ID: 1165042123

View in Genome Browser
Species Human (GRCh38)
Location 19:33076084-33076106
Sequence AAAAAATACAAGTATTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275077
Summary {0: 5, 1: 216, 2: 12629, 3: 104182, 4: 158045}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165042122_1165042123 8 Left 1165042122 19:33076053-33076075 CCTGGGCAACACTGCAAAATTGC No data
Right 1165042123 19:33076084-33076106 AAAAAATACAAGTATTAGCCAGG 0: 5
1: 216
2: 12629
3: 104182
4: 158045
1165042118_1165042123 26 Left 1165042118 19:33076035-33076057 CCAGGAGCTTGAGACCAGCCTGG 0: 475
1: 20364
2: 41695
3: 58787
4: 51599
Right 1165042123 19:33076084-33076106 AAAAAATACAAGTATTAGCCAGG 0: 5
1: 216
2: 12629
3: 104182
4: 158045
1165042121_1165042123 12 Left 1165042121 19:33076049-33076071 CCAGCCTGGGCAACACTGCAAAA 0: 19
1: 750
2: 13570
3: 73007
4: 164955
Right 1165042123 19:33076084-33076106 AAAAAATACAAGTATTAGCCAGG 0: 5
1: 216
2: 12629
3: 104182
4: 158045
1165042117_1165042123 27 Left 1165042117 19:33076034-33076056 CCCAGGAGCTTGAGACCAGCCTG 0: 237
1: 10789
2: 21107
3: 30236
4: 27018
Right 1165042123 19:33076084-33076106 AAAAAATACAAGTATTAGCCAGG 0: 5
1: 216
2: 12629
3: 104182
4: 158045

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165042123 Original CRISPR AAAAAATACAAGTATTAGCC AGG Intergenic
Too many off-targets to display for this crispr