ID: 1165048418

View in Genome Browser
Species Human (GRCh38)
Location 19:33124859-33124881
Sequence GGATACTGATTGGATCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165048411_1165048418 14 Left 1165048411 19:33124822-33124844 CCGACTTTATCTGCATCTGGCAG 0: 1
1: 0
2: 0
3: 10
4: 168
Right 1165048418 19:33124859-33124881 GGATACTGATTGGATCACACAGG 0: 1
1: 0
2: 0
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165048418 Original CRISPR GGATACTGATTGGATCACAC AGG Intronic
903480704 1:23651276-23651298 AGATTCTGATTGGCTCACACTGG + Intergenic
905356663 1:37389697-37389719 GGATGCAGATTGGCTGACACAGG + Intergenic
907180987 1:52570024-52570046 GGATATTTATTGAATTACACAGG - Intergenic
912028386 1:105206875-105206897 GGGAAGTGATTGGATCACAGGGG - Intergenic
913452920 1:119004324-119004346 GTATACTGATTGGGTTTCACAGG - Intergenic
919226374 1:194709315-194709337 GGATACAGATTGCAACATACAGG + Intergenic
924153752 1:241154729-241154751 GGAGACTTATTGGATGACAAGGG + Intronic
1065971870 10:30812116-30812138 GGAGACTGAATGGAGCAGACGGG - Intergenic
1067004587 10:42648763-42648785 GGATACTGATGGATCCACACTGG - Intergenic
1067426671 10:46216170-46216192 GGATGCTGTTTGGAGCACAAAGG + Intergenic
1071230405 10:83579649-83579671 GGGAAGTGATTGGATCACAGGGG - Intergenic
1071752863 10:88501195-88501217 GGAAACTGATTTGATCACCTGGG + Intronic
1072233814 10:93436250-93436272 GGATACTGATTGGGTCAGAATGG - Intronic
1074002345 10:109386127-109386149 GAATACTGAATAGTTCACACAGG + Intergenic
1074249482 10:111730334-111730356 GCATACTGATTGGACCCCACAGG + Intergenic
1074981527 10:118623774-118623796 GGGAAGTGATTGGATCACGCGGG + Intergenic
1075256186 10:120927445-120927467 GGTCACTGATAGGGTCACACTGG + Intergenic
1078820966 11:14881574-14881596 GGGAACTGATTGGATCATAGGGG + Intronic
1081961121 11:47138317-47138339 GGAAGGTGATTGGATCACATGGG - Intronic
1084542261 11:69794515-69794537 TGATGCTGTTTGGAGCACACAGG + Intergenic
1089667128 11:120027494-120027516 GGATGCTGAGTGGAGCACGCTGG - Intergenic
1091067041 11:132524352-132524374 GGATGATGATGGAATCACACAGG - Intronic
1093640896 12:21526208-21526230 AAATACTGATTGCATCACCCAGG - Intergenic
1095196247 12:39321646-39321668 GGATACTGAATGGAAAACAATGG + Intronic
1097505017 12:60455891-60455913 GGTTGGTGATTGGATCACAGGGG - Intergenic
1101300638 12:103476495-103476517 GGATTCTGATTGGTCCAGACTGG + Intronic
1102199960 12:111050321-111050343 GGATACAGATGAGGTCACACAGG - Intronic
1106094197 13:26628534-26628556 GGATCCTGAATGGATCACCTGGG + Intronic
1107016796 13:35714157-35714179 GGATACTAAATGCATCCCACTGG + Intergenic
1109996784 13:70138061-70138083 GGAAAGTGATTGGATCACGTGGG - Intergenic
1110839040 13:80120468-80120490 GGGAAGTGATTGGATCACAGGGG + Intergenic
1118472432 14:66087235-66087257 GGATATTTATTGGATCACCAGGG - Intergenic
1125344360 15:38703967-38703989 AGATAATGATTGAATCAGACTGG - Intergenic
1126490531 15:49231351-49231373 GGAAAGTGATTGGATCACAGAGG - Intronic
1126929648 15:53633164-53633186 GGAAACTGATTGGATCAAGGGGG + Intronic
1134871769 16:17658346-17658368 GGAACGTGATTGGATCACAGGGG - Intergenic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1138997757 16:62475117-62475139 GGGAAGTGATTGGATCACAGGGG + Intergenic
1141086485 16:81099176-81099198 GGATGCTGACTGGATCACGCTGG + Intergenic
1141774031 16:86110408-86110430 GGAGGCTCATGGGATCACACAGG + Intergenic
1146568450 17:33933255-33933277 GGATAGTGATTGGTTCTGACTGG - Intronic
1149832678 17:59885457-59885479 GGATACTGCTTTGGTCCCACGGG - Intronic
1150574240 17:66416015-66416037 GGATACTGACTGGCACACAGTGG + Intronic
1153323442 18:3794950-3794972 GGATGCTGACTCCATCACACAGG - Intronic
1156344419 18:36242819-36242841 GGAAGGTGATTGGATCACAGGGG - Intronic
1156657612 18:39307751-39307773 GGATAGTGGTTGGATCATAGGGG - Intergenic
1157545568 18:48544174-48544196 GGATAGTGGTTGGTTGACACTGG + Intronic
1157842258 18:50969159-50969181 GGATACTGATTTGGACAAACTGG - Intronic
1158129605 18:54138396-54138418 GGAAGGTGATTGGATCACAAGGG + Intergenic
1158682891 18:59584550-59584572 GGGAAGTGATTGGATCACAGGGG + Intronic
1159020208 18:63137078-63137100 TGATTCTGAATGGATCACTCTGG - Intronic
1162055098 19:8057978-8058000 GGCTCGTGATTGGCTCACACTGG + Intronic
1165048418 19:33124859-33124881 GGATACTGATTGGATCACACAGG + Intronic
929809380 2:45176352-45176374 AGATTTTGATTGGATTACACTGG + Intergenic
930634703 2:53791444-53791466 GGATTCTGATTGTATAAAACAGG - Intronic
934886474 2:98029753-98029775 GGAAACTGATGGCATCACCCAGG + Intergenic
936622822 2:114118112-114118134 GGATACTTCTGGGTTCACACTGG + Intergenic
938154674 2:128924231-128924253 GGGAAATGATTGGATCACAGGGG - Intergenic
941125166 2:161576108-161576130 GGACATTGAGAGGATCACACTGG + Intronic
941128137 2:161611852-161611874 TGATACTGATTGGTACACATGGG + Intronic
944029198 2:195213327-195213349 GGGAACTGATTAGATCACAAAGG + Intergenic
945784273 2:214213867-214213889 GGATACTTATTGGTTCATAAAGG - Intronic
946550065 2:220791701-220791723 GGATATTGATTGGATATCAGTGG - Intergenic
947483049 2:230520884-230520906 GGATACAGATTGCAACATACAGG + Intronic
1169218160 20:3805118-3805140 GGAAAATGATGGGATGACACAGG - Exonic
1169312312 20:4554591-4554613 GGATACTGATTGCATTCCAAGGG + Intergenic
1170555764 20:17513554-17513576 GGACCCTGATTGGAGCAGACAGG + Intronic
1175550628 20:59814924-59814946 GGCTTCTGTTTGGATCAAACAGG + Intronic
1178733254 21:35124886-35124908 GGGAAGTGATTGGATCACAGGGG - Intronic
949491693 3:4595450-4595472 GGAAAGTGATTGGATCACAGGGG - Intronic
951401064 3:22231801-22231823 GGAAAATGATTGGATCATAGGGG + Intronic
956949600 3:74266406-74266428 GGATACTGATTGACTCACTATGG + Intronic
960761089 3:121074499-121074521 GGATACTGACGGATTCACACTGG + Intronic
960922400 3:122760780-122760802 GGTTACAGCTTGGAACACACTGG + Intronic
964838482 3:160967562-160967584 GGATGCTGATTAGATCAAAGGGG - Intronic
970461137 4:16276013-16276035 GGAAAATGATTGGATCATAGGGG + Intergenic
971877612 4:32325599-32325621 GGAAACTGATGGGAACACAAAGG + Intergenic
977145493 4:93434712-93434734 GGAAAATGACTGGATCACTCTGG - Intronic
978640137 4:110860981-110861003 GGAGACTAATTGGTTCTCACAGG - Intergenic
978970751 4:114802313-114802335 GGATACTGATTGGCTCATGTAGG + Intergenic
981528098 4:145727426-145727448 GTATATTGATGAGATCACACTGG + Intronic
983053332 4:163074162-163074184 GGAAACTGTTTGGATGACTCTGG - Intergenic
983885652 4:172977417-172977439 GGATACTGAGTGGATCATTGTGG + Intronic
985953399 5:3240944-3240966 TCATACTGATGGAATCACACAGG + Intergenic
986582482 5:9279630-9279652 GGAAGGTGATTGGATCACAGGGG + Intronic
988114596 5:26868266-26868288 ACATACTGCTTGGCTCACACTGG + Intergenic
990170392 5:53042111-53042133 GGTTACTGGTTGGTTCACCCTGG + Exonic
990453995 5:55966422-55966444 TGATACTGATTGAGTTACACAGG + Intronic
992757503 5:79922195-79922217 GGGAAGTGATTGGATCACAGGGG + Intergenic
996710403 5:126537741-126537763 GGAAGCTGATTGGATCATATGGG + Intergenic
998047305 5:138998743-138998765 GGAGAGTAATTGGATCACAGGGG - Intronic
998887442 5:146709076-146709098 AGACACTGATTGGATGACAGAGG - Intronic
1000876700 5:166648104-166648126 GGAAACTGATTGGGGCACATAGG + Intergenic
1004987709 6:21101566-21101588 GGACAGGGATGGGATCACACAGG - Intronic
1005222986 6:23609350-23609372 GGATATTAATTGTATTACACAGG + Intergenic
1009661130 6:66612806-66612828 GGATCCTGATAGGATCATGCTGG + Intergenic
1011524532 6:88249248-88249270 GGATTCTGATTGCATCATAAAGG + Intergenic
1016538638 6:145137937-145137959 GGCCACTGATTGGATAGCACAGG - Intergenic
1017645576 6:156537106-156537128 GGGAAGTGATTGGATCACGCGGG - Intergenic
1017927878 6:158925884-158925906 GGGAAGTGATTGGATCACAGGGG + Intergenic
1021659875 7:22909170-22909192 GGAAAGTGATTGGATCACAGGGG + Intergenic
1028962873 7:96769277-96769299 GGAAGGTGATTGGATCACAGGGG + Intergenic
1039114138 8:34073450-34073472 GGAAGGTTATTGGATCACACAGG - Intergenic
1043423052 8:80119954-80119976 GGGTACTGATGGGATCTCTCTGG + Intronic
1043585341 8:81762087-81762109 GGATACTCTTTGGATCTCACAGG - Intergenic
1044691831 8:94888326-94888348 GGATACTGAATGGTTAACATTGG + Intronic
1050452905 9:5802743-5802765 GTATACTGATTGAATGACAGGGG + Intronic
1058827371 9:108787193-108787215 GGATGCTGATGAGCTCACACAGG + Intergenic
1060374568 9:123106959-123106981 GGATGCTGCTGGGATTACACAGG - Intergenic
1185500891 X:596428-596450 GGAAGGTGATTGGATCACAGGGG + Intergenic
1187468721 X:19549437-19549459 AGAGACTGATTGGAACACTCAGG - Intronic
1188746452 X:33850716-33850738 GGTAACTGATTAGATCACAAGGG - Intergenic
1189333983 X:40158755-40158777 GGCTCCTGATTGGAGAACACTGG + Intronic
1190531417 X:51381673-51381695 GGAAACTGATTGCATAACAATGG + Intergenic
1197577857 X:128242162-128242184 CGATACAAATTGGATCAAACAGG - Intergenic
1198658255 X:138938235-138938257 GAAGACTGATTGGGTGACACAGG + Intronic