ID: 1165038232

View in Genome Browser
Species Human (GRCh38)
Location 19:33049953-33049975
Sequence CTGTTCCCCCAAAAGATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 145}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165038232_1165038245 26 Left 1165038232 19:33049953-33049975 CCCCACATCTTTTGGGGGAACAG 0: 1
1: 0
2: 2
3: 24
4: 145
Right 1165038245 19:33050002-33050024 TAGCCCATGATGGCCTGGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 222
1165038232_1165038246 27 Left 1165038232 19:33049953-33049975 CCCCACATCTTTTGGGGGAACAG 0: 1
1: 0
2: 2
3: 24
4: 145
Right 1165038246 19:33050003-33050025 AGCCCATGATGGCCTGGTGGGGG 0: 1
1: 0
2: 0
3: 30
4: 244
1165038232_1165038238 16 Left 1165038232 19:33049953-33049975 CCCCACATCTTTTGGGGGAACAG 0: 1
1: 0
2: 2
3: 24
4: 145
Right 1165038238 19:33049992-33050014 TCCCGCCTCATAGCCCATGATGG 0: 1
1: 0
2: 0
3: 4
4: 75
1165038232_1165038244 25 Left 1165038232 19:33049953-33049975 CCCCACATCTTTTGGGGGAACAG 0: 1
1: 0
2: 2
3: 24
4: 145
Right 1165038244 19:33050001-33050023 ATAGCCCATGATGGCCTGGTGGG 0: 1
1: 0
2: 1
3: 8
4: 110
1165038232_1165038242 21 Left 1165038232 19:33049953-33049975 CCCCACATCTTTTGGGGGAACAG 0: 1
1: 0
2: 2
3: 24
4: 145
Right 1165038242 19:33049997-33050019 CCTCATAGCCCATGATGGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 151
1165038232_1165038247 28 Left 1165038232 19:33049953-33049975 CCCCACATCTTTTGGGGGAACAG 0: 1
1: 0
2: 2
3: 24
4: 145
Right 1165038247 19:33050004-33050026 GCCCATGATGGCCTGGTGGGGGG 0: 1
1: 0
2: 2
3: 17
4: 206
1165038232_1165038243 24 Left 1165038232 19:33049953-33049975 CCCCACATCTTTTGGGGGAACAG 0: 1
1: 0
2: 2
3: 24
4: 145
Right 1165038243 19:33050000-33050022 CATAGCCCATGATGGCCTGGTGG 0: 1
1: 0
2: 0
3: 18
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165038232 Original CRISPR CTGTTCCCCCAAAAGATGTG GGG (reversed) Intronic
901493391 1:9607930-9607952 CAGTTCCCCCCAAAGAAATGGGG + Intronic
902110930 1:14077662-14077684 GTGTTTCCCAAAAAGATATGTGG + Intergenic
903442186 1:23396411-23396433 CTGTTGCACCAAAAGGTGTTTGG - Intronic
903603117 1:24556316-24556338 CACTTCCTCCAACAGATGTGGGG - Intronic
905253558 1:36665527-36665549 GTGTTCCTCCAAAAGATGAGGGG - Intergenic
908139966 1:61174117-61174139 CTTTTCCCCCTTCAGATGTGAGG + Intronic
913304689 1:117415326-117415348 GTCTTCACCTAAAAGATGTGTGG + Intronic
915090608 1:153421681-153421703 CTGATCTCCCAAAAGAAGAGAGG + Exonic
915094899 1:153455443-153455465 CTGATCTCCCAAAAGAAGAGAGG - Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
918272292 1:182913440-182913462 CTGTGACCCCAAAATATGTGGGG - Intronic
918793567 1:188861830-188861852 CTTTTCCCCCCAAAAAAGTGAGG - Intergenic
921744109 1:218718181-218718203 CTGTTCCCCCACAATATATATGG + Intergenic
923266545 1:232319826-232319848 CTGCTCCACAAAATGATGTGGGG + Intergenic
924464957 1:244291331-244291353 CTGTTACCCCAGAATATGGGAGG + Intergenic
924710521 1:246527159-246527181 CTGTTCCCTCAAAAGGAGGGTGG + Intergenic
1065481891 10:26203656-26203678 CTTTTCTCCCAAAATATCTGTGG + Intronic
1065949607 10:30640019-30640041 CTGTTCCCCAAAAACCTATGGGG + Intergenic
1066711213 10:38236772-38236794 TTGTTTCTCCAAAATATGTGAGG + Intergenic
1070458570 10:76642379-76642401 CTGTTTCTCCACAAGAAGTGGGG + Intergenic
1072991751 10:100202257-100202279 GTGGTCCCCCAAAAGATATGTGG + Intronic
1074379728 10:112969452-112969474 ATGTTTCCCCAAAAGATGTGTGG - Intronic
1074561824 10:114541966-114541988 GTGTTCCCCCAAAACATGCTGGG - Intronic
1075096579 10:119475311-119475333 CTGTTTCCCCAACATATGAGTGG + Intergenic
1076473030 10:130732946-130732968 CTGAACCCCAGAAAGATGTGTGG - Intergenic
1077128524 11:956870-956892 CTGTGACCCCAGAATATGTGGGG + Intronic
1078379064 11:10823214-10823236 CTGTGACCCCAAACTATGTGGGG - Intronic
1079339524 11:19600498-19600520 CTGATCCCCCAAAACTTTTGAGG + Intronic
1080826285 11:35851907-35851929 CTGCACCCCCAAGAGAAGTGTGG + Intergenic
1081043962 11:38249475-38249497 CTCTTTCCCCAAAATATCTGAGG - Intergenic
1082580779 11:54865622-54865644 CTGATTCCCCAAAGGATGTTTGG - Intergenic
1084672144 11:70613590-70613612 GTGTCCCCCAAAAAGAGGTGTGG + Intronic
1085844883 11:80053587-80053609 CTGTATCCTCAAAAGATGTGGGG - Intergenic
1091190617 11:133692737-133692759 CTGCTCCCCGCAAAGAGGTGTGG - Intergenic
1091625157 12:2115894-2115916 CTGTTACCCCAACACATGAGTGG - Intronic
1095350218 12:41201449-41201471 CTTTTCCCCCAACAAATGTATGG + Intronic
1095783626 12:46086950-46086972 TAGTTCCCCCAAAACATGTGTGG + Intergenic
1096956214 12:55528928-55528950 CTGTTCCCCAAAAACCTATGGGG + Intergenic
1097952932 12:65452909-65452931 ATGTTTCCCCAAAATATGTCTGG - Intronic
1098356537 12:69617625-69617647 CTGTGACCCCAAAATATGTGTGG - Intergenic
1098479582 12:70943138-70943160 CTGTTCCCCCCAAGGATATTAGG + Intergenic
1099627660 12:85095677-85095699 CTATTCCACAAAAAAATGTGAGG - Intronic
1100131947 12:91505841-91505863 CTTTTCCACCAAAATATTTGTGG + Intergenic
1103089901 12:118090448-118090470 ATGTCCCCCAAAAAGATATGTGG - Intronic
1104177702 12:126348997-126349019 CAGTTCCTCCAAATGATGTATGG - Intergenic
1106231432 13:27824034-27824056 CTCTTCCCCCAAAAAAAGTGAGG + Intergenic
1108055821 13:46483937-46483959 CCGTGACCCCAAAATATGTGGGG - Intergenic
1109263277 13:60167946-60167968 CTGTGACCCCAAAATATGTAAGG - Intergenic
1112113081 13:96323989-96324011 CTCTTCCCACAAAGGATATGAGG + Intronic
1113595397 13:111528266-111528288 CTGTTCCCATACATGATGTGGGG + Intergenic
1115909392 14:38238776-38238798 CTGTTCCACAAAATGATTTGGGG + Intergenic
1116568887 14:46489223-46489245 CTGTTGGCCCAGAAGATCTGCGG - Intergenic
1119170335 14:72530159-72530181 CTGCTGCCCCATAAGAAGTGAGG - Intronic
1122216295 14:100206829-100206851 CTGTGACCCCAAAATATATGGGG - Intergenic
1122581085 14:102772032-102772054 ATGTTCTCCCAAAAGATTTCGGG + Intergenic
1126073585 15:44886984-44887006 CTGTGCCACCACAGGATGTGGGG - Intergenic
1126555350 15:49981719-49981741 CTGTTTCCCAAAAAGATTTGAGG + Intronic
1128144856 15:65327318-65327340 CCCTTCTCCCAAATGATGTGTGG - Exonic
1128713545 15:69890150-69890172 CTGTTTTCCCAAAGGAAGTGGGG - Intergenic
1129055443 15:72816803-72816825 CTGTTACACCAAAAGGTGTGGGG + Intergenic
1129683990 15:77674427-77674449 CTGTTACCCAAAATGAAGTGGGG - Intronic
1131302842 15:91214765-91214787 GTGTTCCCCAAACAGTTGTGGGG + Intronic
1133878554 16:9758821-9758843 CTGTTCACCAAAAAGAGATGGGG + Exonic
1136999056 16:35213084-35213106 CTTTTCACCCCAAAGAGGTGGGG - Intergenic
1137236881 16:46624400-46624422 CTGTTCCCCCAAAAACAGAGGGG + Intergenic
1137248192 16:46722353-46722375 CTGTCCCCCCAGAGGGTGTGAGG + Intronic
1137546125 16:49404963-49404985 GTGTTCTTCCAAATGATGTGTGG - Intergenic
1137697661 16:50472795-50472817 CTGAGACCCCAAAATATGTGGGG - Intergenic
1137997329 16:53232982-53233004 CTGTAACCCCAAAATATGTGGGG + Intronic
1138327560 16:56188759-56188781 AGGTTCCCCCAAAGGACGTGAGG - Intergenic
1141801380 16:86311639-86311661 CTGGATCCCCAAAAGTTGTGTGG + Intergenic
1144722860 17:17484424-17484446 CTGTTCCCACAAAAGAGGTCTGG - Intronic
1146494246 17:33306876-33306898 TCGTTGCCCCAAAAGCTGTGAGG - Intronic
1149268187 17:54950895-54950917 CTGTGGCCCCCAAATATGTGAGG + Intronic
1156630243 18:38958983-38959005 CTGGTTCCCCCAAAGATTTGAGG + Intergenic
1156813617 18:41282015-41282037 CTGTGACCCCAAAATATGTGGGG + Intergenic
1160223694 18:76996348-76996370 CTTTTCCCTCAAAAGATTGGTGG - Intronic
1160346423 18:78135877-78135899 CTTTGCCCCCAAAAGGTGTAGGG - Intergenic
1160410639 18:78673418-78673440 GTGTTCCCCAAAGAGATGTGTGG + Intergenic
1160953548 19:1679185-1679207 CAGTTTCCCCAGAAGATGGGGGG - Intergenic
1165038232 19:33049953-33049975 CTGTTCCCCCAAAAGATGTGGGG - Intronic
1165430023 19:35767210-35767232 CTGGGGGCCCAAAAGATGTGTGG - Intronic
1166444091 19:42843932-42843954 CTGTTCCCCCAAATGAGACGGGG - Intronic
925019951 2:560572-560594 CATTTTCCCCAAAATATGTGGGG + Intergenic
927269031 2:21185757-21185779 CTGTTCATTCAAAAGATGTGGGG + Intergenic
929024328 2:37585239-37585261 CTGTTCCACCTGAAGATTTGAGG - Intergenic
929782062 2:44963434-44963456 CTGTGCCCCAGAAAGCTGTGGGG - Intergenic
930194683 2:48497267-48497289 CTGTGACCCCAAAATATGTGGGG - Intronic
931022422 2:58063282-58063304 CTCTTCTCCCAAAATAGGTGAGG - Intronic
931028836 2:58147065-58147087 CATTTCCCCCAAATGATTTGAGG + Intronic
931071656 2:58658383-58658405 ATGCTCCCCCAGAAGCTGTGGGG - Intergenic
931214728 2:60230264-60230286 CTGTGCGCCCCAAACATGTGTGG - Intergenic
937146211 2:119647090-119647112 CTGTTTTCCAAAAATATGTGAGG + Intronic
937308873 2:120889103-120889125 CTGGTCCTCCGAAAGAAGTGCGG + Intronic
938059219 2:128239109-128239131 CTGTTCCCCCAAAATTCCTGTGG - Intronic
938703430 2:133899391-133899413 CTTTTCCCCCCAAACCTGTGAGG + Intergenic
938976017 2:136479727-136479749 CTGTTCCTCCACAAGCTGGGTGG + Intergenic
939623166 2:144445703-144445725 ATTTTCCCCCAAAAAATGAGGGG - Intronic
941013683 2:160330788-160330810 GTGTTCCCCCAAAAGATATGTGG + Intronic
943952164 2:194144917-194144939 CTGTTCCCCCACATGGTGTGTGG - Intergenic
944900397 2:204207978-204208000 CTGTTCACCCAAAGGGTGTGTGG - Intergenic
1170479767 20:16754311-16754333 CTGTTGGCCCTAAAGATCTGGGG + Intronic
1173440743 20:43073404-43073426 CATTTCCCCCTAAAGATTTGAGG - Intronic
1173473741 20:43343710-43343732 CTGATCCCACACAAGAGGTGAGG - Intergenic
1174726886 20:52871747-52871769 CTGCACCCCCAAAAGAAGAGAGG - Intergenic
1175469738 20:59219051-59219073 TGGTTCCCCCTAAAGAAGTGGGG + Intronic
1178863368 21:36307681-36307703 CAGTCTCCCCAAAAGTTGTGAGG - Intergenic
1181558907 22:23688379-23688401 CTGTTTCCCCCAAACAAGTGGGG - Intronic
1183714941 22:39528123-39528145 CTCTGCCCCCGGAAGATGTGTGG + Intergenic
949966182 3:9358483-9358505 CTGGGACCCCAAAATATGTGGGG + Intronic
955266795 3:57451864-57451886 CTGTTTCCCCATAAGATCTCAGG + Intronic
957893737 3:86391477-86391499 GTATTTTCCCAAAAGATGTGTGG + Intergenic
961750000 3:129089097-129089119 CTGTTCCCCCAAAAACAGAGGGG + Exonic
963227047 3:142872904-142872926 ATTTTCCCCCAAAAGATTTATGG + Intronic
963718744 3:148835321-148835343 GTTTTCCCCTAAAGGATGTGAGG - Intronic
965842356 3:172921394-172921416 CTGTTCTACCAAGACATGTGAGG + Intronic
971514522 4:27469545-27469567 CTGTGACCTCAAAATATGTGGGG - Intergenic
971589052 4:28443540-28443562 CTGTGCTCCCAAAAGATGCCTGG + Intergenic
975835174 4:78415343-78415365 CTGTTCCCCCCAAAAATCTATGG + Intronic
978570125 4:110127860-110127882 GTTTTCCCCCAAAACATGTCTGG - Intronic
981902145 4:149879175-149879197 CAGTTCGCCCAAAAGATATATGG - Intergenic
982454475 4:155592219-155592241 CTTTTGCCCCAAAATATATGAGG + Intergenic
983935517 4:173500301-173500323 CTGCTCCCCCAAGAGCTGCGGGG + Intergenic
983975960 4:173934845-173934867 CTGTTCCTTCAAAAGAGGTTAGG - Intergenic
986557529 5:9026338-9026360 CTGGTCCCTCCAATGATGTGGGG - Intergenic
986737358 5:10678016-10678038 ATGTTTCCCCAAAAGATATGTGG + Intergenic
987314624 5:16712678-16712700 CTATTCCATCAAAAGCTGTGAGG - Intronic
993885261 5:93408625-93408647 ATGTTCCCCCAAAAGACATTTGG + Intergenic
995016699 5:107318115-107318137 GTGTCTCCCCAAAAGATGTAGGG + Intergenic
996559199 5:124810418-124810440 CTGCTTCCACAAAAGATGTGTGG + Intergenic
999784247 5:154877169-154877191 CTGTTGACACAAAATATGTGGGG + Intergenic
1000446305 5:161326286-161326308 CTGTTCCCTTAAAAAATGTGTGG - Intronic
1001356806 5:171034765-171034787 TTTTTCCCCCAAAAGATGCTGGG - Intronic
1005726658 6:28655757-28655779 CTGTTCCCCCATAAAATTTGAGG + Intergenic
1008586788 6:52958029-52958051 CTGTGACCCCAAAATATGTGGGG + Intergenic
1013611975 6:111804273-111804295 CAGTTCCCCCATAAAATCTGAGG - Intronic
1013826402 6:114215877-114215899 CTGTGGCCCCAGAAGATGAGTGG - Intronic
1016684850 6:146869511-146869533 TTTTTCCCACAAAAGATGTATGG - Intergenic
1017663408 6:156695719-156695741 CTGATCCCGCCAAAGCTGTGGGG - Intergenic
1020407307 7:7852275-7852297 CTGTGACCTCAAAATATGTGGGG + Intronic
1021602657 7:22379695-22379717 CTTTTCCCCTAAAAGCTTTGAGG - Intergenic
1021774687 7:24041033-24041055 CTCCTCCCCCAAAGGATGGGTGG - Intergenic
1029175328 7:98660565-98660587 CTGTTGGCCCAGAAGATCTGGGG + Intergenic
1033796369 7:144849950-144849972 GTGTTCCTCCCAAAGCTGTGCGG - Intergenic
1036601784 8:10267682-10267704 CTGATCCCCCAGCAGGTGTGGGG - Intronic
1037131757 8:15414938-15414960 GTGTCCCTCCAAAAGATCTGTGG - Intergenic
1037341749 8:17853120-17853142 CTGTTCCCCCAAACCCTATGGGG - Intergenic
1038619613 8:29128499-29128521 CTTTTCCCACAAAATATCTGAGG - Intronic
1038849352 8:31259544-31259566 ATGTTACCCCAAAAGATATGTGG + Intergenic
1039573137 8:38602842-38602864 GTGTTCCCCAAAAAGATATGTGG + Intergenic
1039856291 8:41417196-41417218 CTTTCCCCCCAAAAGACCTGTGG + Intergenic
1044008489 8:86964640-86964662 CTGCTCCTACAACAGATGTGTGG - Intronic
1046374973 8:113366065-113366087 CTGTTTCACCAAAAAAGGTGGGG + Intronic
1047501465 8:125445072-125445094 GTTTTCCCCCAAAAGAGGTAAGG - Intergenic
1049158396 8:141081677-141081699 CTTTGACCCCAAAATATGTGGGG + Intergenic
1050013358 9:1208132-1208154 CTGATGTCCAAAAAGATGTGGGG - Intergenic
1050362660 9:4845467-4845489 CTGTTTCCTCAAAATAGGTGAGG + Intronic
1052290897 9:26839493-26839515 GTGTTCAACAAAAAGATGTGTGG + Intergenic
1055697511 9:78902740-78902762 CTTTTCCTCCAAAAAATCTGAGG + Intergenic
1058373274 9:104294437-104294459 CTTTTCCCCCAAAACAGATGAGG - Intergenic
1059742809 9:117169562-117169584 CTGTTCCCCCAAACAATGACAGG + Intronic
1059770220 9:117416831-117416853 CTGTGAACCCAAAGGATGTGTGG + Intergenic
1061790293 9:133055597-133055619 CTTTTCCCAGAAAAGATGTCAGG + Intronic
1062144757 9:134982848-134982870 CTGTCCCCCAGAAAGATATGGGG - Intergenic
1187110803 X:16297783-16297805 CTGGTCCCCCAAGAGACCTGAGG - Intergenic
1189464132 X:41265206-41265228 CCGTGACCCCAAAATATGTGGGG - Intergenic
1189523699 X:41797786-41797808 CTGTTACCCCATAGGCTGTGTGG + Intronic
1197582145 X:128296612-128296634 CTGTTCCACTAATATATGTGGGG - Intergenic
1198971049 X:142280606-142280628 CTGTTCTTCAAAAGGATGTGAGG - Intergenic
1200254688 X:154573893-154573915 CGGTTACCCCAACGGATGTGTGG + Intergenic
1200263081 X:154630515-154630537 CGGTTACCCCAACGGATGTGTGG - Intergenic
1200751518 Y:6948866-6948888 CTGTTTTCCCTAAAGCTGTGAGG - Intronic