ID: 1165035763

View in Genome Browser
Species Human (GRCh38)
Location 19:33032403-33032425
Sequence CCTTCTCCAGAGGTGGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165035755_1165035763 12 Left 1165035755 19:33032368-33032390 CCACTGGTGACTGAGCTCGATCT No data
Right 1165035763 19:33032403-33032425 CCTTCTCCAGAGGTGGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165035763 Original CRISPR CCTTCTCCAGAGGTGGTGTA GGG Intronic