ID: 1165048018

View in Genome Browser
Species Human (GRCh38)
Location 19:33121607-33121629
Sequence GGAGACTTGGCGGCCGGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165048018_1165048024 15 Left 1165048018 19:33121607-33121629 CCGCACCCGGCCGCCAAGTCTCC 0: 1
1: 0
2: 2
3: 25
4: 309
Right 1165048024 19:33121645-33121667 ATGTAGCAAATACAATAAAATGG 0: 1
1: 0
2: 6
3: 62
4: 693

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165048018 Original CRISPR GGAGACTTGGCGGCCGGGTG CGG (reversed) Intronic
900207916 1:1439472-1439494 GGAGGCTGCGCGGCCGGGCGTGG - Exonic
900346016 1:2210558-2210580 GGGGCCTTGGGGGCTGGGTGGGG + Intronic
901487089 1:9571565-9571587 AGAGCCTTCTCGGCCGGGTGGGG - Intronic
902995361 1:20220876-20220898 AGAGAGGTTGCGGCCGGGTGCGG + Intergenic
903528674 1:24012862-24012884 AGAGCCCTGGAGGCCGGGTGCGG + Intergenic
904520257 1:31089750-31089772 GTAGGTTTGGCGGCCAGGTGCGG - Intergenic
904755981 1:32768958-32768980 AAAATCTTGGCGGCCGGGTGCGG + Intronic
904833164 1:33318585-33318607 GGAGACTCGGAGGCAGGGTCAGG - Intronic
908231740 1:62112213-62112235 AAAGCCTTGGGGGCCGGGTGCGG + Intronic
910995013 1:93095282-93095304 GGACACTTGGAAGCCAGGTGAGG - Intronic
911133875 1:94418654-94418676 AGAGACCTGTCGGCCGGGTGGGG - Intronic
911642300 1:100302345-100302367 AAAGACTTTGGGGCCGGGTGTGG - Intergenic
913468263 1:119165098-119165120 GGTGACTGGGCGGTGGGGTGGGG + Intergenic
915728615 1:158036927-158036949 GGAGCCTTGGCGGGCAGGTCTGG + Intronic
916803260 1:168233991-168234013 GAAGACTTATTGGCCGGGTGTGG + Intronic
919909870 1:202104313-202104335 AGAGATTTCGTGGCCGGGTGTGG + Intergenic
919926381 1:202193948-202193970 GGGCACCTGGCGGCCGGGCGCGG - Exonic
920109111 1:203574681-203574703 AAAGACTTGGGGGCCGGGTGTGG - Intergenic
920576366 1:207063676-207063698 GGAGATGTGGTGGCTGGGTGGGG + Intronic
920780694 1:208988281-208988303 GCTGACTTAGAGGCCGGGTGCGG - Intergenic
921157956 1:212452885-212452907 GGAAACTTGGCTGGAGGGTGGGG - Intergenic
921182552 1:212643141-212643163 AGACACTTAGCGGCCGGGCGTGG - Intergenic
921853078 1:219951429-219951451 AGGGACTTGGGGGCCGGGCGCGG + Intronic
922292692 1:224221777-224221799 AGAGACATGTCGGCCGGGCGCGG - Intergenic
922810081 1:228410450-228410472 GGACACCTGGCAGCCAGGTGTGG - Intronic
922811185 1:228416507-228416529 GTAGCCTAGGCGGCGGGGTGGGG + Intronic
923299848 1:232630548-232630570 GGAGACGGGAGGGCCGGGTGGGG - Intergenic
923538418 1:234870741-234870763 GGAGACTTGGATGACAGGTGAGG + Intergenic
923626457 1:235617592-235617614 AGAGACTTGCAGGCTGGGTGCGG + Intronic
924381965 1:243473909-243473931 GGAGAGTTGCCGGCGGGGGGGGG + Intronic
924808352 1:247379466-247379488 CTAGAGTTGGCGGCGGGGTGCGG - Intergenic
1062932547 10:1362791-1362813 GGAGACAGCGAGGCCGGGTGGGG - Intronic
1067403991 10:46003854-46003876 AGCTACTTGGTGGCCGGGTGTGG + Intergenic
1067451920 10:46387015-46387037 AGAGACTTGGCATCTGGGTGGGG - Intronic
1067585318 10:47472740-47472762 AGAGACTTGGCATCTGGGTGGGG + Intronic
1069143037 10:64852202-64852224 AAACACTTGGAGGCCGGGTGTGG - Intergenic
1071417391 10:85454000-85454022 AGAGACTTGGAGGCTTGGTGTGG - Intergenic
1071521499 10:86334095-86334117 GGGGACTAGGGGGCCAGGTGTGG - Intronic
1072194807 10:93108145-93108167 GAATTATTGGCGGCCGGGTGCGG - Intergenic
1072590021 10:96820488-96820510 AGAGGCTTGATGGCCGGGTGTGG - Intergenic
1072701228 10:97642675-97642697 AGAAACTTGGAGGCCGGGCGCGG - Intronic
1072914318 10:99527677-99527699 GGAGATGTGGGGGTCGGGTGGGG - Intergenic
1072974032 10:100042212-100042234 GGTGATGTGGTGGCCGGGTGTGG - Exonic
1073076773 10:100829338-100829360 GGAGACAGGGCGGCCGGGCCAGG - Exonic
1073180081 10:101578278-101578300 GGAGACTTGGTGGGGGAGTGGGG - Intronic
1073249540 10:102113489-102113511 GGAGACTTGGTGGCTGGGTGGGG - Intronic
1073521130 10:104130705-104130727 GAACACTTGGAGGCCAGGTGTGG + Intronic
1074897569 10:117790720-117790742 GGAGACTTGGAGGCCAGGTCGGG - Intergenic
1075617196 10:123899038-123899060 GGAAACTTTCAGGCCGGGTGCGG - Intronic
1076483620 10:130801497-130801519 GGTGACTCGGCTGCCGGATGGGG + Intergenic
1076878981 10:133230846-133230868 GGGGACTGGGGGGCCAGGTGGGG + Intronic
1076881845 10:133243486-133243508 GGAGGCTGTGGGGCCGGGTGTGG + Intergenic
1077101004 11:822305-822327 GGGCCCTTGGTGGCCGGGTGGGG + Intronic
1077134501 11:991754-991776 GGAGAGGGGGCGGCAGGGTGTGG + Intronic
1077154393 11:1084939-1084961 GGAGCTGTGGCGGCCGAGTGTGG + Intergenic
1079112115 11:17610759-17610781 AGAGGCTTTGGGGCCGGGTGTGG - Exonic
1081810557 11:45911731-45911753 GGAAGCCTGGGGGCCGGGTGTGG + Intronic
1082119628 11:48364676-48364698 AGAGAATTGGTGGCTGGGTGTGG - Intergenic
1082254666 11:50020502-50020524 AGAGAATTGGTGGCTGGGTGTGG + Intergenic
1083780282 11:64914049-64914071 GGAGACAGGGCGGCCAGGAGGGG + Intronic
1083797539 11:65026076-65026098 GGAGAGATGGGGGCCGGGCGTGG - Intronic
1084681751 11:70670442-70670464 GGCGCTTTGGCCGCCGGGTGCGG + Intronic
1084971570 11:72774966-72774988 GGAGCCTGGGCAGCTGGGTGTGG + Intronic
1086322424 11:85664673-85664695 GGAGAGTTGGAAGCCGGGAGGGG - Exonic
1088969681 11:114761862-114761884 AGAGGCTTGGCGGCCGGGCGCGG - Intergenic
1089255880 11:117193651-117193673 GGATACATGGAGGCTGGGTGGGG + Intronic
1089525659 11:119094929-119094951 GGAGGCCTGGCGGCCGGCCGCGG + Exonic
1089876085 11:121723247-121723269 GGAGAGTAGGGGGCCGGGTGGGG - Intergenic
1090670901 11:128944563-128944585 GGAGTGTTGGGGGCCAGGTGCGG - Intergenic
1092860816 12:12717631-12717653 GGAGACTCGGCGGCCGGGCCGGG + Exonic
1096889100 12:54748514-54748536 GGGGACTTGGGGGAAGGGTGGGG + Intergenic
1097038337 12:56138676-56138698 GGAGACATGGCTGCTGGCTGTGG + Intronic
1097264548 12:57737908-57737930 GGAGAGGCGGCGGCCGGGAGCGG + Exonic
1102865079 12:116367908-116367930 GGATCCTTTGGGGCCGGGTGCGG - Intergenic
1103415457 12:120739519-120739541 AGAGACTGGGCGGCCCGGCGGGG + Exonic
1103557547 12:121775449-121775471 GGAGACCTGGGGGAAGGGTGAGG - Intronic
1103685010 12:122725181-122725203 GGAGACTTGGCTGCACTGTGAGG - Intergenic
1104003637 12:124876868-124876890 GTAGAATTGGAGGCTGGGTGCGG + Intronic
1104018166 12:124974242-124974264 GGGGACTGGGTGGCCGGGTGCGG - Intronic
1104514757 12:129414814-129414836 AGAGACTGGGCGGTGGGGTGGGG - Intronic
1105720010 13:23103798-23103820 AAAGGCTGGGCGGCCGGGTGTGG - Intergenic
1106601019 13:31187084-31187106 GAAAACATTGCGGCCGGGTGCGG + Intergenic
1108080682 13:46731805-46731827 GGAGATTTGGGGGGCAGGTGGGG - Intronic
1109890982 13:68613942-68613964 GTAGACTTTGTGGCCGGGCGCGG - Intergenic
1110739307 13:78976068-78976090 GGAGAATTTGGGGCCAGGTGCGG - Intergenic
1111926063 13:94464347-94464369 GGGGATTTTGAGGCCGGGTGAGG + Intronic
1112512639 13:100023503-100023525 AGACACGTGGCCGCCGGGTGCGG - Intergenic
1113665878 13:112142018-112142040 GGAGGCTGGGTGGCTGGGTGGGG - Intergenic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114530774 14:23394331-23394353 GGAAACGTGGAGGCAGGGTGGGG + Intronic
1115397314 14:32922997-32923019 GAATACTTGGCGGCCAGGTGCGG + Intergenic
1118141356 14:63086543-63086565 GGAAACTTAGCAGCTGGGTGTGG + Intronic
1119703201 14:76768837-76768859 GGAGGCTTGGGGGCAGGGGGTGG + Intronic
1119706543 14:76786450-76786472 GAAAACTTAGCGGCCGGGTGCGG - Intergenic
1120918986 14:89737626-89737648 GGATGCTGGGAGGCCGGGTGCGG - Intergenic
1121276805 14:92673794-92673816 GAAGATGTGGCGGCCGGGCGCGG - Intronic
1122167243 14:99837070-99837092 GAAGACTTGAGGGCAGGGTGTGG + Intronic
1122908744 14:104815988-104816010 GGAGACCCGGCGGGCGGGAGCGG + Intergenic
1123149441 14:106166777-106166799 GGTGACCTGGCGGACGTGTGAGG - Intergenic
1123951010 15:25274676-25274698 GGTGATTAGGCGGCCGGGCGCGG - Intergenic
1124437663 15:29664517-29664539 GGAGACTCGGAAGCCGCGTGTGG + Intergenic
1125040255 15:35177647-35177669 TGATACTTTGTGGCCGGGTGTGG + Intergenic
1125181844 15:36887555-36887577 GGAGGGTTGGCCGCCGGGTGGGG - Intergenic
1125343253 15:38695089-38695111 GCAGAATTGGGGGGCGGGTGCGG + Intergenic
1126396072 15:48219252-48219274 GAAAACTTGTCGGCCGGGTGTGG + Intronic
1126608992 15:50509359-50509381 AGAGACAAGGCGGCCGGGCGCGG + Exonic
1126762413 15:51981181-51981203 TCAGACTTATCGGCCGGGTGCGG + Intronic
1128042316 15:64586032-64586054 GGGATCTTGCCGGCCGGGTGCGG + Intronic
1128755005 15:70176885-70176907 GAAGACTTATGGGCCGGGTGTGG + Intergenic
1128823003 15:70679110-70679132 AGAGATTAGGCAGCCGGGTGTGG + Intronic
1131254915 15:90855633-90855655 GAAGATCTGGCGGCCGGGCGTGG + Intergenic
1131300606 15:91196508-91196530 AGAGACTGGGAGGCCGGTTGTGG + Intronic
1131692730 15:94844821-94844843 GGAGGGTGGGCGGCCGGGGGTGG + Intergenic
1131873151 15:96780737-96780759 GGAGTCTTGGCTGGCGGGGGAGG - Intergenic
1132021445 15:98366011-98366033 GGATACTAGTCGGCCAGGTGCGG - Intergenic
1132834253 16:1944826-1944848 GGAGACTTGTAGGCTGTGTGGGG - Exonic
1133870061 16:9677631-9677653 TGAGATTTGGGGGCCGGGTGGGG + Intergenic
1134588619 16:15434418-15434440 GGAGGCTTGGGGGCTGGGTAGGG - Exonic
1134676262 16:16092697-16092719 GAAAAGTTGGTGGCCGGGTGTGG + Intronic
1138222040 16:55260164-55260186 GGAGACTGGGAGCCAGGGTGTGG + Intergenic
1139505324 16:67395587-67395609 GGAGGCTGGGAGGCCAGGTGTGG + Intronic
1139765337 16:69223918-69223940 GAAGAACTGTCGGCCGGGTGTGG - Intronic
1140245132 16:73241498-73241520 GGAGGGTTGGGGGCCGGGCGCGG + Intergenic
1140526143 16:75624427-75624449 TGAGACTCGGCAGCCAGGTGCGG - Intergenic
1142312395 16:89321465-89321487 GGGGACTGTGGGGCCGGGTGGGG + Intronic
1142335751 16:89489401-89489423 GGAGGGTAGGCGGGCGGGTGTGG - Intronic
1142397724 16:89842105-89842127 GGAGACTTGGGGGCCGACAGAGG - Intronic
1142412135 16:89922280-89922302 GCTGATTTGGGGGCCGGGTGGGG + Intronic
1142599545 17:1046979-1047001 GGAGTCTCAGCGGCGGGGTGGGG - Intronic
1142721880 17:1781820-1781842 GAAAACTTTGAGGCCGGGTGTGG - Intronic
1142996650 17:3764404-3764426 GGAGGTTTGGAGGCCGGGCGCGG + Intronic
1143245489 17:5481935-5481957 GGGGACTGGAGGGCCGGGTGTGG - Intronic
1144196535 17:12900415-12900437 GGCAACATGGAGGCCGGGTGTGG - Intronic
1145784123 17:27582994-27583016 GAAGACCTTGCGGCTGGGTGGGG - Exonic
1146260984 17:31420791-31420813 TGAGACTTTGGGGCTGGGTGCGG + Intronic
1146275394 17:31512817-31512839 GGTGACTGGACGGCCGTGTGTGG + Intronic
1147131614 17:38412951-38412973 GGGGTCTTGCCGGCCGGGCGCGG - Intergenic
1147287351 17:39412823-39412845 GAAAAATTTGCGGCCGGGTGCGG - Intronic
1147290553 17:39438761-39438783 AGAGACTAGGTGGCTGGGTGCGG - Intronic
1147767459 17:42846238-42846260 GGAGACTTGGGGGCGGGGTCAGG + Intronic
1148503369 17:48108212-48108234 GGAGACTTGGCGGTAGATTGTGG + Intronic
1150732001 17:67703875-67703897 GGCTACTATGCGGCCGGGTGTGG - Intergenic
1151481613 17:74372932-74372954 GGACAGATGGAGGCCGGGTGCGG + Intergenic
1151589685 17:75034970-75034992 GGTGACTAGGCGGGCGGCTGGGG + Intronic
1152765537 17:82135811-82135833 GCACACTGGGAGGCCGGGTGGGG + Intronic
1153786050 18:8536632-8536654 GGGGACTTGGGGTCGGGGTGGGG - Intergenic
1156316361 18:35972515-35972537 GGGGACGCGGCGGGCGGGTGGGG + Exonic
1157223455 18:45842927-45842949 GGAAACTTGGTGGCAGGGAGAGG + Intronic
1158534638 18:58296629-58296651 GGACACTTGTGGGCCGGGCGCGG + Intronic
1158605698 18:58894172-58894194 GTAGACTTTCCGGCCGGGCGTGG + Intronic
1159587139 18:70291388-70291410 GGACACTTGCAGGCTGGGTGTGG - Intronic
1160831049 19:1104982-1105004 GGAGACCCGGAGGCCGGGAGAGG - Intronic
1161452020 19:4351570-4351592 ATAGACTTGGCGGCCGGGCACGG + Intronic
1161507588 19:4652266-4652288 TGGGACTTGGCGGTCAGGTGGGG - Exonic
1161819260 19:6519242-6519264 GGGGGCTAGGCGGCCGGGTGCGG - Intergenic
1161828896 19:6588647-6588669 GGAGTCGCGGCGGTCGGGTGGGG - Intronic
1162104837 19:8364081-8364103 GGAGTCTTGGAGGCGGGGTGCGG - Intronic
1162115333 19:8425935-8425957 CGAGGATTGGGGGCCGGGTGCGG + Intronic
1162293269 19:9794557-9794579 AGAGACAAGTCGGCCGGGTGCGG - Intergenic
1162581450 19:11533547-11533569 GAATGCTTGACGGCCGGGTGTGG - Intergenic
1163196466 19:15724695-15724717 GTATAGTTGGAGGCCGGGTGTGG - Intergenic
1163216620 19:15883768-15883790 GAAAATGTGGCGGCCGGGTGCGG + Intronic
1163530254 19:17844506-17844528 GGAGTGCTGGAGGCCGGGTGCGG + Intronic
1163786320 19:19276786-19276808 GCAGGCTTGGGGGACGGGTGGGG + Intronic
1163832226 19:19552588-19552610 TGAGACATGGCTGCAGGGTGAGG - Intergenic
1165048018 19:33121607-33121629 GGAGACTTGGCGGCCGGGTGCGG - Intronic
1165347745 19:35259347-35259369 CCAGACTTGGGGTCCGGGTGCGG + Intronic
1165816934 19:38648105-38648127 AGAGAATTGGCGGCTGGGTGGGG + Intronic
1166733928 19:45073599-45073621 ATAGCCTGGGCGGCCGGGTGCGG - Intronic
1167113041 19:47473079-47473101 AGAGACTTGCAGGCTGGGTGCGG + Intergenic
1167207488 19:48112399-48112421 AGGGACATGGCGGCCGTGTGTGG + Intergenic
1167408719 19:49332264-49332286 GGACACTTGTCAGCCGGGTGCGG + Intergenic
1167471170 19:49677241-49677263 GGGGTCTTGGCGGCCGGAGGAGG + Intronic
1167976160 19:53227613-53227635 GGAGACGTGGGGGTAGGGTGAGG - Intergenic
1168282239 19:55311968-55311990 TGGGTCTGGGCGGCCGGGTGGGG - Exonic
928101067 2:28437593-28437615 GGAGTCTGGGCGGCCAGGCGTGG + Intergenic
929094938 2:38254439-38254461 GGGGACATGGCGGCGGGGGGGGG + Intergenic
930136252 2:47906143-47906165 GGGGAGTGGGCGGGCGGGTGAGG + Intergenic
930811485 2:55546416-55546438 AGAAACTTGCAGGCCGGGTGTGG + Intergenic
931029458 2:58155762-58155784 GGAAACGGGGCGGCGGGGTGGGG - Intronic
934554407 2:95279758-95279780 CGGGACGTGGCGACCGGGTGTGG - Intronic
935058013 2:99584175-99584197 GGTGAGTAGGAGGCCGGGTGTGG + Intronic
940973654 2:159920690-159920712 GGACACTCAGGGGCCGGGTGCGG - Intergenic
941945959 2:171097632-171097654 TAAGAATAGGCGGCCGGGTGTGG + Intronic
944684916 2:202109725-202109747 GGAGACTTGGGGGGCTGTTGTGG - Exonic
946402506 2:219475948-219475970 GAAGGCAGGGCGGCCGGGTGTGG - Intronic
946627706 2:221632175-221632197 ATAGACTTGTCGGCCAGGTGCGG + Intergenic
948620661 2:239232480-239232502 GGAGACATGGTGGCAGGGTGGGG - Intronic
948805533 2:240452252-240452274 GGAGACTTGGTGGAAGGATGTGG + Intronic
1169437693 20:5607666-5607688 GTAAACATGGCGGCCAGGTGTGG + Intronic
1170563855 20:17582367-17582389 GTATACTTCGGGGCCGGGTGTGG - Intronic
1171249708 20:23638264-23638286 GGAGACTGGGGGGCCAGGGGAGG - Intronic
1172995888 20:39070101-39070123 GTAGATATGGCGGCTGGGTGAGG + Intergenic
1173493628 20:43503390-43503412 AAAGACTGGGGGGCCGGGTGTGG - Intergenic
1173641097 20:44602540-44602562 GAAGACTTGGAGGCCAGGTGCGG + Intronic
1173872317 20:46349904-46349926 GGAGACGTGGGGGCAGGGAGGGG - Exonic
1176071124 20:63226902-63226924 GGGGCCTTGGGGGCCTGGTGTGG - Intergenic
1176186847 20:63784941-63784963 AGAGACTTTGTGGCCGGGCGTGG + Intronic
1176238490 20:64065114-64065136 GGGGACCTGGGGGCCAGGTGTGG + Intronic
1176250218 20:64117012-64117034 GAAGCCATGGCAGCCGGGTGAGG + Intergenic
1178256091 21:31053710-31053732 GGATATTTGGTGGTCGGGTGCGG + Intergenic
1179600360 21:42473859-42473881 GGAGACTTGGGAGGCTGGTGAGG - Intronic
1179887335 21:44319755-44319777 GGCGTCCTGGCGGCCGGGTCAGG + Intronic
1179905156 21:44418801-44418823 GAAGCCTTGGCGGCTGGGGGAGG + Intronic
1180089406 21:45526092-45526114 GGAGAGATGGGGGCCTGGTGGGG - Intronic
1180733988 22:18001905-18001927 GGGGACTTGTTGGCCGGGCGCGG + Intronic
1181550363 22:23635332-23635354 GGAGACTTGGGGGCTGGGTGCGG + Intergenic
1183214861 22:36473014-36473036 GCAGTCTTGGTGGCCGGGCGCGG + Intronic
1184743868 22:46444874-46444896 GGAGATTTGACGGCCTTGTGAGG - Intronic
1184766426 22:46574940-46574962 GGAGACTTGGTGGAGGGGTGTGG + Intergenic
1185182716 22:49372517-49372539 GGAAACCTGGGGGCGGGGTGGGG - Intergenic
1185212158 22:49576423-49576445 GGAGACGTGGAGGCAGGCTGTGG - Intronic
1185278008 22:49958013-49958035 GGGGACTTGGCCGGGGGGTGGGG + Intergenic
951911152 3:27752123-27752145 GAAGGCTTGGAGGCCGGGTGCGG + Intergenic
952476791 3:33718359-33718381 GGAGACTTGGGGTCCGAGTTGGG + Intergenic
952747380 3:36794061-36794083 GAAGACATGTGGGCCGGGTGCGG - Intergenic
953657221 3:44863304-44863326 GGAGACAAGGCGGCGGGGGGGGG - Intronic
954761816 3:52880151-52880173 GGAGGCTTAGGGCCCGGGTGGGG + Intronic
955156345 3:56420593-56420615 GGGAATTTGGGGGCCGGGTGTGG + Intronic
955911609 3:63864043-63864065 CGAGGCTTGGCGGCCGGCGGCGG + Intergenic
956442074 3:69290271-69290293 AGAGACTTGAGGGGCGGGTGAGG + Intronic
956703570 3:71980370-71980392 AGAGACTGGCCGGCCGGGCGCGG - Intergenic
957908069 3:86583223-86583245 GGAGACTTTAGGGCCAGGTGTGG + Intergenic
959584678 3:108015036-108015058 AGAAACTTGGGGGCTGGGTGTGG + Intergenic
960639578 3:119812970-119812992 GGAGACTGGGTGGTTGGGTGTGG + Intronic
961654319 3:128433033-128433055 GGAGATTTGGGGGGCGGGGGCGG - Intergenic
962752943 3:138447975-138447997 GGGGAATCGGCGGCCGGGTGTGG + Intronic
964102737 3:153006444-153006466 GAAGAGGTGGAGGCCGGGTGTGG - Intergenic
965575069 3:170209591-170209613 GGAACCTTGCAGGCCGGGTGCGG - Intergenic
965907888 3:173732506-173732528 GGACACTTTGCGGCTGGGTTCGG + Intronic
966133075 3:176666517-176666539 GGGGGGTTGGGGGCCGGGTGTGG + Intergenic
968458137 4:708771-708793 GGAGACTTGGAGGAGGGGTGGGG + Intronic
968815136 4:2818154-2818176 GGGGACTGGGCGGGCAGGTGAGG - Intronic
968939613 4:3631092-3631114 GGGGACCTTGGGGCCGGGTGGGG + Intergenic
969119958 4:4900825-4900847 GGCGACTTAGCTGCAGGGTGGGG - Intergenic
970831379 4:20344136-20344158 GGATACTTTGTGGCCGGGCGCGG - Intronic
971257979 4:25031049-25031071 GGCGAGGTGGGGGCCGGGTGGGG - Intergenic
971349019 4:25839883-25839905 GCAGACTTGGAGGCCGAGGGTGG - Intronic
972543163 4:40056773-40056795 GGCGGGTGGGCGGCCGGGTGGGG - Intergenic
974906473 4:68064475-68064497 GGAGCAGTGGTGGCCGGGTGTGG - Intronic
975113166 4:70649499-70649521 GTAAAGCTGGCGGCCGGGTGCGG - Intronic
977463920 4:97359339-97359361 AGAGACTTGGGGGCCTTGTGAGG - Intronic
978448467 4:108803459-108803481 ACAGACTAGACGGCCGGGTGCGG + Intergenic
979702567 4:123685188-123685210 CCAGACGTGGCAGCCGGGTGGGG - Intergenic
980130298 4:128811403-128811425 GGTGACCTGGCGGCCGAGGGCGG + Intronic
981859290 4:149335719-149335741 GGGGGCTTGGAGGCCGGGGGAGG - Intergenic
982506735 4:156228035-156228057 CCAGACTTGGTGGCCAGGTGAGG + Intergenic
984690593 4:182721056-182721078 GGAGACTTTTAGGCCGGGCGTGG - Intronic
985940157 5:3128891-3128913 GGACACCTGCCGGCCGGGCGCGG + Intergenic
989029118 5:37099323-37099345 GGACACATTGCGGCGGGGTGTGG - Intergenic
989376009 5:40761981-40762003 GGGGATATGGAGGCCGGGTGCGG + Intronic
989545800 5:42671664-42671686 AGAAACTAGGCGGCCGGGCGCGG + Intronic
989601742 5:43206646-43206668 GGAGACTGGGGGGCCGAGTCAGG - Intronic
990579168 5:57151530-57151552 AGAGACTTTAAGGCCGGGTGTGG + Intergenic
990859541 5:60311310-60311332 GGTGACTTGCCAGCCGGGCGCGG - Intronic
995462838 5:112420311-112420333 AGAGACCTGGAGGCTGGGTGGGG + Intergenic
996121588 5:119679758-119679780 AGAGACTTCTCGGCCGGGCGCGG - Intergenic
996608601 5:125352650-125352672 GGGGACTTGGGGGGAGGGTGGGG - Intergenic
997013420 5:129904703-129904725 GGCGCCTAGGCGGCCGGCTGCGG + Exonic
997185494 5:131877761-131877783 GGTGACTGGGGGGCAGGGTGCGG - Intronic
1000947481 5:167439082-167439104 AAAAACTTGGCGGCCCGGTGCGG - Intronic
1001241469 5:170074769-170074791 GAACACTTGGCTGCAGGGTGAGG + Intronic
1002154618 5:177266606-177266628 GGGGTCTTGGCGGCCGGAAGAGG - Intronic
1002784818 6:392766-392788 GGAGGGGTGGCGGCTGGGTGGGG + Intronic
1003467061 6:6390971-6390993 GGAGACCTGGTGGCAGGGAGTGG - Intergenic
1003624584 6:7729328-7729350 GGAAACCTGGAGGCGGGGTGGGG - Intronic
1003866012 6:10363531-10363553 GCACAGTTTGCGGCCGGGTGCGG + Intergenic
1004075395 6:12340040-12340062 GGAGGCTGGGCGGCTGGATGTGG + Intergenic
1004317994 6:14608099-14608121 TGAGTCTTTGCGGCTGGGTGTGG + Intergenic
1005610076 6:27515279-27515301 GGGGCCTTGGCGGCCGAGAGTGG - Intergenic
1005763006 6:28985073-28985095 GGAGATTTGGAGGTGGGGTGGGG + Intergenic
1006502899 6:34469412-34469434 GGGGACTTGGCGGGCAGGTCAGG + Intronic
1006910986 6:37563456-37563478 TGAGAGTTGGAGGCCGGCTGAGG - Intergenic
1007631390 6:43275315-43275337 GAAGCCTCGGCGGCGGGGTGGGG - Intronic
1007709285 6:43811566-43811588 GGAGGCTTGGAGGCTGGCTGGGG + Intergenic
1008068132 6:47072348-47072370 AGAGAGTTGTTGGCCGGGTGTGG - Intergenic
1011620646 6:89239338-89239360 GTGGACTTGGTGGCCAGGTGTGG - Intergenic
1013511448 6:110848002-110848024 GGAAATTTGCTGGCCGGGTGCGG - Intronic
1014833242 6:126127282-126127304 GGAGACTTTGGGGTCGGGAGTGG + Intergenic
1014910640 6:127088783-127088805 GAATAGTTTGCGGCCGGGTGCGG + Intergenic
1015424573 6:133050681-133050703 GAAAAATTGGCGGCCGGGCGCGG - Intergenic
1016883137 6:148931005-148931027 GGAGTCTTGGCAGCCAAGTGTGG + Intronic
1017437911 6:154435283-154435305 AGAGATTTGTGGGCCGGGTGTGG - Intronic
1017738068 6:157381469-157381491 GGCGACTGGGCGGCCGCGCGCGG - Exonic
1019118342 6:169783684-169783706 GGAGACCTGGGGGCCGTGGGTGG + Intergenic
1019272915 7:160469-160491 GGATTCTTGCCGGCCGGGCGCGG - Intergenic
1019410552 7:904827-904849 GGAGCCTGGGCGGCCGGGCGGGG - Intronic
1021126135 7:16852749-16852771 AGAGACTTGGGGGCCAGGAGGGG - Intergenic
1021571409 7:22068964-22068986 GGATCTTTGTCGGCCGGGTGCGG + Intergenic
1021791750 7:24212948-24212970 GAAGACTTGGGGGGCTGGTGGGG + Intergenic
1021885061 7:25129945-25129967 GGATAGTTGGTGGCTGGGTGTGG + Intergenic
1021958855 7:25852737-25852759 GGAGACTGGGCGCTGGGGTGGGG + Intergenic
1024479029 7:49844971-49844993 AGTGAATTGCCGGCCGGGTGCGG - Intronic
1027200492 7:76061052-76061074 GGAGACTGAGCTGCTGGGTGTGG + Intronic
1028996147 7:97102291-97102313 GGGCAGTTGTCGGCCGGGTGTGG - Intergenic
1029716962 7:102334154-102334176 GGAGACAAGGCGGCCGGGCGCGG + Intergenic
1030058855 7:105607271-105607293 GGAGAGTTGGAGGGTGGGTGGGG - Exonic
1031196160 7:118616695-118616717 AGTGACATGGCGGCCGGGCGTGG + Intergenic
1033148885 7:138895972-138895994 AGAGAAGTGGGGGCCGGGTGGGG - Intronic
1034000611 7:147408468-147408490 GAGGACCTTGCGGCCGGGTGTGG + Intronic
1034711261 7:153193284-153193306 AGAGGCTGGGCGGCGGGGTGAGG + Intergenic
1035263024 7:157673822-157673844 GGAGCCCTGGGTGCCGGGTGGGG - Intronic
1038979182 8:32737961-32737983 GGAGACTTTCAGGCCAGGTGTGG - Intronic
1039885908 8:41653892-41653914 GGCGCCTTGTCGGCCGGGGGTGG - Intronic
1040459869 8:47636951-47636973 GGAGCCTTGGCAGGAGGGTGAGG + Intronic
1040517426 8:48146139-48146161 AGAAACATGCCGGCCGGGTGCGG - Intergenic
1040781089 8:51110434-51110456 GGAGACTTGGCGGTGGGAGGAGG - Intergenic
1043688562 8:83120524-83120546 AGACACTTTGAGGCCGGGTGCGG + Intergenic
1043975635 8:86581731-86581753 GGAGACTTGGTGGGGGGGTAAGG - Intronic
1044035640 8:87299824-87299846 GGACACCTGGCTGCAGGGTGTGG - Intronic
1045695254 8:104802116-104802138 GGAGACTTGGGGTCCAGGAGGGG + Intronic
1049208080 8:141372529-141372551 GCAGGCTTGGTGGCCGGGGGTGG + Intergenic
1049317879 8:141979281-141979303 GGATACTTGGCTGCTGCGTGGGG - Intergenic
1049473404 8:142786142-142786164 GGAGACCTGGGGACCGGGAGGGG + Intronic
1049856732 8:144866871-144866893 AGAGACTCAGCGGCCGGGCGTGG - Intergenic
1050374482 9:4956797-4956819 AGAGAATTTGCGGCCGGGCGCGG + Intergenic
1053247390 9:36545788-36545810 AAAGAATAGGCGGCCGGGTGCGG + Intergenic
1053301907 9:36958451-36958473 GGAGACTTGGAGGGTTGGTGGGG + Intronic
1054929538 9:70621654-70621676 GGACTCTTGGAGGCTGGGTGTGG - Intronic
1056990471 9:91405891-91405913 GCAGAGTCGGCGGCCGGGGGCGG - Intergenic
1059068990 9:111115478-111115500 GGTGACATAGCGGCCGGGCGCGG - Intergenic
1059645921 9:116267581-116267603 TAAGAAATGGCGGCCGGGTGCGG + Intronic
1060093773 9:120768534-120768556 GGAGGCTAGGAAGCCGGGTGCGG + Intronic
1061068244 9:128292574-128292596 GGACACTTGATGGCAGGGTGTGG - Intergenic
1061301799 9:129709803-129709825 GGAGCCATGGAGGCCTGGTGAGG - Intronic
1061649823 9:132038480-132038502 GGATGCCTGGCGGCCGGGCGCGG - Intronic
1061670582 9:132185996-132186018 GGAGAGAGGGAGGCCGGGTGAGG - Intronic
1062110528 9:134779799-134779821 GGTGTGTTGGCTGCCGGGTGTGG + Intronic
1062607039 9:137353088-137353110 GGAGGCTTGGAGGCCAGGAGGGG - Intronic
1186535586 X:10343841-10343863 GGAGACCTGGCAGCCTGGGGAGG + Intergenic
1187963799 X:24591081-24591103 AGAGATGTGGAGGCCGGGTGTGG - Intronic
1190573523 X:51809406-51809428 GGAGACTAAGGGGCCGGGCGCGG - Intronic
1193772085 X:85599697-85599719 GGGGACTTGGGGGGAGGGTGGGG + Intergenic
1193960165 X:87914983-87915005 GGAAGCTTGGGGGCCAGGTGGGG - Intergenic
1195112029 X:101658750-101658772 GGAGAAATGGCGGACGGGGGCGG - Intronic
1195226759 X:102803443-102803465 GGGGACTTGGAGGAAGGGTGGGG - Intergenic
1197210000 X:123820515-123820537 GTGGATTTGTCGGCCGGGTGAGG - Intergenic