ID: 1165042122

View in Genome Browser
Species Human (GRCh38)
Location 19:33076053-33076075
Sequence GCAATTTTGCAGTGTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165042122_1165042123 8 Left 1165042122 19:33076053-33076075 CCTGGGCAACACTGCAAAATTGC No data
Right 1165042123 19:33076084-33076106 AAAAAATACAAGTATTAGCCAGG 0: 5
1: 216
2: 12629
3: 104182
4: 158045
1165042122_1165042124 13 Left 1165042122 19:33076053-33076075 CCTGGGCAACACTGCAAAATTGC No data
Right 1165042124 19:33076089-33076111 ATACAAGTATTAGCCAGGCATGG 0: 4
1: 254
2: 20746
3: 48640
4: 95579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165042122 Original CRISPR GCAATTTTGCAGTGTTGCCC AGG (reversed) Intergenic
No off target data available for this crispr