ID: 1165040472

View in Genome Browser
Species Human (GRCh38)
Location 19:33064706-33064728
Sequence CCGGGCCCTGCAGGGGCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 376}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165040472_1165040486 3 Left 1165040472 19:33064706-33064728 CCCACGGCCCCTGCAGGGCCCGG 0: 1
1: 0
2: 2
3: 33
4: 376
Right 1165040486 19:33064732-33064754 AAAGGAGGTCTGGAGCCCGCAGG 0: 1
1: 0
2: 0
3: 12
4: 136
1165040472_1165040483 -7 Left 1165040472 19:33064706-33064728 CCCACGGCCCCTGCAGGGCCCGG 0: 1
1: 0
2: 2
3: 33
4: 376
Right 1165040483 19:33064722-33064744 GGCCCGGGGGAAAGGAGGTCTGG 0: 1
1: 0
2: 4
3: 40
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165040472 Original CRISPR CCGGGCCCTGCAGGGGCCGT GGG (reversed) Intronic
900124623 1:1063980-1064002 GCGGGCGCTGCAGGGGCGGGCGG - Intergenic
900255764 1:1697652-1697674 CCAGACCCCGCAGGAGCCGTGGG + Intronic
900432066 1:2607166-2607188 CGGAGCACTGCAGGGGCTGTGGG - Intronic
900559571 1:3297163-3297185 CCGGGACCTGGAGGGGCCACTGG - Intronic
900644442 1:3702633-3702655 CCAGGCCCTGCTGGGGCCCCAGG - Intronic
901493092 1:9606556-9606578 CCACGCCCTGCAGGAGCCGGGGG - Intronic
901639263 1:10685196-10685218 CCGGGCCCTGCAGGGGAGAAGGG + Intronic
901657635 1:10779435-10779457 CAGCGCCCTGCGGGGGCCGTGGG + Intronic
903173667 1:21568616-21568638 CCTGGCTCTGCAGGCGCCCTGGG + Intronic
904533289 1:31182641-31182663 CAGGGCCCGGCAGGGGGCGGAGG - Intronic
904822863 1:33256586-33256608 CCCGGCCCTGCTCGGGCCGCCGG + Exonic
905182271 1:36174846-36174868 CCGGGCCCGGCAGGAGCCAGTGG - Intronic
905734835 1:40317588-40317610 CTGGGCCCTGGAGAGGACGTAGG - Intronic
906676062 1:47694431-47694453 CCGGGGTCTGCGGGGGCTGTGGG + Intergenic
907453914 1:54563068-54563090 ACGGGCCCCGCAGGGCCCGAGGG - Intronic
907540879 1:55214901-55214923 CCGGGCCCGGCGGGGGCCCGCGG - Exonic
911125413 1:94336890-94336912 CCAGCCACTGCAGGGGCCGAGGG + Intergenic
911700017 1:100941816-100941838 CCAGGCACTCCAGGGGCCTTGGG - Intronic
912418956 1:109530683-109530705 CAGGGCCCTCCAGCGGCCCTTGG + Intergenic
914343563 1:146779672-146779694 CTGGGCCCTGCAGGGGGCAGTGG - Intergenic
915229134 1:154432856-154432878 CCAGGCCCTGCAGTGGCCTGAGG - Intronic
915273103 1:154769150-154769172 CCGGGTCCTGGAGGGGCATTTGG - Intronic
915313439 1:155015832-155015854 AAGGGCCCGGCAGGGGCCATGGG + Intronic
915365819 1:155315149-155315171 CAGAGCCCAGCATGGGCCGTGGG - Intronic
915482104 1:156194049-156194071 CCGCCCCCTGCAGGGGGCGGAGG - Intronic
919640033 1:200038460-200038482 CGGCGCCCTGAAGGGGCCGAGGG - Intronic
920051196 1:203166086-203166108 CTGGGCCCTGCAGGAGGCCTGGG + Exonic
922768072 1:228166240-228166262 CCGGGGCCTGCAGAGGGCGTGGG + Intronic
922918220 1:229276286-229276308 CCGGGCCGTGCAGGTGCTGTTGG + Intronic
923930088 1:238684893-238684915 CCGGGGCCGGCAGGGCCCGCCGG + Intergenic
1062857101 10:784836-784858 CCGGGCGCTGCGGGGGCGGGAGG - Intergenic
1063407731 10:5813142-5813164 GCGGGCCGTGCAGGAGCCGGGGG + Intronic
1064236116 10:13577385-13577407 CCGGGGCCTGCAGGGGGTGGAGG - Intergenic
1064237270 10:13587568-13587590 ACGTGCCCTGCATTGGCCGTGGG + Intronic
1066504014 10:36023329-36023351 CAGAGCCCTGCCTGGGCCGTGGG + Intergenic
1067479424 10:46585339-46585361 CCAGGGCCTGCAGGAGCCGTGGG + Intronic
1067539173 10:47139307-47139329 ACGTGCCCTGCAGAGGCCCTGGG - Intergenic
1067615314 10:47756459-47756481 CCAGGGCCTGCAGGAGCCGTGGG - Intergenic
1067713813 10:48671726-48671748 CCGGGCCCTGCAGGTGGGGCCGG - Intergenic
1069898637 10:71694633-71694655 CAGGGCCCTGGAGGGTCCCTGGG + Intronic
1071630715 10:87216410-87216432 CCAGGGCCTGCAGGAGCCATGGG - Intergenic
1073291852 10:102417030-102417052 CTGGGCCATGCTGGGGCCGGGGG + Exonic
1073465551 10:103692886-103692908 CCTGGCCCGGCAGGACCCGTAGG + Intronic
1073812412 10:107164878-107164900 CCGGGCGCTGGAGGCGCCGCCGG + Intergenic
1073921714 10:108466563-108466585 CCGGGCGCTGGAGGCGCCGCCGG + Intergenic
1076156717 10:128210731-128210753 CCGGGACAGGCAGGGGCCGCAGG - Intergenic
1076204156 10:128581925-128581947 CAGGGGCCTGCAGGGGCCTGTGG - Intergenic
1076444249 10:130500929-130500951 CAGGGTGCTCCAGGGGCCGTTGG + Intergenic
1076723520 10:132403054-132403076 CTGAGCCCTGCAGCAGCCGTGGG - Intronic
1076794803 10:132793310-132793332 CCGGGTCCTGCATGGCCCCTGGG + Intergenic
1076822432 10:132946188-132946210 CCTGGCCCTGCACAGGTCGTCGG - Intergenic
1076847516 10:133076493-133076515 ACGTGCCCTGCAAGGGCTGTGGG - Intronic
1077100245 11:819365-819387 CCGTGCCCAGCAGGGGCGGAGGG + Intronic
1077309527 11:1882242-1882264 CCAGGCCCTGCAGGGCGGGTGGG - Intronic
1077334657 11:1997936-1997958 GTGGGCCCTGCGGGGGCCCTCGG - Intergenic
1077352276 11:2098554-2098576 CAGGGCCCTGCTGGAGCCGGGGG - Intergenic
1077425469 11:2473958-2473980 CGGGGCACTGCAGGGCCCTTGGG + Intronic
1077442908 11:2577022-2577044 GCGGGCCCTGCATTGGCCCTGGG - Intronic
1079071801 11:17353543-17353565 CCGGGCCCGGGAGGGGGCGCGGG - Intronic
1080457614 11:32430608-32430630 CCGTGCCCGGCGAGGGCCGTGGG + Intronic
1081428373 11:42949983-42950005 CCGGGGCCGGCAGGGCCCGCCGG - Intergenic
1082080050 11:48005958-48005980 CCTGGCCCAGCAGGGGCAGGTGG - Intronic
1083479366 11:62933848-62933870 CCTGGCCCTGCAGGGGAAGGGGG - Intergenic
1083755419 11:64789415-64789437 CCTGGCCCTGCTGGGGCTGAAGG - Exonic
1084155538 11:67310810-67310832 CCAGGGCCTGCAGGGGCCTGTGG - Intronic
1084309882 11:68310933-68310955 GCAGGCCCTGCAGGTGCCGAAGG + Intergenic
1084496926 11:69510603-69510625 CCAGACCCAGCAGGGGCTGTGGG - Intergenic
1084913001 11:72406361-72406383 CTCGGCCCTTCAGGGGCAGTAGG - Intronic
1084936754 11:72590756-72590778 CCGGACGCTCCAGGGGCTGTGGG - Intronic
1085764851 11:79273904-79273926 CCTGGCCCTCCAGGGGCAGCGGG + Intronic
1088376854 11:109150762-109150784 CTGGGTCCTGCTGGGGCCGCAGG + Intergenic
1088597428 11:111450711-111450733 CCGGTCCCTGCAGGGTCAGAGGG + Intronic
1088848852 11:113689663-113689685 CCGGGCCCTGCTGGGGACTGGGG - Intronic
1089365734 11:117919939-117919961 CCTGGCCCTGCAGGGCCAGGGGG - Intronic
1089459666 11:118645198-118645220 CCTGGAGCTGCAGGGGCCTTAGG + Intronic
1089466418 11:118689237-118689259 CCGGGGCCAGCAGGGCCGGTCGG + Intergenic
1089466578 11:118689893-118689915 CTGGGCACTGCAGGGGCTGCTGG - Intergenic
1090224801 11:125063470-125063492 TCGGGGCTTGCAGGGGCCGCGGG + Intronic
1202817640 11_KI270721v1_random:53118-53140 GTGGGCCCTGCGGGGGCCCTCGG - Intergenic
1092749634 12:11706701-11706723 TCGGGCCCTGCAAGGGCAGCTGG - Intronic
1093172200 12:15873980-15874002 CCAGGTCCTGCAGGAGCAGTTGG - Intronic
1093435303 12:19129624-19129646 CCGGACCCTGCCGGGGCGGCGGG + Intergenic
1094447524 12:30547179-30547201 CCGGGTCCTGCAGGAGCAGTTGG + Intergenic
1096530663 12:52240928-52240950 CCGGGGCCTGTCGGGGGCGTGGG - Intronic
1096539234 12:52295530-52295552 CAGGGCCCTGCAGAGGGCATGGG - Intronic
1096741152 12:53695164-53695186 CCGGGCCCTGCGGAGGCCGAAGG - Intergenic
1098006549 12:66003570-66003592 CCAGGCCCTGCAGGGGTCCGAGG + Intergenic
1100980230 12:100157539-100157561 CCAGGCCCTGCAGGGGGCCATGG - Intergenic
1102375709 12:112419267-112419289 CCTCGCCCTCCAGGGGCCGGGGG + Intronic
1103800293 12:123533560-123533582 CCGGGCCCAGCCTGGGCCGCGGG + Exonic
1103848799 12:123917847-123917869 GCGGGGCCTGCATGCGCCGTTGG + Intronic
1103940792 12:124500229-124500251 CAGGGGCCAGCAGGGGCCCTGGG - Intronic
1106995049 13:35471270-35471292 CCCGGCCCGGCGGGGGCCGAGGG + Intronic
1107590479 13:41898842-41898864 CCGGGGCCTGCAGGGCCGGCCGG + Intronic
1108314125 13:49221168-49221190 CCGGGCCTCGCAGCGGCCGCCGG - Exonic
1109210658 13:59531661-59531683 CTGGGCCCAGCAGGGGCTGAGGG + Intergenic
1112495525 13:99900955-99900977 CAGGGACCTACAGGGGCCGGGGG - Intergenic
1112509675 13:99998002-99998024 CCGGGACCCACAGGGGCCCTGGG - Intergenic
1113665052 13:112135780-112135802 CCGTCCCCGGCAGGGGCCCTAGG - Intergenic
1113863683 13:113507796-113507818 CCAGGCCCTTCAGGGGCTGCTGG + Intronic
1113991303 14:16029924-16029946 CCGGTACCTGGAGGGGCCCTGGG + Intergenic
1114485407 14:23058712-23058734 CTGGGAACTGCAGGGGCCCTGGG + Exonic
1115203067 14:30874415-30874437 CCGGGGCCGGCAGGGGGCGAAGG + Intergenic
1115646183 14:35369755-35369777 CAGGGCCCTGCAGGTGCGGCCGG + Intergenic
1116452345 14:45080534-45080556 CCGGGGCCGGCAGGGCCGGTCGG - Intergenic
1117302494 14:54443149-54443171 CCGGGGCCGGCAGGGGCGGCCGG - Intergenic
1119264878 14:73258863-73258885 CCAGGCCCTGCCTGGGCAGTGGG + Intronic
1121491626 14:94365189-94365211 CCGGGCTCTGCTGTGGCCTTAGG - Intergenic
1122768684 14:104087402-104087424 CAGGGCCCTGTAGGGGCTGTGGG + Intronic
1122771174 14:104098622-104098644 CCGGAGCCTGCAGGGGCCTGGGG - Intronic
1122785830 14:104162891-104162913 CAGGGCCCTGCAGGTGCAGGTGG - Intronic
1122811933 14:104293421-104293443 CCGGGGGCTGGAGGGGCCGGGGG + Intergenic
1123696607 15:22883350-22883372 TCGGACCCTGAAGGGGCCGGGGG + Intronic
1123923956 15:25090448-25090470 CAGGACCCTTCAGGGGCCATGGG - Intergenic
1123944492 15:25232505-25232527 AGGGGCCCTGCAGGGGGCTTCGG - Intergenic
1128414892 15:67436197-67436219 CTGGGTCCTGCAGGAGCAGTCGG - Intronic
1128454888 15:67826897-67826919 CCGGGCCCTCCTGGGCCCGCCGG - Exonic
1128656684 15:69467763-69467785 CAGGGCCCAACAGGGGCCCTGGG - Intergenic
1128944613 15:71812050-71812072 CTGCGCCCTGCCGGGGCCGGGGG - Exonic
1129516508 15:76160660-76160682 CCTGGTCCTGCAGGGGCCCTGGG + Intronic
1130276171 15:82477405-82477427 CCGGGCCCTGCAGGGGGCCATGG - Intergenic
1130468530 15:84204798-84204820 CCGGGCCCTGCAGGGGGCCATGG - Intergenic
1130485222 15:84394964-84394986 CCAGGCCCTGCAGGGGGCCATGG + Intergenic
1130495734 15:84468744-84468766 CCGGGCCCTGCAGGGGGCCATGG + Intergenic
1130590823 15:85209397-85209419 CCGGGCCCTGCAGGGGGCCATGG - Intergenic
1131188541 15:90294816-90294838 CCGGGCCCTGCAGGGGGCCAAGG + Intronic
1131260363 15:90884557-90884579 CCGGGGCCTGGAGGAGCGGTGGG + Intronic
1132338391 15:101063300-101063322 CCGGGCCCAGCAGGGACTGGAGG - Intronic
1132349982 15:101133529-101133551 CCTGGCCCTGAAGGGGCCTGTGG - Intergenic
1132356399 15:101174327-101174349 CCAGGCCCAGCAGGGGCTGCAGG + Intergenic
1132491639 16:234953-234975 CGGGGTCCTCCAGGGGCCGAGGG - Intronic
1132501264 16:285790-285812 GCGGGGCCTGCAGGGGCAGGGGG - Intronic
1132645476 16:997459-997481 CCGGTGCCTGCAGGGGCCCTGGG + Intergenic
1132903127 16:2268950-2268972 CCGGACCCTGCACCGGCCGATGG - Intergenic
1132994871 16:2817621-2817643 GCGGGCCCTGCAGAGCACGTGGG + Intronic
1133020475 16:2964735-2964757 CCCGCCCCTGCAGGAGCCCTCGG - Intronic
1135111244 16:19692259-19692281 CCGGGCTCTGCATGAGACGTGGG - Intronic
1136399658 16:30010572-30010594 CGGGGCCCTGCAGGGCCCCTTGG - Intronic
1136546665 16:30958403-30958425 GCGGGGCCTGCAGGGGGCGGGGG + Intronic
1137236530 16:46623069-46623091 CCAGGCCCTGCAGGGGTCCGAGG + Intergenic
1137540322 16:49357227-49357249 CCGGCCCCGGCAGGGGGCTTTGG - Intergenic
1138453569 16:57107768-57107790 CCAGGACCTGCAGGAGCTGTGGG - Intronic
1138478271 16:57284652-57284674 CCAGGCGCTGCAGGAGGCGTCGG + Exonic
1138589531 16:57992246-57992268 CTTGGCCCTGCAGGGGACGGGGG - Intergenic
1138619164 16:58197939-58197961 CCCGGCCCTGGAGCGGCCGGCGG + Intergenic
1139603035 16:67998312-67998334 CCGGGGCCAGCAGGGCCCGCGGG - Intronic
1139650679 16:68360638-68360660 CCGGCTCCTGCAGGGTCCGAGGG - Exonic
1139990428 16:70935662-70935684 CTGGGCCCTGCAGGGGGCAGTGG + Intronic
1140469681 16:75207060-75207082 CCAGGCCCTGCGGAGGCCGAAGG - Intronic
1141685357 16:85566904-85566926 CCGGCCACTGCATGGGCAGTAGG + Intergenic
1141686083 16:85570759-85570781 CCAGGCCCTGGAGGGGCTGAGGG + Intergenic
1141699482 16:85635901-85635923 CTGGGCCCAGCAGCGGCCGTGGG + Intronic
1142149067 16:88504831-88504853 CCTGGCCCCACAGGGGCAGTGGG - Intronic
1142376089 16:89707827-89707849 CCAGGCCCTGCAGGGACCCTGGG + Exonic
1142638297 17:1271017-1271039 CTGGGCCCTGCAGGCGGCGGGGG - Exonic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1143664291 17:8347382-8347404 CCGGGGCCTGCAGGGTCGGCCGG + Intergenic
1144874700 17:18391268-18391290 CAAGGCCCTGCAGGGGCAGCAGG + Intergenic
1145157524 17:20553153-20553175 CAAGGCCCTGCAGGGGCAGCAGG - Intergenic
1145910097 17:28537371-28537393 GAGGGGCCTGCAGGGGCCGTGGG - Exonic
1146255667 17:31390669-31390691 CCGGGTCCTGCAGGGCCCCGAGG + Intergenic
1146281771 17:31549626-31549648 TCGGGCCGGGCAGGGTCCGTGGG - Intergenic
1146492298 17:33291959-33291981 GCGGGCGCTGCAGGGGCCAGGGG - Exonic
1146905136 17:36613286-36613308 CCTGGCCCTGCAGGAGTCGGTGG - Intergenic
1147144829 17:38478888-38478910 CCTGGGCCTGCTGTGGCCGTGGG + Intronic
1147722422 17:42547281-42547303 CCTGGGCCTGCTGGGGCCGCTGG + Intergenic
1147723606 17:42553452-42553474 CCTGGGCCTGCTGGGGCCGCTGG + Exonic
1147831199 17:43299331-43299353 CCGGGCCCTGACGGGGGCGTGGG + Intergenic
1149991952 17:61388285-61388307 TCTGGCACTGCATGGGCCGTAGG + Intronic
1150211481 17:63444247-63444269 CTGGGCCTTTCATGGGCCGTTGG - Intronic
1150267848 17:63842520-63842542 CCGGGTCCGGCAGGAGGCGTGGG - Exonic
1151278754 17:73056058-73056080 CTGTGCCCTCCAGGGGCCTTGGG - Intronic
1151576319 17:74954170-74954192 CCTGGCTCTGCAGGGGCAGCGGG + Exonic
1151618911 17:75233045-75233067 CCGGGCCCTGCAGGTTCCTCAGG + Exonic
1151825875 17:76523851-76523873 CTGGGCCCACCAGGGGCCCTGGG + Intergenic
1151944704 17:77313193-77313215 CCTCGCTCTGCAGGGGCAGTCGG + Intronic
1152185866 17:78855998-78856020 CCTGCCCCTGCAGGAACCGTGGG - Intronic
1152317611 17:79590030-79590052 GAGGGCACTGCAGGGGCGGTGGG + Intergenic
1152374791 17:79913489-79913511 CAGGACCCAGCAGGGGCCGCAGG + Intergenic
1152751794 17:82065708-82065730 CCGGGAGCTGCAGGGGCCCCGGG - Intronic
1152753502 17:82077470-82077492 ACGGGCCCTGCTGGGGGGGTGGG - Intergenic
1152854969 17:82659488-82659510 CCGGGCCCTCCAGGGCTCATGGG - Intronic
1154067177 18:11118281-11118303 CTGGGACCTGGAGGGGCCCTGGG + Intronic
1155199387 18:23503749-23503771 CGCGGCCCTGCCGGGGTCGTGGG + Intronic
1159260447 18:66006035-66006057 TCGGGCCCTGCAGGAGCCCACGG + Intergenic
1160309273 18:77773465-77773487 CCAGGACCGGCAGGGGCAGTAGG + Intergenic
1160511651 18:79456458-79456480 TCGGGGCCTGCAGGGGCCTCGGG - Intronic
1160564468 18:79778496-79778518 ACAGGCCGTGCAGGGGCCGGAGG + Intergenic
1160880292 19:1316557-1316579 CCCTGCCTTGCAGGGGCAGTAGG - Intergenic
1161041891 19:2114765-2114787 CAGAGCCCTGTAGGGGTCGTTGG + Exonic
1161079284 19:2302598-2302620 AGGGGCCCTGCAGGGGCAGACGG - Intronic
1161231971 19:3178930-3178952 GGGGGCCCTGCGGGGGCTGTCGG + Exonic
1161519184 19:4714053-4714075 CCGGGCCCTGCAGGCTGCTTGGG - Intronic
1161937447 19:7380901-7380923 CCGGGCCCTGCAGGATCAGAGGG - Exonic
1162739899 19:12767894-12767916 CCTGTCCCTGCAGCGGCTGTTGG - Exonic
1163662800 19:18588826-18588848 GCAGGCACTGCAGGGACCGTAGG - Exonic
1163838922 19:19593791-19593813 CTGAGCCCTGCAGCGGCCTTGGG + Intronic
1164120774 19:22262849-22262871 CTGAGTCCTGTAGGGGCCGTGGG - Intergenic
1164156884 19:22602482-22602504 CCGGGCCCTGCAGGGTGCCATGG + Intergenic
1164551995 19:29219579-29219601 GCAGACCCTGCAGGGGCCCTGGG - Intergenic
1165040472 19:33064706-33064728 CCGGGCCCTGCAGGGGCCGTGGG - Intronic
1165040477 19:33064709-33064731 ACGGCCCCTGCAGGGCCCGGGGG + Intronic
1165067472 19:33237416-33237438 CAGGGCACTGCAGGGGCAGGTGG - Intergenic
1166218889 19:41353107-41353129 CCCGCCCCTGCAGGGGCTGGGGG + Exonic
1166290574 19:41860633-41860655 CCCGGCGTTGAAGGGGCCGTGGG + Intronic
1166725107 19:45022159-45022181 CCGCACCCTGCAGATGCCGTCGG - Exonic
1166738026 19:45097546-45097568 TCAGGCCCTGCAGGGGCCCAGGG + Intronic
1166738828 19:45102063-45102085 CCTGCCCCTGCATGGGCTGTGGG + Intronic
1166903960 19:46090771-46090793 GCTGGCCTTGCAGGGGCTGTGGG + Intergenic
1167266438 19:48485334-48485356 CCGGCCCCTGGAGGGGCCTCTGG - Exonic
1167476836 19:49706218-49706240 CCGGGCCCTCCAGGGGCACGTGG + Exonic
1168115920 19:54221338-54221360 CAGGGCCCTGCAGGGTCAGGAGG + Exonic
1168118903 19:54241086-54241108 CAGGGCCCTGCAGGGTCAGGAGG + Exonic
1168119944 19:54246238-54246260 CAACACCCTGCAGGGGCCGTGGG - Intronic
1168133846 19:54337655-54337677 CAGGGCCCTGCAGGGTCAGGAGG + Exonic
1168187540 19:54709574-54709596 CAGGGCCCTGCAGGGTCAGGAGG - Intergenic
1168452671 19:56478089-56478111 CCAGGGCGTGCAGGGGCCGTTGG - Intergenic
925342210 2:3145576-3145598 CCGGGCCCTCCAGCCCCCGTTGG - Intergenic
926755018 2:16227433-16227455 CTGATCCCTGCAGGGGACGTTGG + Intergenic
927103038 2:19802521-19802543 CTGTGCCCTACAGGGGCCTTCGG - Intergenic
927490191 2:23516239-23516261 CCGGGCCCAGCAGGTGCCCATGG - Intronic
927491911 2:23526433-23526455 GAGGGCTCTGCAGGGGCCGGGGG + Intronic
927857206 2:26535180-26535202 ACGGGCCTTGCAGGGGTGGTGGG + Intronic
928136016 2:28688011-28688033 CCTGGCCCTCCAGGGGCTGTGGG - Intergenic
931746480 2:65295657-65295679 CTGGGCTCTGCTGGGGCAGTGGG + Intergenic
932420354 2:71597744-71597766 CAGGGAGCTGCAGGGGCCTTTGG + Intronic
934077020 2:88437176-88437198 CCGGGCCCTGCAGAGGAGGTAGG - Intergenic
934553721 2:95276865-95276887 CCGGGCTCTGCAGGAGCCGGGGG - Intronic
934677640 2:96260927-96260949 CCAGGCCCTGCGGGGCCTGTTGG - Intronic
934950158 2:98570596-98570618 CCTGGAGCTGCAGGGGCCATGGG + Intronic
936545990 2:113393815-113393837 ACGGGCCCCGCAGGGCCCGAGGG + Intergenic
937000936 2:118466889-118466911 CCGGGCCCTGCTAGGACAGTAGG - Intergenic
937061285 2:118982179-118982201 CCGGGCCCTCCTGGTGCAGTGGG + Exonic
938619909 2:133039673-133039695 CCTGGTCCTGGAGGGGCTGTTGG - Intronic
940227858 2:151419031-151419053 CCTGACCCTGCAGAGGCCCTAGG - Intronic
943524144 2:188995716-188995738 CCAGGCCCTGCAGGGCCCAGAGG + Exonic
946326077 2:218985300-218985322 CCGGGCCGCGCGGGGGCCGGAGG - Exonic
946401199 2:219469234-219469256 CCAGGTCCTGCAGTGGCCGCAGG - Exonic
946409957 2:219510933-219510955 ACGGGCTGTGCAGGGGCCGAGGG - Intergenic
948190527 2:236054851-236054873 CCGGGCCCGGCAGTGGCGGCAGG - Intronic
948663030 2:239518426-239518448 CGGGGCCCTGCAGCGGGCCTGGG + Intergenic
948783699 2:240340198-240340220 CCGGGCCCTGCTGCCGCCGCAGG - Intergenic
1168830956 20:845095-845117 CCAGGTCCAGCTGGGGCCGTCGG - Exonic
1169140193 20:3223414-3223436 CCGGGCCCTGCTGGAGCTGCAGG + Exonic
1171193513 20:23179034-23179056 CTGGATCCTGCAGGGGCAGTGGG + Intergenic
1171481333 20:25458015-25458037 TTGGGCCCGGCAGGTGCCGTGGG - Intronic
1172969917 20:38865770-38865792 GCAGGCTCTGCAGGGGCCGCTGG - Intronic
1173166371 20:40689477-40689499 CCGGGACCTGCAGGGTACGGGGG - Intergenic
1173810449 20:45952165-45952187 GCGGGCACTGAAGGGGCAGTCGG + Exonic
1173923624 20:46764386-46764408 CCGGCCCTTGCAGGAGCCGCAGG - Intergenic
1175223870 20:57433625-57433647 CAGGGGCCTGCAGAGGCCCTGGG - Intergenic
1175448536 20:59042982-59043004 CCGGCCCCTCCAGCTGCCGTCGG - Intergenic
1175465837 20:59191080-59191102 CCTGGCCCTCCAGGGGCCCCAGG + Exonic
1175907720 20:62389601-62389623 CCTGGCCCTGGAGGGGCTCTGGG - Exonic
1175979075 20:62728003-62728025 CTTGGCCCTGCAGGCACCGTGGG - Intronic
1175983906 20:62754898-62754920 CTGGGCCCTCCAGGGGCGGGAGG + Intronic
1176073387 20:63238006-63238028 CGGGGCCCCGCAGGGGCAGCCGG - Intronic
1176185330 20:63775353-63775375 CCGGGTCGCGCAGGGGCCGGGGG - Intronic
1177195729 21:17901550-17901572 CCAGGTCCTGCAGGAGCAGTCGG + Intronic
1179922608 21:44515341-44515363 CCAGGCCCTGAAGGTGCCTTAGG - Intronic
1180064398 21:45405319-45405341 CCGGGTCCTGCGGGGGTCGCGGG + Intronic
1180068231 21:45423496-45423518 CCGGGCCCTCCGGGGGGCGGGGG - Intronic
1180157234 21:45983584-45983606 CCGTGCCCAGCAGGAGCCATTGG + Intronic
1180315965 22:11277600-11277622 CCGGTACCTGGAGGGGCCCTGGG - Intergenic
1180966046 22:19788471-19788493 CCGAGGCCTGCAGGAGACGTTGG - Exonic
1181469408 22:23128550-23128572 CCTGGCCCTGCAGGGGCCCTGGG - Intronic
1182123078 22:27799388-27799410 CCTCGCCCTGCTGGGGCCGAGGG + Exonic
1182284017 22:29233447-29233469 CCAGGCCCTCCAGGGCCCATGGG + Exonic
1182355316 22:29720188-29720210 CGGGGCCCCGCAGGGGCAGCGGG - Exonic
1183537737 22:38412991-38413013 CCGGGGCCCGCAGGGGCCCGCGG + Intergenic
1183722551 22:39571013-39571035 CGGGGCCCTGCAGGGGCTGAAGG + Intronic
1183780461 22:39995593-39995615 CCGGGCCCTGCCTGGGAGGTGGG - Intronic
1183931455 22:41238174-41238196 CCGGGCCCTGCAGCGGGGGCAGG + Exonic
1184172929 22:42769964-42769986 CGGGGTCCTGCAGGGGCGCTGGG - Intergenic
1184210964 22:43035402-43035424 CAGGGCCCTGCAGGAGACCTTGG + Intergenic
1184247581 22:43243442-43243464 CTGGGCCCTGCAGGGGAGGCCGG + Intronic
1184598214 22:45526857-45526879 CTGGGCCTTGCAGATGCCGTCGG + Intronic
1184680657 22:46070935-46070957 GCGGGGACTGCAGGGACCGTCGG + Intronic
1184899340 22:47434591-47434613 CCTGGCCCCGCTGCGGCCGTCGG + Intergenic
1185082469 22:48717665-48717687 TCGGGCACTGCAGGTGCCATTGG + Intronic
1185248941 22:49789548-49789570 CTTGGCCCTGCAGAGGCCATTGG - Intronic
1185320828 22:50199680-50199702 CGTGGCCCTGCCGGGGCCCTGGG + Intergenic
950416524 3:12872244-12872266 ACGGGACCTGAAGGGGCCGCTGG - Intergenic
950503111 3:13376878-13376900 CCAGGCCCTTCAGGTGGCGTTGG - Intronic
950509923 3:13420024-13420046 CCGGGCCGGGCGGGCGCCGTGGG - Intronic
952955635 3:38555646-38555668 CCTGGCTCACCAGGGGCCGTGGG + Exonic
953469529 3:43155133-43155155 CCGGGCCCTGCAGTGGGAGAAGG + Intergenic
954590362 3:51777472-51777494 GTGGGCCCTGCAGGAGCGGTGGG - Intergenic
958733020 3:97978752-97978774 CAGGGCCCTGCAGGGCCATTGGG + Intergenic
958814673 3:98901952-98901974 CCGGGCCGGGCGGGGGCCGCGGG - Intergenic
961749650 3:129087767-129087789 CCAGGCCCTGCAGGGGTCCGAGG + Exonic
962530781 3:136277882-136277904 CCTGGCCCTGCAGGTGGCCTGGG - Intronic
962820633 3:139044649-139044671 CTGGGCCTGGCAGGGGACGTGGG + Exonic
962891656 3:139677774-139677796 CTGGGCCTAGCAGGGGCTGTCGG + Exonic
963082780 3:141409916-141409938 CCCAGCCCTGCAGGGGCTCTGGG - Intronic
965200359 3:165649579-165649601 CCGGGGCCTGCAGGGCCGGCCGG + Intergenic
967779498 3:193419846-193419868 TTGGGCCCTGGAGGGGCAGTGGG - Intronic
967881910 3:194307500-194307522 CCGGGCCCTGCAGGTGCTTCTGG - Intergenic
967930421 3:194686736-194686758 CCGAGCCTGGCAGGGGCCGGTGG + Exonic
968545140 4:1194446-1194468 GCGTGCCCTGCAGGGGGAGTGGG + Intronic
968569336 4:1331326-1331348 CCAGGCCCTGCACAGGCCCTGGG + Intronic
968653345 4:1768510-1768532 CCCAGCCCTGCAGGGGCCTAGGG + Intergenic
968899413 4:3423986-3424008 CCGGGCCCAGCAGGTGCAGTGGG - Intronic
969680299 4:8639647-8639669 TCGGCCCCTGCAGGGGCTCTGGG + Intergenic
969704311 4:8783742-8783764 CCGGGCCCTGCGAGGTCAGTGGG + Intergenic
969902811 4:10365360-10365382 CTGGGCACAGCAGGGTCCGTAGG + Intergenic
970745022 4:19283929-19283951 CCGGGGCCTGTAGGGGGCTTGGG + Intergenic
974484803 4:62492158-62492180 CCGGGGCCGGCAGGGCCCGCCGG + Intergenic
982384181 4:154781835-154781857 CCCGGGCCTGCAGCGGTCGTTGG - Intronic
982630417 4:157823653-157823675 CAGGGTCCTGCAGGCGCAGTTGG - Intergenic
982728177 4:158927800-158927822 CCGGGGCCAGCAGGGCCCGCCGG - Intronic
984546702 4:181113205-181113227 CCGGGGCCTGTGGGGGCCGGTGG + Intergenic
984698967 4:182806483-182806505 GCGGGCCCTGCAGGGGATGGCGG + Intergenic
984811274 4:183798012-183798034 CCGGGCCCTGCGGCCGCCCTCGG + Intergenic
985628737 5:1004174-1004196 CCGGGCACTGAAGGGGACGTGGG + Intergenic
985638802 5:1053476-1053498 CTGGTCCCTGCAGGGGAGGTGGG + Exonic
985650159 5:1103905-1103927 CTGAGCCATGGAGGGGCCGTGGG + Intronic
993529204 5:89003881-89003903 CCGGGGCCTGCAGGGCCGGCCGG + Intergenic
994329879 5:98492276-98492298 CCAGGTCCTGCAGGAGCAGTTGG - Intergenic
995764650 5:115602262-115602284 CCGGGCTCTGCAAGCGCGGTGGG - Exonic
997428130 5:133818286-133818308 CATGGCCATGCAGGGGCTGTTGG + Intergenic
997659669 5:135579487-135579509 TCTGGCCCAGCAGGGGCCCTTGG - Intergenic
997698222 5:135878216-135878238 CCGGGCCCTGCAGGAGCTGTGGG - Intronic
998056536 5:139083015-139083037 CCAGGCCCTGCAGGGGCTCAAGG + Intronic
998142771 5:139709496-139709518 CCGGGCTGTGCAGGGCCCGGCGG + Intergenic
998156278 5:139788689-139788711 CCAGGCTCTGCCGGGGCCCTGGG + Intergenic
999052794 5:148541869-148541891 CCGGGATCTGCAGGGGCTGTGGG - Intronic
999372104 5:151062164-151062186 CTGGGGCATGCAGGGGCTGTGGG + Exonic
1001101179 5:168815814-168815836 CCGGGCCCAGCATGGGCTGCTGG - Intronic
1001575025 5:172757720-172757742 CCGGGCCCTGCATGGGACGCTGG - Intergenic
1001933838 5:175691049-175691071 CCAGGGCCTGCAGAGGCCATGGG - Intergenic
1002180964 5:177431003-177431025 AGGGGCCCTGCTGGGGCCGGGGG + Intronic
1002640632 5:180629065-180629087 GCCGGGGCTGCAGGGGCCGTGGG - Intronic
1003116878 6:3289222-3289244 CTGGGTCCTGCAGGGGCTGGGGG - Intronic
1003122163 6:3327230-3327252 CCAGGCCCTGAAGGGGCAGTTGG - Intronic
1004169828 6:13287324-13287346 CAGGGCCCTGCTGGTGCCCTTGG - Exonic
1005333964 6:24775003-24775025 CCGGGCACTCCAGCGACCGTGGG + Exonic
1006008290 6:31020819-31020841 CCGGGGCCTGCAGGGCCCGCTGG - Intronic
1007112764 6:39322549-39322571 CAGGACCCTGCCAGGGCCGTGGG + Intronic
1007236989 6:40397653-40397675 CCGGGCCCTGAATGGGCAGATGG + Intronic
1007740471 6:44006537-44006559 CAGGGCCCTGCAGTGGCTGAGGG + Intergenic
1011700611 6:89951126-89951148 GCGGCCCCAGCTGGGGCCGTGGG + Exonic
1015600333 6:134904830-134904852 CCGGGGCCAGCAGGGCCGGTCGG - Intergenic
1017906518 6:158760521-158760543 CAGGGCCTTGCAGGGGCCAGGGG + Intronic
1018177067 6:161186434-161186456 CGGTGGACTGCAGGGGCCGTCGG - Intronic
1018906194 6:168077595-168077617 CCAGGCCCAGCAGGGGCCACAGG + Intronic
1018975730 6:168563903-168563925 CAGGGGCCTGCAGGGGGCGGGGG + Intronic
1019068395 6:169321795-169321817 CTGGGCCCTGCAGGGGCGCAAGG + Intergenic
1019215567 6:170440677-170440699 GCGCGCCTTGCAGGGGCCGGTGG - Intergenic
1019291790 7:254117-254139 CCGGGACCTGCCGGGTGCGTGGG + Intronic
1019385763 7:755194-755216 CCAGGCCTCGCAGGGGCTGTGGG + Intronic
1022298930 7:29084208-29084230 CCGGGCCCTGCAGGATCCACTGG + Intronic
1023337734 7:39187541-39187563 CCGGCCCCTTCAGCGGCCCTCGG - Intronic
1025850461 7:65239650-65239672 CGGGGCCCTGCAGGGGACGCTGG - Intergenic
1026482492 7:70790551-70790573 CCGGTCCCTGAAGGAGCGGTCGG - Exonic
1026805877 7:73429465-73429487 CAGGGCGCCCCAGGGGCCGTGGG - Intergenic
1026904736 7:74056494-74056516 CTCGGCTCTGCAGGGGCAGTGGG + Intronic
1029211264 7:98910167-98910189 CCAGGAGCTGCAGGGGCAGTGGG - Exonic
1029715065 7:102321307-102321329 GCGGGCGCGGCAGGGGGCGTGGG - Exonic
1032220461 7:129990400-129990422 CTGGGCCCTGGAGGGGCAGAAGG + Intergenic
1032519975 7:132536515-132536537 GGGGGCCCTGCAGGGGCTGAAGG - Intronic
1033732801 7:144195566-144195588 CCGGGACCTGGAGGGGACGCTGG - Exonic
1033743652 7:144294146-144294168 CCGGGACCTGGAGGGGACGCTGG - Intergenic
1033750250 7:144355451-144355473 CCGGGACCTGGAGGGGACGCTGG + Exonic
1034911668 7:155002984-155003006 CCGGGCGCCGCGGGGGCCGGGGG - Exonic
1035460809 7:159037359-159037381 AGGGGCCCTGCAGGGGCCCAGGG + Intronic
1035543845 8:463555-463577 CCTGGCCCTGCAGAGTCGGTGGG - Intronic
1035687745 8:1538066-1538088 CCGAGCCCTGCAGGTGCCCCAGG - Intronic
1036695535 8:10972149-10972171 CCGGGCCCAGCTGGGGCCTCGGG + Intronic
1037810959 8:22086653-22086675 CCGGGGCCTGCAGGGCCGGCCGG - Intergenic
1038544133 8:28412377-28412399 TCGGGCCCCGGAGAGGCCGTGGG - Intronic
1039546270 8:38413556-38413578 GTGGGCCCAGCAGGGGCTGTGGG + Exonic
1041919657 8:63168168-63168190 CCGGGCCTAGCAGGAGCCTTCGG - Intergenic
1041932358 8:63300797-63300819 CTGGGCCCTGAAGATGCCGTAGG + Intergenic
1043982481 8:86658067-86658089 CCCGGCCCTGCAGGGGGCCATGG - Intronic
1048977668 8:139681990-139682012 CCAGGCCCTGCAGGTACCCTGGG + Intronic
1048999743 8:139817156-139817178 CCATGCCTTGCAGGGGCCGCTGG + Intronic
1049158928 8:141084912-141084934 CTGGGCCCTCCCGGGGCCGCAGG - Intergenic
1049432565 8:142572076-142572098 CCGTGGGCTGCAGGGGCCGGGGG - Intergenic
1049434064 8:142578165-142578187 CCCGGCCCTGCAGGGGTGATTGG - Intergenic
1049573665 8:143380944-143380966 CTGGGCCCTTCAGGGGCCTGGGG + Intronic
1049641063 8:143716259-143716281 CCGGGGCCTGCCGGGGGCGGGGG + Exonic
1049804385 8:144532387-144532409 CTGTGCCCTGCAGGGTCCCTGGG - Exonic
1053066286 9:35071890-35071912 CCGGGCCCGGCTGGGGCCTCGGG + Intronic
1053149149 9:35732042-35732064 CCGGGCCGGGCGGGGGCCTTAGG - Intronic
1053289483 9:36870693-36870715 CAGGGCCCTGGAGAGGCCCTGGG - Intronic
1055814179 9:80185558-80185580 CCGGGCCCGGCAGGGCCTGCCGG + Intergenic
1056755185 9:89377177-89377199 CTGGGCCATGCAGGGGCGGGAGG + Exonic
1057208118 9:93185130-93185152 CCCGGCGCTGCAGGGGCTGCGGG - Exonic
1057613511 9:96567430-96567452 CCCGGCCCTGCGGGGGCACTTGG - Intronic
1057783798 9:98071929-98071951 CCGTGCCCTGCAGGTGGCATCGG + Intronic
1059325507 9:113501792-113501814 CTGGGCCCTAAAGGGGCCTTGGG - Intronic
1061062556 9:128257991-128258013 CCGGGCCCTGCAGGGGGCCATGG - Exonic
1061545119 9:131299902-131299924 CTGGGCCCTGCGGGGACCATAGG - Intronic
1062047642 9:134431812-134431834 CCGGGCTCTCCAGAGGCCTTGGG + Intronic
1062424156 9:136498310-136498332 CCTGGCCCTGCAGCTGCTGTTGG - Intronic
1062473622 9:136717350-136717372 CCAGGGGCTGCAGGGGCCGGAGG - Intronic
1062596506 9:137302168-137302190 CCGGGCCCGGCCGGGGACGGCGG + Exonic
1203364262 Un_KI270442v1:243554-243576 CCGGTACCTGGAGGGGCCCTGGG - Intergenic
1185457079 X:316598-316620 CTGGGGCCTGCAGGGGCAGGTGG + Intronic
1190879691 X:54483525-54483547 CCTTTCCCTGCAGGGGCCATGGG + Intronic
1192432000 X:71118868-71118890 CGGGGCTCTGGAGGGGCCGGGGG + Intronic
1193086047 X:77448361-77448383 CAGGATCCTGCATGGGCCGTGGG + Intronic
1195129966 X:101841816-101841838 CCTGGCTCAGCAGGGGCCATTGG - Intronic
1195176255 X:102317968-102317990 CCTGGCTCAGCAGGGGCCATTGG + Intronic
1195182609 X:102369125-102369147 CCTGGCTCAGCAGGGGCCATTGG - Intronic
1197431368 X:126370541-126370563 CCGCGCCCAGCCGGGGCTGTGGG - Intergenic
1197716078 X:129706923-129706945 CCAGGCCCTGCAGTGGGAGTGGG - Intergenic
1200128904 X:153830620-153830642 CAGGGGCCGTCAGGGGCCGTGGG + Intergenic
1200147620 X:153934792-153934814 CCGGGCTCGGCCGGGGCCCTCGG + Intronic
1200709324 Y:6469418-6469440 CTGGGCCTTGCAGGGGCTCTCGG + Intergenic
1201024788 Y:9695290-9695312 CTGGGCCTTGCAGGGGCTCTCGG - Intergenic