ID: 1165055671

View in Genome Browser
Species Human (GRCh38)
Location 19:33174806-33174828
Sequence CAGCTCATGTCTCCTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165055671_1165055675 -5 Left 1165055671 19:33174806-33174828 CCCATGGCAGGAGACATGAGCTG 0: 1
1: 0
2: 3
3: 16
4: 171
Right 1165055675 19:33174824-33174846 AGCTGGCAGGAGACATGAGCTGG 0: 2
1: 0
2: 5
3: 41
4: 381
1165055671_1165055676 -1 Left 1165055671 19:33174806-33174828 CCCATGGCAGGAGACATGAGCTG 0: 1
1: 0
2: 3
3: 16
4: 171
Right 1165055676 19:33174828-33174850 GGCAGGAGACATGAGCTGGCAGG 0: 3
1: 1
2: 2
3: 36
4: 323
1165055671_1165055678 16 Left 1165055671 19:33174806-33174828 CCCATGGCAGGAGACATGAGCTG 0: 1
1: 0
2: 3
3: 16
4: 171
Right 1165055678 19:33174845-33174867 GGCAGGAGACATGAGCTGGCAGG 0: 3
1: 1
2: 2
3: 36
4: 323
1165055671_1165055677 12 Left 1165055671 19:33174806-33174828 CCCATGGCAGGAGACATGAGCTG 0: 1
1: 0
2: 3
3: 16
4: 171
Right 1165055677 19:33174841-33174863 AGCTGGCAGGAGACATGAGCTGG 0: 2
1: 0
2: 5
3: 41
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165055671 Original CRISPR CAGCTCATGTCTCCTGCCAT GGG (reversed) Intronic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
901798767 1:11695040-11695062 CAGCTCATGCCACCTTCCCTGGG + Intronic
902201364 1:14836069-14836091 CAGGTCAGGTCTCCTGCTAGCGG - Intronic
902237566 1:15067323-15067345 CAGCTCTTGTCTCCTGGGGTGGG - Intronic
902810489 1:18885389-18885411 CAGCTGATGTCTGCTGCCATGGG + Exonic
902943427 1:19816454-19816476 GTGCTCATGTCACCTGCCAAGGG + Intergenic
903305156 1:22408164-22408186 CAGCCCAAGCCTCCTGCCACCGG + Intergenic
904609476 1:31717201-31717223 CAGCTCCTGTCACCTGTCAAGGG - Intergenic
904785258 1:32977786-32977808 CAGCTCCTGTCTCCTGGTAAAGG - Intergenic
905335435 1:37241411-37241433 CAGCTCATGGCTCCTGGGGTGGG + Intergenic
907915634 1:58866395-58866417 CAGTTCCTGTCTCCTGTGATGGG + Intergenic
909602747 1:77478083-77478105 CAGCTCACCTCTTGTGCCATGGG + Intronic
909793536 1:79703512-79703534 AAGATCATGTCATCTGCCATAGG + Intergenic
910688822 1:89945316-89945338 GCGCTTCTGTCTCCTGCCATGGG - Intergenic
912850100 1:113116391-113116413 CAACTTATGCCTCCTGCCAATGG + Exonic
915565547 1:156710843-156710865 CAGCTCTTGTCTCCAGACAGTGG + Intergenic
917863376 1:179170129-179170151 CATATGATGCCTCCTGCCATGGG - Intronic
923800035 1:237200018-237200040 TAGCTCATGTCACCTGTCTTAGG + Intronic
924396243 1:243624205-243624227 CAGCTGCCGTCTCATGCCATTGG - Intronic
924509662 1:244719033-244719055 CAGCTCATTTCTCTTGTCACTGG + Intergenic
924953626 1:248907305-248907327 CATGTCTTGCCTCCTGCCATAGG + Intronic
1062925197 10:1311168-1311190 AACCTCATTTCTCCTTCCATGGG + Intronic
1067817393 10:49491796-49491818 CAGCTAATGAGTCCTGCCACAGG + Intronic
1068484783 10:57643854-57643876 CAGCTCATGACTTCAGCCTTAGG + Intergenic
1069255626 10:66328814-66328836 CATCACATTTCTCCTGCCCTTGG - Intronic
1075052150 10:119190445-119190467 CAGCTCCTGTCACATGGCATTGG + Intergenic
1075410447 10:122224101-122224123 CAGGTCATTTCTCCACCCATTGG + Intronic
1075468605 10:122671175-122671197 CAGCCCAAGGATCCTGCCATGGG - Intergenic
1077070684 11:670126-670148 CCACTCATGTCCCCTTCCATCGG - Intronic
1084369998 11:68734993-68735015 CAGCTCATGGCACCTGACATGGG + Intronic
1085435245 11:76493892-76493914 CAGCTCTTCTCTCCTGTCACTGG - Intronic
1085512095 11:77093606-77093628 TCTGTCATGTCTCCTGCCATGGG + Intronic
1088830058 11:113529270-113529292 CAGCTCAAGTATCCTTCCCTAGG + Intergenic
1089360548 11:117883289-117883311 CAGCTCATTTCTGATGACATTGG + Intergenic
1094151553 12:27290002-27290024 CTGCTCATCCCTCCTGCCTTGGG - Intronic
1095972194 12:47909960-47909982 CAGCTCATGTCTTCTTCCTCGGG + Intronic
1098056452 12:66511197-66511219 CTTCTCCTGTCTGCTGCCATGGG + Intronic
1098877822 12:75884890-75884912 CAGCTCAAATCTCCTGCCTTAGG + Intergenic
1099897166 12:88662657-88662679 CAGCTCCTGGCTCCAGCCACTGG - Intergenic
1101243952 12:102866757-102866779 CAGTGCATGTCTCCTTCCCTTGG + Intronic
1103700394 12:122846173-122846195 CAGCCCCTGCCTCCTGCCCTGGG + Intronic
1104216856 12:126742137-126742159 AAGCTCAGGTCTCCTTCCAATGG - Intergenic
1105303449 13:19154164-19154186 CAGCTCACGTCTCCTCCCACAGG - Intergenic
1105320709 13:19318725-19318747 CAGCACATCTCTCCTACTATAGG + Intergenic
1110108046 13:71704600-71704622 CAGCTCAGGCTCCCTGCCATGGG - Intronic
1110232600 13:73182388-73182410 CAGCACATGTGGGCTGCCATGGG + Intergenic
1111348363 13:86994209-86994231 CATCTCCTGCCTCCTGCCACTGG - Intergenic
1115492573 14:33972574-33972596 CAGCACTTGTCTCCTGCCTGTGG - Intronic
1120058420 14:79953350-79953372 AAGCTCTTCTCTTCTGCCATTGG + Intergenic
1121120137 14:91371424-91371446 CAGCACATGGCTCCTCCCATGGG - Intronic
1126350670 15:47742066-47742088 CAGCTGAGGCCTCCTGCCCTTGG - Intronic
1128375418 15:67071071-67071093 CAGCTCATGCCTCATACCTTTGG - Intronic
1132534518 16:471453-471475 CAGCTCGTGCCTCCTGCCTCCGG + Intronic
1133287144 16:4695896-4695918 CAGCTCAGGCCCCCTGCCCTAGG + Intergenic
1134206621 16:12243388-12243410 CACCTGATGTCTCCTGCAGTTGG + Intronic
1142518507 17:489503-489525 CAGCTCATGTCACCTCCTCTGGG - Intergenic
1143659618 17:8316383-8316405 GAACTCATGTCTCCAGCCAGAGG - Intronic
1144326871 17:14190815-14190837 CAGGCCCTCTCTCCTGCCATAGG + Intronic
1144475753 17:15587678-15587700 CAGGCCCTCTCTCCTGCCATAGG + Intronic
1144837260 17:18163169-18163191 CAGCCCTTGTCTCCTGCCCTGGG - Intronic
1146657972 17:34646101-34646123 CATCTCCTGTCTCCTGACAATGG - Intergenic
1149509400 17:57226589-57226611 CAACTCAGCTCTCCTGCTATGGG + Intergenic
1150425939 17:65077142-65077164 CAGCTCCTGTCTCCTACTCTGGG + Intergenic
1152814015 17:82397059-82397081 CAGCTCAGGCCACCTGCCACAGG + Intronic
1153559617 18:6358808-6358830 CTGCTCATTCCTCTTGCCATTGG - Intronic
1156608528 18:38698148-38698170 AGGCTCATGTCTCCTGCCCTGGG + Intergenic
1158977278 18:62722102-62722124 CATCTAAAATCTCCTGCCATGGG - Intronic
1160667736 19:340958-340980 CATCTCACGCCTCCTGCCCTGGG + Intronic
1161358340 19:3832068-3832090 CGGCTTCTCTCTCCTGCCATGGG + Intronic
1163348337 19:16759171-16759193 CATCTCATGTCTTCTGCATTTGG - Intronic
1165055671 19:33174806-33174828 CAGCTCATGTCTCCTGCCATGGG - Intronic
1167526244 19:49985658-49985680 TAGCTCCTGTCTCCCGCAATAGG + Intronic
927114214 2:19885730-19885752 CAACTCCTATCTCCTGCCATGGG + Intergenic
927518466 2:23685685-23685707 CACCTCAGGTCTCCTGCCCCCGG + Intronic
928201227 2:29248980-29249002 CAGCTGATTTCTCCACCCATGGG + Intronic
929030778 2:37648426-37648448 CAGTTCTTGTCACCTGCCACTGG - Intronic
929271730 2:39980400-39980422 CTGCCCTTGTGTCCTGCCATCGG - Intergenic
929864666 2:45708054-45708076 CTGCACATGTTTCCTGCCTTCGG + Intronic
929938893 2:46315481-46315503 CACCTCATGTCTCTGGCCAGTGG - Intronic
931745233 2:65286166-65286188 TTTCTCATGCCTCCTGCCATAGG - Intergenic
932219670 2:69989945-69989967 CAGCACATGGCCCTTGCCATGGG + Intergenic
932232646 2:70095261-70095283 CAGCTTCTGCCTCCTGCCACAGG + Intergenic
933373767 2:81451733-81451755 CAGCTTATGTCTAATGACATCGG + Intergenic
933467610 2:82675383-82675405 TGACTCATGTCTCCTGCCATGGG - Intergenic
935946313 2:108289703-108289725 CAGCACATGGTTCCTGCCCTTGG - Intronic
936974223 2:118203180-118203202 CAGCTCAAGTGTCCCGCCGTCGG + Intergenic
936984421 2:118295823-118295845 CAGCTCTTCTTTCCTACCATTGG + Intergenic
937892001 2:126946182-126946204 CACCTCGTGTCTCATGCCTTTGG - Intergenic
940770824 2:157837903-157837925 CAGCTGTTGTCTCCTGCAGTTGG + Intronic
942654822 2:178204427-178204449 CAGCTCAAGTCTGCTGCCCTGGG + Intronic
943454182 2:188082597-188082619 CAACTCATGTTTTCTGACATGGG + Intergenic
944585729 2:201171831-201171853 CAGCTCATATCTCCTACCTCTGG + Exonic
945575565 2:211524969-211524991 CAGCTTATGCCTGCTCCCATAGG + Intronic
945749295 2:213760846-213760868 CATCTAATGCCTTCTGCCATAGG - Intronic
946789471 2:223285520-223285542 CAGCCCAGGTCTACAGCCATGGG + Intergenic
948119512 2:235518611-235518633 CAGCTGGTGTTTTCTGCCATAGG + Intronic
1168955509 20:1831855-1831877 CTGCTCAGGTCTCCTACCGTGGG - Intergenic
1173009559 20:39169490-39169512 CAGTTAATGTCTCCTGCTACAGG + Intergenic
1173654657 20:44691254-44691276 CTCATCATCTCTCCTGCCATTGG + Intergenic
1173775859 20:45705740-45705762 AAGCTCATTTCTCTTGCCATAGG - Intronic
1174860319 20:54085221-54085243 CAGCTCATTTCTCCTGGCCCAGG + Intergenic
1178517919 21:33264361-33264383 CACATCCTGTCTCCTGCAATTGG + Exonic
1178576055 21:33792749-33792771 CATGTCAGGTCTGCTGCCATAGG + Intronic
1179069712 21:38060130-38060152 CAGCACATGCCTGCTGCCGTGGG - Intronic
1179966610 21:44810482-44810504 CATCTCATGTGTGCTGCCGTGGG - Intronic
1180066555 21:45415416-45415438 CAGCTCCTGGCTGCTGCCCTGGG - Intronic
1181899512 22:26141635-26141657 CATGTGATGTCTTCTGCCATGGG - Intergenic
1182398580 22:30056120-30056142 CAACTCATGGCTTCTTCCATGGG + Intergenic
1182652242 22:31861467-31861489 CAGCTCATGGCGTCTGCCAGTGG - Intronic
1183199012 22:36373181-36373203 GAGCCCAAGTCTCCTGCCAATGG + Intronic
1183332313 22:37228251-37228273 GAGCTCCTCTGTCCTGCCATGGG + Intronic
1183771006 22:39925846-39925868 CAGTTCTTGCATCCTGCCATTGG + Intronic
950493173 3:13318456-13318478 GAGCTCGTGTCTGCTGACATGGG - Intronic
952279189 3:31906963-31906985 CAGATCATTTCTCCAGCCTTCGG + Intronic
952737266 3:36703283-36703305 CTGGTAATGACTCCTGCCATTGG + Intergenic
958645978 3:96874701-96874723 CAGCTCCTGTCACCTCTCATGGG + Intronic
961008761 3:123422625-123422647 CAGCTCATGTCTGGTGGCAGGGG + Intronic
961822533 3:129582470-129582492 CAGCTCATCTCTCCAGGCAAAGG - Intronic
962484512 3:135829415-135829437 CCTCTCTTGTCTCCTGCCCTGGG - Intergenic
964169116 3:153746395-153746417 CAGTTCATATCTCCCGCCTTTGG - Intergenic
967473432 3:189889363-189889385 CCATTCATGTCTCCAGCCATTGG - Exonic
969844485 4:9909477-9909499 CAGTTCTTGTCTGATGCCATGGG - Intronic
976711378 4:88074955-88074977 CAGCTCATGACTACTGACCTCGG - Exonic
978852787 4:113358086-113358108 CAGCTGATGTCTCCAGCGGTAGG - Exonic
982187918 4:152820806-152820828 CAGCACATTTCTCCTGCGACTGG + Intronic
982485090 4:155956878-155956900 CATATCATCTCTTCTGCCATTGG + Intergenic
985552166 5:539314-539336 CAGCTCAGGACTCCTGGCTTTGG + Intergenic
987194787 5:15515356-15515378 CAGTTCCTGGCTGCTGCCATTGG + Intronic
989535392 5:42557723-42557745 AAGCTAATGTCTCCTGACCTGGG + Intronic
990391172 5:55322880-55322902 CATCTCAAGACTCCTGCTATGGG + Intronic
993379485 5:87190181-87190203 CAGCTCAAGTGTCCTTTCATGGG - Intergenic
997505287 5:134412037-134412059 CAGCCCGTGGCTCCTGCCCTGGG + Intergenic
998353153 5:141514002-141514024 CAGCTCAAGTCTGTTGTCATGGG + Intergenic
999753501 5:154647523-154647545 CAGCTCCTGTCTCCTGCGCTTGG + Intergenic
999801343 5:155040610-155040632 CAGCTCTTTTCTCCTCCCAGAGG - Intergenic
1000930063 5:167240831-167240853 CTCCTCATGTCTCCTTGCATTGG + Intergenic
1003308024 6:4946529-4946551 CAGCTCATACCTACAGCCATGGG - Intronic
1003633982 6:7814627-7814649 CATTACATGTCTCCTGCCAATGG - Intronic
1007574626 6:42916886-42916908 GAGCTCAGGCCTCCTGCCATGGG - Intronic
1007731658 6:43951228-43951250 GAGCCCATGCCTCCTGCCCTGGG - Intergenic
1007737478 6:43990663-43990685 CAGCTCTTGCCTTCTTCCATGGG + Intergenic
1007808177 6:44466550-44466572 CAGCTCATGTCTCCAACCCCTGG + Intergenic
1013065784 6:106683607-106683629 AATCTCTTTTCTCCTGCCATAGG + Intergenic
1015380867 6:132566700-132566722 CACTTCCTTTCTCCTGCCATGGG - Intergenic
1016227567 6:141758641-141758663 CATGTGATGTCTTCTGCCATGGG + Intergenic
1016463993 6:144308044-144308066 CAGCTGCAATCTCCTGCCATCGG + Intronic
1017343946 6:153357638-153357660 CAGCTCCTTTCTGCTGCAATCGG - Intergenic
1019819604 7:3232456-3232478 CAGCTCATTCCTGCTGCCTTAGG + Intergenic
1020224722 7:6271804-6271826 CAGCTCGTGTCTCCCACCCTCGG + Intronic
1020280795 7:6649035-6649057 CAGCTCCTGTCACCTGCCGCTGG + Intronic
1023627976 7:42135783-42135805 CAGTTCATGTCTCCTGACTTTGG - Intronic
1025251399 7:57353690-57353712 CAGCTCTTGACTCCTTCCTTAGG - Intergenic
1028301563 7:89206898-89206920 CAGCACTTTGCTCCTGCCATAGG - Intronic
1031547741 7:123070096-123070118 CAGGTCTTGTCTCCTTCCAAAGG - Intergenic
1033715386 7:143996515-143996537 CATGTCTCGTCTCCTGCCATAGG + Intergenic
1035340468 7:158157544-158157566 CAGCTCATGTCTTCTCCCAGGGG - Intronic
1036019980 8:4833782-4833804 CAGCTGATCTATCCTTCCATGGG - Intronic
1037459412 8:19094223-19094245 CAGCTCATGTCTGTTGACCTTGG + Intergenic
1037606979 8:20446260-20446282 TAGCTAATGTCTACTGCGATGGG + Intergenic
1037975061 8:23203354-23203376 CAGCCCATGCCACCTGCCATGGG + Intronic
1039224985 8:35378544-35378566 CATTTGATGTCTCCTGCCAGAGG + Intronic
1039913313 8:41841890-41841912 CAGCTCATGTCACCTGCCGTGGG + Intronic
1039920563 8:41891387-41891409 CAGCTCGTGTCCCCTGCCCAGGG + Intronic
1040343202 8:46455907-46455929 CATGTCTTGCCTCCTGCCATAGG + Intergenic
1040547577 8:48410850-48410872 CAGTGCATGTGTCCTGCCCTGGG - Intergenic
1042046473 8:64658030-64658052 TTGGTCATCTCTCCTGCCATGGG - Intronic
1045930017 8:107611302-107611324 CAGCTTATTTCTCATTCCATTGG + Intergenic
1049598072 8:143493518-143493540 CAGCTCAGCCCTGCTGCCATGGG + Intronic
1050411648 9:5372592-5372614 CAGCTACTGCCTCCTGCCACAGG + Intronic
1051178600 9:14386403-14386425 AAGGTCCTGTCTCCTGCCTTAGG + Intronic
1051605274 9:18912119-18912141 CAGCTCCTCCCTCCTGCCGTGGG - Intergenic
1051607077 9:18926746-18926768 CAGCTCATGTCTAAAGCCTTGGG - Intergenic
1052747209 9:32452395-32452417 CCCCTCATTTCTTCTGCCATGGG + Exonic
1053119972 9:35539087-35539109 CAGCTCAAGGCTCCTGACAGAGG + Exonic
1055111792 9:72567051-72567073 CTGCTTATGTCTCCTGCCTCAGG + Intronic
1055379899 9:75694898-75694920 CAGCTGAGGTCTCCTGTCTTTGG + Intergenic
1055599172 9:77897566-77897588 CAGCACTGGGCTCCTGCCATGGG + Intronic
1057702745 9:97375626-97375648 CAGCTCAGGTCGGCTGCCTTGGG + Intronic
1058126296 9:101199037-101199059 CAGCTCATGTCTCCTTTCCATGG - Intronic
1186446902 X:9637856-9637878 CAGCTCCTCTCACCTACCATTGG + Intronic
1189225887 X:39412975-39412997 CAGCACATGTTTCCTGCCTCTGG + Intergenic
1189341814 X:40210255-40210277 CAGCTAATGACCTCTGCCATGGG - Intergenic
1193884191 X:86964215-86964237 CAACTCATGACTCCTGAGATGGG - Intergenic
1194782106 X:98036349-98036371 CAGCACTTGTCTCCTGCCATTGG + Intergenic
1195398793 X:104439717-104439739 CAGCTCAGGTGTGCTTCCATTGG + Intergenic
1195704885 X:107731748-107731770 CAGATCATGTCTGCCCCCATGGG + Intronic
1197869705 X:131053373-131053395 CAGCTCATCTCTTCTCCCCTGGG + Intergenic
1198075717 X:133191088-133191110 CAGCTCTTGTCCCCAGCCAGAGG + Intergenic
1199713614 X:150490137-150490159 CTGCTGACATCTCCTGCCATGGG - Intronic
1200758977 Y:7018719-7018741 CAGCTCTTCTCACCTACCATTGG + Intronic
1201390255 Y:13489979-13490001 CAGCATATGTCTGCTGCCATTGG - Intergenic