 10:113451881-113451903 CCATCCCCAGAGATGGTGAATGG + Intergenic
1076375167 10:129978873-129978895 TGATCTCCAGAGGTGGTGAAGGG + Intergenic
1077519576 11:3024268-3024290 CATTCTCCAGATTTGGTGTGTGG + Intronic
1077586171 11:3455110-3455132 CCGTCTCCAGAGGTTCAGTATGG - Intergenic
1080653323 11:34239813-34239835 CCTTGTCAAGAGGTGGGGGAGGG - Intronic
1081815760 11:45940040-45940062 CCTTCACTAGTGGTGGTGGAGGG - Intronic
1082660282 11:55900829-55900851 CCTTCTCTAGAAGTTGTGTCTGG + Intergenic
1082718357 11:56642776-56642798 CCTTCTCCAGAAGTTGTGTCTGG - Intergenic
1084317614 11:68354495-68354517 CCTTCTCAGGAGGTGGCGGAGGG + Intronic
1092384318 12:8024105-8024127 CCTTCTTCAGACTTGGTGTTGGG + Intergenic
1094499886 12:31011985-31012007 CCCTTTGCAGAGGTGGTCTAAGG - Intergenic
1102567854 12:113808793-113808815 GTTTCTGCAGAGGTGGTGGAGGG + Intergenic
1103889498 12:124228049-124228071 CCTTCTCCAGATCTGCTTTAGGG + Intronic
1105761887 13:23522666-23522688 TCCCCTGCAGAGGTGGTGTAAGG - Intergenic
1109049762 13:57464233-57464255 CTTTCTACAGAGGCGGAGTAAGG - Intergenic
1110965840 13:81695903-81695925 CCTTCTCCAGAGGAGTTTCATGG - Intergenic
1113491681 13:110697206-110697228 CCCTCAGCAGAGGTGGTGTTTGG - Intronic
1113536019 13:111066860-111066882 CCTTCCCCAGAGCTCGTGGAAGG - Intergenic
1114049213 14:18907129-18907151 CCTGCTCCAGAGTTGTTGTGAGG - Intergenic
1114113351 14:19494802-19494824 CCTGCTCCAGAGTTGTTGTGAGG + Intergenic
1114115054 14:19612556-19612578 CCTGCTCCAGAGTTGTTGTGAGG + Intergenic
1117002828 14:51388967-51388989 TCTTCTGCAGAGGTAGTGCAGGG + Intergenic
1121649298 14:95545376-95545398 CCTTCCCCAGAGGTTTTGGAAGG + Intergenic
1123171583 14:106377756-106377778 GCTTCTCCAGAGGAGGGGTGTGG + Intergenic
1202904747 14_GL000194v1_random:62065-62087 CCTATTCAAGAGGTGGTGTGAGG + Intergenic
1132005390 15:98221898-98221920 CATTCTCCAGAGCTGCTGTGAGG + Intergenic
1132273347 15:100544974-100544996 CCTTCTGAAGAGGTTGTGTAAGG - Intronic
1135600583 16:23780003-23780025 CCCTCTCCAGAAATGGTGTGTGG - Intergenic
1139694018 16:68660032-68660054 TCTTTTACAGATGTGGTGTAGGG + Intronic
1140046722 16:71444441-71444463 CCTGGCCCAGAGGTGGTGAAGGG - Intergenic
1140561133 16:75982995-75983017 CCTACTCCAGAGACGGTGTTGGG + Intergenic
1140785942 16:78342336-78342358 CCTTCACGAGTGGTTGTGTAGGG - Intronic
1141429592 16:83964847-83964869 CCCTCAGGAGAGGTGGTGTAGGG - Intronic
1141917899 16:87112764-87112786 CCTTGTCAAGAGGAGGGGTAGGG + Intronic
1142006197 16:87690629-87690651 TCCTCTCCAGGGGTGGAGTAGGG + Intronic
1145906910 17:28521390-28521412 CCTTCTCAGGAGGTGGTGCAGGG - Intronic
1146957763 17:36946724-36946746 CCTTCTCCAGAGAAGGCGGAGGG - Intergenic
1148136180 17:45293353-45293375 ACTCCTCCAGAGGGGGTGCAGGG + Intronic
1150249578 17:63698518-63698540 CCTTCCGCAGAGGGGGTGGAAGG + Exonic
1151260598 17:72912943-72912965 CTTTCCCCAGATGTGGTGTCAGG + Intronic
1152235294 17:79135415-79135437 CCCCCTCCAAAGGTGGGGTATGG - Intronic
1158331635 18:56368635-56368657 GCTTCTCCAGTGGGGGTGTTCGG + Intergenic
1160999924 19:1905481-1905503 ACTTCCCCAGAGGGGGAGTAGGG + Intronic
1163764457 19:19154978-19155000 CTGCCTCCAGAGTTGGTGTAGGG - Intronic
1164301723 19:23967962-23967984 CCCTCTCAAGAGGAGATGTATGG + Intergenic
1164944550 19:32282493-32282515 TCTTCTCAAGAGGTGGGGTGGGG - Intergenic
1165035763 19:33032403-33032425 CCTTCTCCAGAGGTGGTGTAGGG + Intronic
1166135643 19:40775589-40775611 CCTTCTCCGGACCTGGTGTCAGG + Exonic
1166407140 19:42529214-42529236 CCTTCCCCACAGGTGGTGCCAGG + Intronic
925637216 2:5951812-5951834 CTTTCTCCAGTGGGTGTGTAGGG + Intergenic
929888526 2:45899827-45899849 CTTTCTCCCCAGGTGGTGTCAGG - Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
937072102 2:119072357-119072379 CCTTGGACAGAGGTGGTGGAGGG + Intergenic
938426553 2:131195456-131195478 CCTGCTCCAGAGTTGTTGTAAGG - Intronic
941183577 2:162291626-162291648 CCTCCTCCAGAGGTCATATATGG - Intronic
943405492 2:187478082-187478104 CCCTCTCAAGAGTTGATGTATGG + Intronic
944515913 2:200511441-200511463 CCTTCTGCAGAGATGGAGGAAGG + Intronic
946873982 2:224110211-224110233 CCTACTCCAGAGGGGATGGATGG + Intergenic
948771276 2:240252435-240252457 CCTTGTTCAGAGATGGTGAAGGG - Intergenic
1169851663 20:10058945-10058967 CCTTCTCCAGAAGTGTTGTATGG + Intergenic
1169854029 20:10084146-10084168 CCTTCCCCAGCAGTGGTGTCTGG - Intergenic
1170555404 20:17510892-17510914 CCTTCTTCAGAGGTTGTGGTAGG - Intronic
1172498752 20:35409717-35409739 CCTTCTCCAGTGATGGTTTTGGG - Intronic
1172907893 20:38382857-38382879 CCTTCTCTTGAGGTGGTGCCTGG + Intergenic
1174460476 20:50678796-50678818 CCTCCTCCTGGGGTGATGTAAGG - Intronic
1175166659 20:57048879-57048901 GCTCCTCCAGAGGGGGTGTGTGG - Intergenic
1176065073 20:63190245-63190267 CCTTCTCCAAAGATGGTGGCAGG - Intergenic
1176624115 21:9076831-9076853 CCTATTCAAGAGGTGGTGTGAGG + Intergenic
1179581669 21:42348166-42348188 CCTTCTCCAGAGGACGTGCCTGG + Intronic
1180467692 22:15629503-15629525 CCTGCTCCAGAGTTGTTGTGAGG - Intergenic
1180746480 22:18092428-18092450 ATTCCTCCAGCGGTGGTGTACGG + Exonic
1181761022 22:25058949-25058971 CCTTATGCAGAGGTGGTGTCAGG - Intronic
1181940029 22:26468550-26468572 CCTGCTCCTGAGGTGCTGTTCGG + Exonic
1183361766 22:37386563-37386585 CTTTCTCCAGAGGAGGTGGGAGG + Intronic
949439093 3:4061341-4061363 CATTGTCCAGATGTGGTGTCTGG - Intronic
950127278 3:10517663-10517685 CCTTCTCCAGTGGGGTTGCACGG - Intronic
950282838 3:11721424-11721446 CCATCTCCAGAGGCCCTGTATGG - Intergenic
956445216 3:69319513-69319535 AATTCTCCAGAGCTGCTGTAGGG + Intronic
956867730 3:73385978-73386000 ACTTCCCCAGATGTAGTGTAGGG - Intronic
957069160 3:75552207-75552229 CCGTCTCCAGAGGTTCAGTATGG + Intergenic
957741988 3:84282099-84282121 CCTTGTCTAGAGGTGCTGAAAGG - Intergenic
960989723 3:123302537-123302559 GGTTCTCCTGAGGTGGGGTAGGG + Intronic
963480347 3:145865460-145865482 CCTTCTCCAGAAGAGGAGAAAGG + Intergenic
968463122 4:735805-735827 CCTTCTCCAGAAATGGTGGCTGG - Intronic
969001358 4:3985065-3985087 CCGTCTCCAGAGGTTCAGTATGG - Intergenic
969752654 4:9123634-9123656 CCGTCTCCAGAGGTTCAGTATGG + Intergenic
969812560 4:9659797-9659819 CCGTCTCCAGAGGTTCAGTATGG + Intergenic
973878799 4:55248013-55248035 CCTGCTCCTGGGGTGGTGAAGGG - Intergenic
975647084 4:76555821-76555843 CTTTTCCCAGAGGTGGGGTAGGG - Intronic
975830214 4:78361273-78361295 CTTTCCCCAGATTTGGTGTATGG - Intronic
975847479 4:78540474-78540496 CTTTCTTCAGAGGTGGTCTGTGG + Intronic
978275978 4:106950445-106950467 CCTTTTCCACAGGTGCAGTAGGG - Intronic
978384392 4:108166551-108166573 CCTAGTCCAGAGCTGGTCTAGGG - Intronic
983923229 4:173370168-173370190 CCGCCTCCTGAGGTGGAGTACGG - Intronic
988594810 5:32581748-32581770 CCTTCCCCAGGGCTGGTGTGGGG + Intronic
997011055 5:129878215-129878237 GCTTATCCAGAAGTGGTGAAAGG - Intergenic
1000273078 5:159705314-159705336 CCTCCCCCAGAGGTGGTGGGTGG + Intergenic
1002174361 5:177393217-177393239 CCTTATCCTCAGGGGGTGTAAGG - Intronic
1003552941 6:7115151-7115173 CCCTCTCAAGAGGAGATGTATGG - Intronic
1004588366 6:17025279-17025301 CATTGTCCCAAGGTGGTGTAGGG - Intergenic
1006018505 6:31102656-31102678 GCTTCTCCAGAGATGCTGTCTGG + Intergenic
1006464030 6:34180403-34180425 CCTTCTGCAGCGTTGTTGTAAGG - Intergenic
1007811827 6:44491752-44491774 CCTTCTCCAGAGATGGGGGTGGG - Intergenic
1008888934 6:56463035-56463057 CCATCTGCAGAGGTATTGTAAGG - Exonic
1009047616 6:58248907-58248929 CCTTATCGAAAGGGGGTGTAGGG - Intergenic
1010730304 6:79383578-79383600 CCTTCTCCAGTGGTTGTTCAGGG - Intergenic
1011215536 6:85001740-85001762 TCTTCTCCAGAGTTTGTGGATGG - Intergenic
1014917891 6:127175421-127175443 CCTTCTTCAGTGGTGGCATATGG + Intronic
1016300750 6:142628715-142628737 CATTCTCCAGAGGTGGGGGTTGG - Intergenic
1017038125 6:150285434-150285456 CCTTATCTAGAGGTAGGGTAGGG - Intergenic
1017950376 6:159130730-159130752 GCTTCTCCAGATGTGGCCTATGG + Intergenic
1017982529 6:159413572-159413594 CCATCTTCAGATGTGGTGCAAGG + Intergenic
1018816761 6:167338779-167338801 TCTTCTCCAGTGTTGGTGTTGGG - Exonic
1020641428 7:10758895-10758917 CCTTCTCCAAAGGTGGTTACTGG - Intergenic
1020984408 7:15114210-15114232 CCTTCACCAGAAGTGGTGTTAGG - Intergenic
1023523849 7:41078136-41078158 CCCTTTCCTGAGCTGGTGTATGG + Intergenic
1024299322 7:47874532-47874554 ACTTCTCAAGATGTGGTCTATGG + Intronic
1024968703 7:55049480-55049502 CCTTCTCCAGAGATGTTTAAGGG - Intronic
1029421576 7:100474583-100474605 CCTTCTCCAGAGCTGGAGGAGGG - Intronic
1030930919 7:115522330-115522352 CATTCTCCTGAGGTGGTATTGGG + Intergenic
1033411821 7:141125269-141125291 CTTCCTCCTGAGGTGATGTATGG - Intronic
1033630366 7:143151760-143151782 CCTTCTCCAGAGGTCTTCTTTGG + Intergenic
1034169801 7:149054210-149054232 CCTTCTCCCAGGGTGGTGAAGGG + Intergenic
1036117007 8:5969822-5969844 CCTTCTAAAGAGGTGGCTTAAGG - Intergenic
1036375871 8:8199028-8199050 CCGTCTCCAGAGGTTCAGTATGG + Intergenic
1036743882 8:11390487-11390509 CCTTCTCCTGAGGATGTGGAGGG - Intronic
1036853657 8:12224115-12224137 CCGTCTCCAGAGGTTCAGTATGG - Intergenic
1036875033 8:12466625-12466647 CCGTCTCCAGAGGTTCAGTATGG - Intergenic
1037603377 8:20417639-20417661 CATTAGCCAGAGGTAGTGTATGG - Intergenic
1037974982 8:23202607-23202629 TCTTGTCCAGAGGTGGAGTGAGG - Intronic
1038447102 8:27611789-27611811 CCTTCCCCAGAGATGGGGTAGGG + Intronic
1038896646 8:31790832-31790854 CCTTGTCCAGGGGTGGTTAATGG + Intronic
1040989081 8:53329850-53329872 CAGTCTCCAGAGGTTGTGTGAGG + Intergenic
1042466662 8:69136052-69136074 CCTTCTCCAGTGGAGGTGGCAGG + Intergenic
1043386062 8:79748912-79748934 CTTTCTCCAGAGCTGGTGGAAGG - Intergenic
1048014530 8:130485636-130485658 CCTCCTCCACAGGTGGGATATGG - Intergenic
1049542681 8:143215595-143215617 CATTCTCCAAAGCTGGTGCAGGG - Intergenic
1051374097 9:16386784-16386806 CCTTCTCCAAAGGTCTTGTCAGG - Intergenic
1053272168 9:36757844-36757866 CCTTCTTCAGTGTTGGTTTAGGG + Intergenic
1055671630 9:78612790-78612812 CCTTCCTCAGAAGTGGTTTAGGG - Intergenic
1055889519 9:81108051-81108073 CCTTCTCCAGGGGAGTTTTATGG - Intergenic
1058181416 9:101804857-101804879 CTTTATCCAGAGGTGGTATCTGG + Intergenic
1059751156 9:117248751-117248773 CCTTTTCCAGATGGGGTGTTTGG - Intronic
1060717286 9:125944182-125944204 CCTTCTCCAGAGATGCTCTTGGG + Intronic
1061669741 9:132182178-132182200 CCTTCCCCAGAGCTGGTGCGTGG - Intronic
1203747298 Un_GL000218v1:47259-47281 CCTATTCAAGAGGTGGTGTGAGG + Intergenic
1189146008 X:38655501-38655523 CTTTCTCCTGAGGTGATTTAAGG - Intronic
1189284011 X:39839186-39839208 CATGCTGGAGAGGTGGTGTATGG - Intergenic
1196007711 X:110853533-110853555 CCTTATCCAGAGGTGCTCTAAGG - Intergenic
1198167393 X:134071114-134071136 CCTTTTCCTGAGTTGGTGGATGG + Intergenic
1198463556 X:136884925-136884947 CCTTTTTAAGAGGTGGAGTAAGG + Intergenic
1199677119 X:150198199-150198221 CCTTCTCCAGAGCAGTTGTGGGG + Intergenic