ID: 1165056881

View in Genome Browser
Species Human (GRCh38)
Location 19:33183140-33183162
Sequence ATTCCTCAGCAGAGCTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165056878_1165056881 11 Left 1165056878 19:33183106-33183128 CCAGCTGATGCTCCAGGAGCCTG 0: 1
1: 0
2: 2
3: 40
4: 291
Right 1165056881 19:33183140-33183162 ATTCCTCAGCAGAGCTTCTCTGG 0: 1
1: 0
2: 1
3: 18
4: 170
1165056879_1165056881 -1 Left 1165056879 19:33183118-33183140 CCAGGAGCCTGTCTGCTCTTGAA 0: 1
1: 0
2: 2
3: 18
4: 189
Right 1165056881 19:33183140-33183162 ATTCCTCAGCAGAGCTTCTCTGG 0: 1
1: 0
2: 1
3: 18
4: 170
1165056880_1165056881 -8 Left 1165056880 19:33183125-33183147 CCTGTCTGCTCTTGAATTCCTCA 0: 1
1: 1
2: 158
3: 5294
4: 72309
Right 1165056881 19:33183140-33183162 ATTCCTCAGCAGAGCTTCTCTGG 0: 1
1: 0
2: 1
3: 18
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165056881 Original CRISPR ATTCCTCAGCAGAGCTTCTC TGG Intronic
900832036 1:4972431-4972453 ATGCCTCAGCATCGCTGCTCTGG - Intergenic
902170038 1:14602572-14602594 TTTCCTCAGCATAACATCTCTGG + Intronic
912665824 1:111578693-111578715 ATTCTCCAGCAGACCCTCTCTGG + Intronic
912920202 1:113859031-113859053 AATCCTCATCAGAGGTTATCAGG + Exonic
915974786 1:160378100-160378122 CTTGCTCACCAGAGCTTCTCAGG - Intergenic
916417409 1:164605339-164605361 ATTCCACAGCAGAGCTTCCAGGG + Intronic
920120125 1:203650230-203650252 ACTTCTCAGCACAGCTTCCCCGG - Intronic
921807228 1:219469895-219469917 AATCCTCACTAGGGCTTCTCTGG + Intergenic
923238765 1:232060293-232060315 CATCCTCAGCAGCACTTCTCAGG + Intergenic
924004510 1:239593089-239593111 TTTTATCAGCAAAGCTTCTCTGG - Intronic
1064042139 10:11976202-11976224 ATTTCTCAGCTGAGGTTCTTAGG + Intronic
1064053918 10:12081550-12081572 ATTCTCCAGCAGGGCTTGTCCGG - Exonic
1070761659 10:79027873-79027895 ATTGCTCAGCTCAGCTTCTGAGG - Intergenic
1074692066 10:116015235-116015257 ATTCCACAGAAGATATTCTCAGG + Intergenic
1075740339 10:124692041-124692063 TTTCCTCTACAAAGCTTCTCTGG - Intronic
1077053278 11:577165-577187 AGTCCTCACAAGAGCCTCTCAGG + Intronic
1077870027 11:6253933-6253955 ATTTCTCAGCAGAGCTCAGCTGG - Intergenic
1078320074 11:10326611-10326633 TTTATTCAGGAGAGCTTCTCTGG - Intronic
1080054565 11:27892768-27892790 TTCCCTCAGCAGAGCTTCCTAGG + Intergenic
1084899703 11:72300503-72300525 CTTCCTCAGCAGAGGTTCAGGGG + Intronic
1085744038 11:79099604-79099626 ATTTTTCAGTAGAGCTTCTCAGG + Intronic
1085780164 11:79400981-79401003 AATCCCAATCAGAGCTTCTCAGG - Intronic
1085912993 11:80850787-80850809 ATTCCTCAGTAATGCTTCTCAGG + Intergenic
1086433427 11:86758230-86758252 ATTCTTCTGCAGATCTTCCCTGG + Intergenic
1086616065 11:88821543-88821565 AATCCTGAGCAGTTCTTCTCTGG + Intronic
1087603689 11:100347814-100347836 ATTCCTCTGCTGAGCATCTTCGG - Intronic
1088973897 11:114797603-114797625 TTGTCTCAGCAGAGCTTCCCTGG + Intergenic
1089714056 11:120338857-120338879 TTTCTTCAGCATTGCTTCTCAGG + Intronic
1091805120 12:3350424-3350446 CTTCCTCTGAACAGCTTCTCAGG - Intergenic
1095294040 12:40508203-40508225 ATTCCTTAGCAGAACTACTCAGG - Intronic
1095826934 12:46539868-46539890 ATTCCTCAGCACAGCTTTCAAGG - Intergenic
1098641494 12:72843579-72843601 GTTCCTCAGCAGAGATTATGGGG - Intergenic
1100952428 12:99866201-99866223 ATTCCTTATCAGGGCTTCTTAGG - Intronic
1104129810 12:125882474-125882496 GTTCCTCAGCAGTGCATCGCTGG - Intergenic
1104417501 12:128607325-128607347 AGTCCTCACCAGGGCTTCTGAGG - Intronic
1104619537 12:130301073-130301095 ATTCCTCAGGAGAGACTCCCAGG + Intergenic
1105033931 12:132904760-132904782 ATTCCCCGGCAGAGTTCCTCTGG + Intronic
1105354324 13:19645072-19645094 AGTCCTGAGGAGAGCTTCACTGG + Intronic
1107806136 13:44155692-44155714 ATTCCACACCAGACCTTCTGAGG + Intronic
1108176198 13:47795318-47795340 ATTCCCCTTTAGAGCTTCTCTGG - Intergenic
1109573750 13:64226581-64226603 ATTTTTCAGCAGAGCTTCAGAGG - Intergenic
1113465780 13:110512087-110512109 ATTCCCGAGCAGAGCTTCCAGGG + Exonic
1116302374 14:43200415-43200437 ATGCCCAAGCAGAACTTCTCAGG + Intergenic
1119615853 14:76098873-76098895 AATCCTCAGCAGATCCGCTCTGG + Intergenic
1121175029 14:91884686-91884708 ATCCCTCAGCACAGTTACTCAGG - Intronic
1121734440 14:96208185-96208207 ATTCCTCCTCTGAGCTCCTCTGG + Intronic
1123130427 14:105981364-105981386 ATTCCTCAGCAGGCCGTCCCTGG - Intergenic
1123977277 15:25565243-25565265 GTTCCTCAGCAGGTCTTCCCTGG - Intergenic
1123990267 15:25678211-25678233 ATTCCTCAGCATGGCGTATCAGG - Exonic
1124188446 15:27550605-27550627 AATCCTTAGCAAAGCTCCTCAGG - Intergenic
1126351170 15:47746241-47746263 GTGCCTCATCAGAGGTTCTCAGG - Intronic
1126480193 15:49110644-49110666 ATGCCACAGCAGTGCTTCTGGGG - Intronic
1127257609 15:57305343-57305365 ATATCTCAGCTGAGCTCCTCTGG - Intergenic
1128445669 15:67757892-67757914 TCTCCTCTGCAGAGCTTCCCTGG - Intronic
1128563271 15:68682556-68682578 AGTCCTCAGCACAGCATCTAGGG - Intronic
1130877869 15:88029875-88029897 AGTCCTCAGCAGAGATTTACTGG - Intronic
1133373975 16:5268332-5268354 ATTCCTCAGCACATCATCTTTGG + Intergenic
1134099237 16:11439928-11439950 AATCCTCAGCAGTGCTTTGCTGG + Intronic
1138320346 16:56106007-56106029 AATCCTCAGCAGGGCCTCTAAGG - Intergenic
1143812225 17:9481251-9481273 AGTCCTCAGCATAGCTCTTCCGG + Intronic
1144167814 17:12629577-12629599 ATTCATCAGCAGAGATCCTAAGG + Intergenic
1146891604 17:36510003-36510025 TTCCCCCAGCAGAGCTTCTCAGG + Intronic
1146949434 17:36895444-36895466 ATGTCTCAGCAGAGTTTCTAAGG + Intergenic
1147915467 17:43882894-43882916 AGTCCTCACCAGATGTTCTCCGG + Exonic
1148257727 17:46150363-46150385 CTTCTTCAGCAGAACTTCTATGG + Intronic
1149155893 17:53629853-53629875 ATTCATCTGCAGAGCTACTGGGG - Intergenic
1150453657 17:65289797-65289819 TTTCCACCGCAGAACTTCTCAGG - Intergenic
1151274985 17:73027563-73027585 ATTACTCAGAAGAGCCTGTCAGG - Intronic
1151404207 17:73876278-73876300 ATTTCTCAGCAGGGCAACTCGGG - Intergenic
1151808650 17:76422692-76422714 CCTCCTCAGAAGGGCTTCTCTGG + Intronic
1153331109 18:3876151-3876173 CTTCCTCAGCAGAGCTTGCACGG + Intronic
1159766532 18:72497266-72497288 ATTTCTTTGAAGAGCTTCTCTGG + Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1161043599 19:2122899-2122921 ATTCCTCAACAGAGCAGCACGGG + Intronic
1163600697 19:18247606-18247628 ATTTCTCAGTAGAGGGTCTCTGG + Intronic
1164959635 19:32416759-32416781 AGTACTCAGAAGAGCTTCTTTGG - Intronic
1165056881 19:33183140-33183162 ATTCCTCAGCAGAGCTTCTCTGG + Intronic
925275827 2:2647582-2647604 ATCCCTCAGAAAAGCTTGTCGGG - Intergenic
925460220 2:4055973-4055995 ATTTCTCACCACAGCTTATCTGG + Intergenic
926984278 2:18604791-18604813 GTTACTCTGTAGAGCTTCTCCGG + Intergenic
929943379 2:46352078-46352100 CTTTCTCAGCAGAGCACCTCTGG + Intronic
930710053 2:54542575-54542597 ATTCCACATCAGTGGTTCTCAGG - Intronic
930929340 2:56861768-56861790 TTTCCTCAGCAAATCTTCTGGGG + Intergenic
932467950 2:71935390-71935412 CTTCCTCTGCAGAGCTCCTCTGG - Intergenic
935828952 2:106979175-106979197 ATTCCACTGCAAATCTTCTCTGG + Intergenic
937506519 2:122543532-122543554 ATTCCTTAGCAGGGCTTATAAGG - Intergenic
937910943 2:127075441-127075463 ATTCCTTCCCAGAGCTTCTTGGG - Intronic
938900623 2:135796214-135796236 AGGCCTCAGCAGGGCATCTCTGG - Intronic
944908802 2:204288876-204288898 TTTCCACAGGACAGCTTCTCTGG - Intergenic
948587534 2:239028532-239028554 AATCCACAGCAGAGATTCCCTGG + Intergenic
1169651980 20:7879108-7879130 ATTTCTCAGCTGAGCATCTGAGG + Intergenic
1171410442 20:24943535-24943557 AATCCTCACCACAGCTTCTAGGG + Intergenic
1178450922 21:32699058-32699080 AGTCCTCAGCAGAGCATGGCAGG - Intronic
1178915289 21:36702466-36702488 ATTCGTCAGGACAGCTGCTCCGG + Intronic
1179835671 21:44030929-44030951 AATCCTCACCAGAGCTCCTCTGG + Intronic
1182137066 22:27916106-27916128 ATTACTCAGCAGTGATTCTTTGG - Intronic
1182401022 22:30078127-30078149 TTTCCTCCGAAGAGCTTCTGTGG - Intergenic
1185057464 22:48588418-48588440 ATGCCTCAGCAGAGCCTTTCAGG - Intronic
949092853 3:49934-49956 ATTCCTCCCCTGAGCTTCTGTGG - Intergenic
952413014 3:33066121-33066143 TCTCCTCAGCTGAGCTCCTCAGG + Intronic
952537086 3:34322462-34322484 AATCCTTAGCACAGCTTCTCAGG - Intergenic
953458347 3:43061747-43061769 TTGCCTCAGCAGAGCCTCTGAGG - Intergenic
954853104 3:53619685-53619707 ATCCCTCAGCAGAACTTAACTGG + Intronic
955549231 3:60065812-60065834 ATTCCCCAGCAGATTTTCACTGG - Intronic
956282803 3:67576113-67576135 TTTCCACAGCAGAGTTTCTGTGG + Intronic
957033119 3:75266020-75266042 ATTCCTCCCCTGAGCTTCTGTGG - Intergenic
960714172 3:120559510-120559532 AATCCCCAGAAGAGCCTCTCAGG + Intergenic
960953327 3:123013649-123013671 ACTCCTCAGCAGAGTGTCTGAGG + Intronic
961374162 3:126451554-126451576 CTTTCTCAGGAGAGCTTCACTGG - Intronic
961465621 3:127079263-127079285 ATTCCACCGCACAGCTACTCAGG - Intergenic
961674591 3:128556866-128556888 GTTCCTCACCAGCTCTTCTCAGG - Intergenic
961724489 3:128917460-128917482 ACCCCTCAGCAGAGAATCTCAGG - Intronic
962367546 3:134796208-134796230 ATACCACGGCAGAGCTTCTCCGG - Intronic
962856606 3:139351852-139351874 ATTCCTCAGCCTAGCATCTGAGG - Intronic
967065375 3:185910637-185910659 ATTCATCAGAAGAGCATCTGTGG + Intergenic
967074653 3:185991115-185991137 ATTCATCAGAAGAGCATCTGTGG + Intergenic
970006819 4:11418958-11418980 CTGCCTCAGCAGAGCTTCTGAGG - Intronic
970246211 4:14066520-14066542 ACACCTCAGCAGCCCTTCTCTGG - Intergenic
973737780 4:53889408-53889430 CGTCCTCAGCAGTGTTTCTCTGG - Intronic
976000250 4:80365990-80366012 TTTCATCTGCAGATCTTCTCTGG + Intronic
978190044 4:105900189-105900211 CTTCCTCATCAGAGGTGCTCTGG + Intronic
978942906 4:114458918-114458940 ATGCATCAGCACAACTTCTCAGG - Intergenic
984480283 4:180292002-180292024 CTTCCTCTGCACAGTTTCTCAGG + Intergenic
987511398 5:18844889-18844911 ATTCCAAGGCAGAGTTTCTCTGG - Intergenic
987717778 5:21594179-21594201 ATACCTTAGAAGAGCTTTTCAGG - Intergenic
988082975 5:26435994-26436016 ATTCCTCAGCTTTGTTTCTCTGG - Intergenic
992660037 5:78950314-78950336 TTTCCTCAGCCCAGCTTCTCTGG - Intronic
994504405 5:100623141-100623163 ATTCCTTTGCAGAGGTTCTGTGG - Intergenic
995565575 5:113430569-113430591 ATTCCTCAGGACAGTTGCTCAGG + Intronic
996091505 5:119356147-119356169 ATTCCTCCGCAGAACTTGGCCGG - Intronic
999598951 5:153238927-153238949 AAAGCTCAGGAGAGCTTCTCTGG - Intergenic
1002076744 5:176712907-176712929 ATTCCACACGAGAGCATCTCGGG - Intergenic
1004015775 6:11730638-11730660 ATCCCTCAGCAAAGCTTCCTGGG - Intronic
1004231920 6:13841452-13841474 AATCCCCACCAGAGCTTCCCAGG - Intergenic
1005904000 6:30244576-30244598 ATTCCTCAGCAGTGGGTCTGAGG + Intergenic
1007473966 6:42107062-42107084 TTGGCTCAGCAGGGCTTCTCGGG + Exonic
1010895748 6:81360695-81360717 AACCCTCAGCTGAGCTTCTTAGG - Intergenic
1012428398 6:99140051-99140073 AAACCTCTGCAGAGTTTCTCTGG - Intergenic
1013845439 6:114445105-114445127 ATTACTCAGCAGATCTTCAGAGG + Intergenic
1015598610 6:134890753-134890775 ATTTTTCAGCAAAGATTCTCTGG - Intergenic
1015897679 6:138033123-138033145 TTTCGTCAGTGGAGCTTCTCTGG - Intergenic
1016386144 6:143532685-143532707 ATTCCTCAGCATGGCATATCAGG - Intergenic
1016935286 6:149445297-149445319 ATGCCACAGCAGGGCTCCTCTGG + Intergenic
1017604567 6:156120163-156120185 ATTGCTCAGCATATTTTCTCTGG + Intergenic
1018952415 6:168387747-168387769 TGTCCCCAGCAGAGCTTCTCAGG + Intergenic
1020502317 7:8938875-8938897 GTCCCTCAACAGAGTTTCTCAGG - Intergenic
1021450411 7:20778624-20778646 ATTCCTCAACTTTGCTTCTCAGG - Intergenic
1023520572 7:41046385-41046407 ATTCCAAATCAGAGCCTCTCAGG - Intergenic
1027821987 7:83058221-83058243 AGTCCTCAGTAGAGCATCTGAGG - Intronic
1031406275 7:121391000-121391022 ATTCCTCACCACATTTTCTCTGG - Intronic
1032611473 7:133419929-133419951 CTTCCTCAGTTGAGCCTCTCAGG - Intronic
1035618374 8:1019348-1019370 ATTATGCAGCAGAGATTCTCTGG - Intergenic
1039906317 8:41789044-41789066 CTTCCTCTGCAAAGCTTCCCTGG + Intronic
1040410259 8:47146969-47146991 ATTCCTCAGCAGAGTGACTAGGG + Intergenic
1042563337 8:70090113-70090135 ATTCCTCAGCAGAGGTCCTCGGG - Intergenic
1042865483 8:73353344-73353366 ATTCCACAGCAGAGCTACTGAGG - Intergenic
1044413421 8:91910020-91910042 ATTGCCCTGCAGAGCTCCTCAGG + Intergenic
1044635561 8:94320257-94320279 ATTCCCCAGCAGTGCCTCTGTGG - Intergenic
1044644613 8:94425158-94425180 ATTCCTAAGCATAGCCACTCTGG + Intronic
1045679916 8:104647631-104647653 ATTCTTCAGCAGGGCTACTTGGG - Intronic
1051215276 9:14791150-14791172 ATTACTCAACTGACCTTCTCAGG + Intronic
1052032213 9:23641491-23641513 ATACCTGAGCAGAGCTTCTTGGG - Intergenic
1053611478 9:39718115-39718137 ATTCCTCAGGAAAACTTATCAGG + Intergenic
1053869511 9:42476170-42476192 ATTCCTCAGGAAAACTTATCAGG + Intergenic
1054086776 9:60753045-60753067 ATTCCTCAGGAAAACTTATCAGG - Intergenic
1054242042 9:62624272-62624294 ATTCCTCAGGAAAACTTATCAGG - Intergenic
1054556166 9:66658788-66658810 ATTCCTCAGGAAAACTTATCAGG - Intergenic
1055422738 9:76161238-76161260 ATTCCTCAGCATAGGATCGCTGG + Intronic
1056543854 9:87596712-87596734 CTTCCTCTGCACAGCTTCTGGGG + Intronic
1057023632 9:91719421-91719443 ATTCCCCAGCAAAGCCACTCTGG + Intronic
1058346789 9:103973244-103973266 ATTTCTCTTCACAGCTTCTCTGG + Intergenic
1059261798 9:112984063-112984085 ATTCCTAAGCAGGGCTGCTATGG - Intergenic
1060292602 9:122318251-122318273 CTTCTTCAGCAGAGCTTGCCTGG - Intronic
1061519957 9:131112029-131112051 CCTCCCCAGCAGAGCGTCTCAGG + Intronic
1061563125 9:131419465-131419487 GTTCCCCAGCAGGGCTGCTCTGG - Intronic
1062073231 9:134570360-134570382 ATGCCTCAGCAGAGCATCTGTGG + Intergenic
1203456970 Un_GL000219v1:177211-177233 ATTCCACAGCACTGCTTCTGGGG - Intergenic
1186257664 X:7740167-7740189 ATTCCTCTGCAGAGCTGGTGAGG - Intergenic
1186284971 X:8033363-8033385 ATTCCTCAGCAGGTCCACTCAGG + Intergenic
1186877039 X:13827119-13827141 AATCCTCAGCAGAGCACCCCGGG - Intronic
1186995802 X:15120768-15120790 TGGCCTCAGCAGAGCTTCCCCGG - Intergenic
1187576066 X:20556851-20556873 TTTCCTCTGCTGAGCTTCTATGG + Intergenic
1188723541 X:33551975-33551997 TTAGCACAGCAGAGCTTCTCTGG - Intergenic
1188839681 X:35001047-35001069 ATTCCTCAGGAGGTCTTCTGTGG - Intergenic
1191204537 X:57820384-57820406 ATTCATCTGCAGAGCTACTGGGG + Intergenic
1196093580 X:111774050-111774072 ATTCCTTTTCAGATCTTCTCAGG - Intergenic
1196276308 X:113769375-113769397 CTTCCTCAGCGGAGTTTCTCAGG - Intergenic
1197066201 X:122237098-122237120 ATTCCACAGCTGATGTTCTCTGG - Intergenic
1197717262 X:129718608-129718630 ATTCCTCAGCCAGGCCTCTCAGG - Intergenic
1200819522 Y:7568089-7568111 ATCCGTAATCAGAGCTTCTCAGG + Intergenic