ID: 1165042124

View in Genome Browser
Species Human (GRCh38)
Location 19:33076089-33076111
Sequence ATACAAGTATTAGCCAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165223
Summary {0: 4, 1: 254, 2: 20746, 3: 48640, 4: 95579}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165042121_1165042124 17 Left 1165042121 19:33076049-33076071 CCAGCCTGGGCAACACTGCAAAA 0: 19
1: 750
2: 13570
3: 73007
4: 164955
Right 1165042124 19:33076089-33076111 ATACAAGTATTAGCCAGGCATGG 0: 4
1: 254
2: 20746
3: 48640
4: 95579
1165042122_1165042124 13 Left 1165042122 19:33076053-33076075 CCTGGGCAACACTGCAAAATTGC No data
Right 1165042124 19:33076089-33076111 ATACAAGTATTAGCCAGGCATGG 0: 4
1: 254
2: 20746
3: 48640
4: 95579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165042124 Original CRISPR ATACAAGTATTAGCCAGGCA TGG Intergenic
Too many off-targets to display for this crispr