ID: 1165059133

View in Genome Browser
Species Human (GRCh38)
Location 19:33196197-33196219
Sequence CAGCAGCAGCAGAGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1475
Summary {0: 1, 1: 2, 2: 41, 3: 248, 4: 1183}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165059133_1165059149 29 Left 1165059133 19:33196197-33196219 CCCTCCTGCCTCTGCTGCTGCTG 0: 1
1: 2
2: 41
3: 248
4: 1183
Right 1165059149 19:33196249-33196271 CCCTTCAAAGTTGTAGGAGCAGG 0: 1
1: 0
2: 2
3: 19
4: 171
1165059133_1165059140 0 Left 1165059133 19:33196197-33196219 CCCTCCTGCCTCTGCTGCTGCTG 0: 1
1: 2
2: 41
3: 248
4: 1183
Right 1165059140 19:33196220-33196242 GGCGAGCAAAGCCCCTTGGTAGG 0: 1
1: 0
2: 0
3: 2
4: 73
1165059133_1165059143 3 Left 1165059133 19:33196197-33196219 CCCTCCTGCCTCTGCTGCTGCTG 0: 1
1: 2
2: 41
3: 248
4: 1183
Right 1165059143 19:33196223-33196245 GAGCAAAGCCCCTTGGTAGGGGG 0: 1
1: 0
2: 2
3: 20
4: 172
1165059133_1165059147 23 Left 1165059133 19:33196197-33196219 CCCTCCTGCCTCTGCTGCTGCTG 0: 1
1: 2
2: 41
3: 248
4: 1183
Right 1165059147 19:33196243-33196265 GGGAAGCCCTTCAAAGTTGTAGG 0: 1
1: 0
2: 0
3: 7
4: 121
1165059133_1165059142 2 Left 1165059133 19:33196197-33196219 CCCTCCTGCCTCTGCTGCTGCTG 0: 1
1: 2
2: 41
3: 248
4: 1183
Right 1165059142 19:33196222-33196244 CGAGCAAAGCCCCTTGGTAGGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1165059133_1165059139 -4 Left 1165059133 19:33196197-33196219 CCCTCCTGCCTCTGCTGCTGCTG 0: 1
1: 2
2: 41
3: 248
4: 1183
Right 1165059139 19:33196216-33196238 GCTGGGCGAGCAAAGCCCCTTGG 0: 1
1: 0
2: 1
3: 10
4: 126
1165059133_1165059141 1 Left 1165059133 19:33196197-33196219 CCCTCCTGCCTCTGCTGCTGCTG 0: 1
1: 2
2: 41
3: 248
4: 1183
Right 1165059141 19:33196221-33196243 GCGAGCAAAGCCCCTTGGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165059133 Original CRISPR CAGCAGCAGCAGAGGCAGGA GGG (reversed) Intronic
900157514 1:1209142-1209164 AACCAGCTGCAGAGGCAGGAGGG + Intergenic
900289006 1:1915943-1915965 CAGCAGCAGTGGTGGCAGGCAGG + Intronic
900289064 1:1916160-1916182 CAGCAGCTGCAGGGCCAGGCGGG - Intronic
900500898 1:3004043-3004065 CAGCTGCAGCCGAGGCCAGAGGG - Intergenic
900780420 1:4614252-4614274 GAGCAGCAGCAGAGTCAGACTGG + Intergenic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
900895296 1:5479106-5479128 CAGCAGCAGCACAGGCAGGGAGG - Intergenic
901004600 1:6165725-6165747 CAGCAGCAGAAGAGGAGGGCGGG + Intronic
901104859 1:6747228-6747250 CAGCAGCAGGAGATGCAGCGGGG + Intergenic
901739640 1:11333891-11333913 CAGCAGTAGCACTGCCAGGAGGG + Intergenic
901837673 1:11934778-11934800 CAGTAGCAGCAGGGGCCGCATGG - Exonic
901916119 1:12502007-12502029 AAGAAGGAGCAGAGGCTGGAAGG + Intronic
902359772 1:15936005-15936027 GGGCAGGAGCAGGGGCAGGAAGG - Exonic
902582445 1:17416672-17416694 CAGCAGCAGCACAAGCACAAGGG + Intronic
902921080 1:19666226-19666248 GCCCAGCAGCAGGGGCAGGAAGG - Exonic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903585932 1:24415403-24415425 CAGCAGGAGCAAAGCCCGGAAGG + Intronic
903931375 1:26864241-26864263 CAGAGGCAGCAGGGGCAGGAGGG - Exonic
904028860 1:27521544-27521566 CAGCAGCAGCAGGGGCGAGAAGG - Intergenic
904028862 1:27521553-27521575 CATCAGCAGCAGCAGCAGCAGGG - Intergenic
904642018 1:31938178-31938200 CCGCAGCAGCAGCAGCAAGACGG - Exonic
904797857 1:33070958-33070980 CAGCAGCAGCAGCTGGAGAAAGG + Intronic
904832549 1:33314423-33314445 CAGGAGAGGCAGGGGCAGGAGGG - Intronic
905172090 1:36115367-36115389 CGGCAGCAGCGGCAGCAGGAGGG + Intronic
905231379 1:36516659-36516681 TACCACCAGCAGAGGCAGGAAGG - Intergenic
905387112 1:37612792-37612814 CAGCAACAGCAGCAGCAGCAAGG - Exonic
905824073 1:41016137-41016159 CAGCAGCAGCTGCAGCAGCACGG - Exonic
905906042 1:41619111-41619133 CAGGAGCAGAGGAGGCTGGAAGG - Intronic
905970112 1:42135351-42135373 CACCAGCAGCAGAGGAAGAAAGG - Intergenic
906003730 1:42449913-42449935 CAGCTGCAGCAGCGGCAGGTAGG - Exonic
906052714 1:42888035-42888057 CACGAGCAGCAGCAGCAGGAAGG + Intergenic
906114801 1:43349311-43349333 CAGCAGCAGCAGGCCCAGGACGG - Exonic
906114966 1:43350338-43350360 AAGAAGCAGCAGATGAAGGATGG - Intronic
906135814 1:43500095-43500117 CAGCTGCATCACAGGCAGCAGGG - Intergenic
906223613 1:44103264-44103286 CAGCCGCAGGAGGGGCAGGCTGG + Intergenic
906258018 1:44365522-44365544 GAGCAGCAGCAGTGCCAAGAAGG - Intergenic
906296969 1:44654871-44654893 CAGCAGCAACAGGCGCAGCATGG + Exonic
906864737 1:49405543-49405565 GAGCAGCAGCAGTGGCAGCATGG - Intronic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
906967280 1:50470594-50470616 GAGAAGCAGAAGAGGTAGGAAGG - Intronic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
907373590 1:54018268-54018290 AAGCAGAGGCAAAGGCAGGAGGG + Intergenic
907403261 1:54238676-54238698 TGGCAGCAGCACAGGCAGGCGGG + Intronic
907440201 1:54474247-54474269 CAGCATCAGCAAAGGCACAAAGG - Intergenic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
907822803 1:57987725-57987747 GAGCGCCAGCAGAGGCAGGCAGG - Intronic
907916377 1:58873554-58873576 CAGCAGCAGAATAGGGAGGTTGG - Intergenic
908029328 1:59983124-59983146 CAGTGGCAGATGAGGCAGGAGGG + Intergenic
908102699 1:60807863-60807885 TAGCAGCAGCAGCTGCAGGCAGG + Intergenic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
908184562 1:61640317-61640339 CAGCACAAGCAAAGGCACGAGGG + Intergenic
908259046 1:62325521-62325543 CAGCGGTGGCAGAGGCAGAAAGG - Intergenic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
908854110 1:68405321-68405343 CAGCAGCAGCAGCAGCAATACGG + Intergenic
908947427 1:69516524-69516546 CACAAGAACCAGAGGCAGGAGGG - Intergenic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909331582 1:74418940-74418962 CAGCAACAGCAGAAACAAGAAGG - Intronic
909664814 1:78121238-78121260 CAACAGCAGCAAAGGCATGGGGG + Intronic
910514014 1:88037573-88037595 TGGCAGCAGCAGTGGCAGAAGGG - Intergenic
911002406 1:93180177-93180199 CAGCAGCACCGGAGGCAGAGCGG + Exonic
911054423 1:93698121-93698143 AGGCAGCAGCGGAAGCAGGATGG + Intronic
912236416 1:107855992-107856014 CAGAAGCTGCAGAGGCAGCTAGG + Intronic
912683130 1:111741384-111741406 CAGCTGCAGAAAAGGCAGGAGGG - Intronic
912696721 1:111847744-111847766 CAGCAGCTGGAGAGGGAGGATGG + Intronic
912701566 1:111882033-111882055 CAGCAGCTGTAGAGGGAGGCAGG + Intronic
913474331 1:119222649-119222671 AAGCAGCAGCAGATTCAGGGTGG + Intergenic
913966250 1:143379950-143379972 CTGCAACAGCCCAGGCAGGAAGG + Intergenic
914060624 1:144205557-144205579 CTGCAACAGCCCAGGCAGGAAGG + Intergenic
914118526 1:144760812-144760834 CTGCAACAGCCCAGGCAGGAAGG - Intergenic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
914996483 1:152547164-152547186 CAGCTGCAGCACAAGCAGGTGGG - Intronic
915137170 1:153740751-153740773 CAGCAGCAGCAGTGGCTGCAGGG - Intronic
915142359 1:153775505-153775527 CAGCAGGGGCAGCAGCAGGAGGG - Exonic
915468540 1:156112557-156112579 CACCAGAAGCAGAGGCAGGAGGG - Intronic
915471580 1:156128952-156128974 AAGCAGCTGCAGGGGGAGGAGGG - Intronic
915679801 1:157570250-157570272 CAGTAGCAGCAGAGGCCCCATGG + Intergenic
915815774 1:158963162-158963184 CTGCAGCAGCAGTGGCAGAGGGG - Intronic
915837207 1:159187406-159187428 AAGCACCATCAGAGGCAGAAGGG + Intronic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916456104 1:164972443-164972465 AGGCAGCAGCAGAGGCAGAAGGG - Intergenic
916675167 1:167059374-167059396 CAGCTGGAGCAGAGGAAGGTGGG - Intronic
917208240 1:172601162-172601184 CAGCAGGAGCAGAAGCAGACAGG + Intronic
917967519 1:180187810-180187832 CAGTAGCAGCAGAGGCATCGGGG + Intronic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
918758363 1:188367831-188367853 CAGCAAAAGGAGGGGCAGGAAGG - Intergenic
919678382 1:200409588-200409610 CGGCGGCAGCAGCGGCAGGAGGG - Exonic
919787425 1:201268705-201268727 CAGCAGCAGCTGCTGCAGGGAGG + Intergenic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
919919693 1:202160692-202160714 CAGCGGCAGCAGGCACAGGAGGG - Exonic
920149048 1:203888898-203888920 TAGCAGCAGGAAAGGCTGGAGGG + Intergenic
920178225 1:204116662-204116684 CGGCAGCAGCAGGAGCAGGTAGG + Exonic
920185716 1:204158070-204158092 CAGAAGCAGAAGAGGAAGGGTGG - Intronic
920335349 1:205241613-205241635 CAGCAGCATCAGCAGCAGCAGGG + Exonic
920885778 1:209926641-209926663 CAGAAGCAGCACAGGTAGAATGG - Intergenic
920974325 1:210771398-210771420 CAGGAGCTGAAGAGGCAGCAAGG + Intronic
921060249 1:211578958-211578980 CAGCCGGAGCAGGAGCAGGAGGG + Intergenic
921328776 1:214014872-214014894 CATCAGCAGCAGGGGCTGGACGG - Intronic
921330713 1:214033006-214033028 CATCAGCAGCAGGGGAGGGAGGG - Intronic
921363435 1:214351617-214351639 CAGCAGCAGGCGAGGGAAGATGG + Exonic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921812362 1:219529419-219529441 GAGCAGCAGCAGCAGCAGCAGGG + Intergenic
921903132 1:220468814-220468836 CAGCAGCAGCATTTGCAGAAAGG + Intergenic
922027710 1:221767137-221767159 CAGGAGTAGGAGAGGCAGGAGGG - Intergenic
922190141 1:223311407-223311429 CAGCAGCAGCACAGGCTGCCTGG - Intronic
922625636 1:227038740-227038762 CAGCAGCAGGAGATGCAACATGG + Intronic
922677828 1:227563624-227563646 CTGCAGCAGCAGAGTCACCAGGG - Exonic
922794658 1:228334143-228334165 AAGCTGCAGCAGTGGCAGGACGG - Intronic
922904750 1:229165471-229165493 CAGCAGCGGCAGGCACAGGAAGG + Intergenic
923119712 1:230978802-230978824 CAGCAGCAGCAGCAGCCGGCAGG + Exonic
923314726 1:232768858-232768880 CAGTAGGAGCTGAGGCTGGAAGG - Intergenic
923517169 1:234707550-234707572 CAGTAACAGCATAGGAAGGAAGG + Intergenic
923877275 1:238062833-238062855 GAGAAGGAGCAGAGGAAGGATGG - Intergenic
924145728 1:241072773-241072795 CGATAGCACCAGAGGCAGGATGG + Intronic
924331784 1:242946808-242946830 CAGAAGCAGCAGTGGCAGTATGG - Intergenic
924385737 1:243496696-243496718 AAGCAGCAGCAAAGGCTGGCTGG + Intronic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
924581715 1:245329564-245329586 CAGCCACTGCAGAAGCAGGACGG - Intronic
924636670 1:245794668-245794690 CAAAAGCAGCTGAGGCAGGAGGG - Intronic
924706285 1:246505432-246505454 CAGCAGCAGCAGCAGCACCAGGG + Intronic
924812546 1:247416114-247416136 CAGCCCCAGAAGGGGCAGGAAGG - Intergenic
1063108985 10:3018502-3018524 CAGCAGCAACCAAAGCAGGAGGG - Intergenic
1063714456 10:8513640-8513662 CAGCCGCAGGAGGGGCAGGCTGG + Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1064609251 10:17080015-17080037 GAGCAGAAGCTGAGGCAGGAAGG - Intronic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1065589819 10:27252719-27252741 CAGTAGCAGCCGGGGCAGGTGGG - Intergenic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1065830394 10:29609350-29609372 CAGCACCAGCAGAGGGTGGGAGG - Intronic
1065848671 10:29768011-29768033 CAGCAGCCGGCGAGGCTGGAAGG - Intergenic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1065902756 10:30223240-30223262 CAGCAGCTGCCCAGGTAGGAGGG - Intergenic
1066317162 10:34259480-34259502 CAGAAGGGGCAGAGTCAGGAAGG - Intronic
1066419017 10:35247109-35247131 CAGCAGGGGCAGAGGCATGGAGG + Intronic
1066474414 10:35731192-35731214 CAGCAGGAACCCAGGCAGGAGGG - Intergenic
1067084165 10:43229435-43229457 GGGCAGGAGCAGAGGCAGGCTGG + Intronic
1067085486 10:43235840-43235862 CTGCAGCCACACAGGCAGGACGG + Intronic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067828571 10:49597028-49597050 CCACAGCAGCAGGAGCAGGAGGG - Intergenic
1068299186 10:55116737-55116759 AAGAAACAGCAGAAGCAGGAAGG + Intronic
1069362896 10:67663549-67663571 CAGCCGCAGGAGGGGCAGGCTGG + Intronic
1069840687 10:71337540-71337562 AAGCAGCAGCAGAGGCAGCTGGG - Intronic
1069916735 10:71791186-71791208 CAGCAGCAGCAGCTCCAGGATGG - Intronic
1070625303 10:78046882-78046904 CAGCAGCAGCAGTGTCACCAGGG + Intronic
1070627515 10:78061812-78061834 CACCAGCAGCAGAGTATGGATGG - Intergenic
1070815377 10:79319513-79319535 CACCCGTAGCAGCGGCAGGATGG - Intergenic
1071110613 10:82150723-82150745 CAGCAGAAGCAGATGAAAGACGG - Intronic
1071191790 10:83109359-83109381 CAGCAGCAGTGGAGTCAGCATGG - Intergenic
1071358023 10:84817959-84817981 CAGCAGCAGCAGCAGCATGAGGG + Intergenic
1071397456 10:85237969-85237991 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1071572636 10:86706431-86706453 TGGCTGCAGCAGAGGCAGGCTGG - Intronic
1071882106 10:89910894-89910916 CAGCAGCAGCAGTGGCAGCATGG + Intergenic
1072047590 10:91672226-91672248 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1072555922 10:96513638-96513660 CAGCAGCAGCAGTGACACCAGGG + Exonic
1073249641 10:102114023-102114045 CAGCAGGAGTAGAGGCAGCAAGG + Intronic
1073331198 10:102670919-102670941 CACCAGGAGCAGGGGCAGGGAGG - Intergenic
1074411658 10:113234034-113234056 CACCAGGAGCAGAGGCAGCCAGG - Intergenic
1074532207 10:114305495-114305517 CTGCAGGAGGAGATGCAGGAGGG + Intronic
1074814530 10:117134419-117134441 CGGCAGCAGCGCAGGCAGGCCGG + Exonic
1075593858 10:123713075-123713097 CAGTAGCATCTGAGCCAGGAGGG - Intronic
1075635360 10:124026923-124026945 CAGGAGCAGCCTAGGCTGGAGGG + Intronic
1075830654 10:125408112-125408134 CTGCAGCAGCAGTGGCCGCATGG - Intergenic
1075960064 10:126560725-126560747 TAGCAGCAACAGAGACAGCATGG - Intronic
1076016029 10:127028182-127028204 CGGGAGAAGCAGGGGCAGGAAGG + Intronic
1076120412 10:127932579-127932601 CTGCAGCAACAGAGACAGGAGGG + Intronic
1076128847 10:127997360-127997382 CAGCAGCAGCAGAGGGACTTGGG - Intronic
1076186734 10:128456331-128456353 CAGCAGCAGCAGATCCAAGTGGG + Intergenic
1076223650 10:128756108-128756130 CTCCAGCACCAGAGGAAGGAAGG + Intergenic
1076263317 10:129089552-129089574 CAACAGCAGCCAAGGCAGGACGG + Intergenic
1076279057 10:129229959-129229981 GAGCAGCAGGAGAGGCAAGAGGG - Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076677803 10:132156494-132156516 CAGCAGCAGCGAAGGCTGGGTGG - Intronic
1076711653 10:132339065-132339087 CGGCAGCAGCCCATGCAGGAGGG + Intronic
1076758402 10:132587362-132587384 TGGCAGCAGCAGAAGCAGGCTGG - Intronic
1077050936 11:566504-566526 CAGCAGCAGCAGACCAGGGACGG - Intergenic
1077063347 11:627108-627130 GAGCAGCAGCAGCAGCAGGAGGG + Exonic
1077063353 11:627117-627139 CAGCAGCAGGAGGGGCCGGGGGG + Exonic
1077103310 11:831635-831657 CAACAGCAGCAGCAGCAGGTGGG - Exonic
1077121325 11:910310-910332 CAGAGGGAGCAGAGGCAGTAGGG - Intronic
1077200467 11:1304525-1304547 CAGCAGCACCCGCGCCAGGACGG + Intronic
1077214122 11:1388296-1388318 CAGCAGCAGCAGCGGGGGAAAGG + Intergenic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077444775 11:2585836-2585858 CTGGAGCAACAGGGGCAGGAAGG + Intronic
1077608584 11:3628818-3628840 ATGCAGGGGCAGAGGCAGGATGG + Intergenic
1077631982 11:3817153-3817175 CAGGAGCAGCAGAGACAGGCAGG - Intronic
1077730249 11:4722693-4722715 CAGCCGCAGGAGGGGCAGGCTGG + Intronic
1077760851 11:5095582-5095604 CAATAGCAGCAGAGACAGAAAGG - Intergenic
1077774834 11:5259017-5259039 AAGCATCAGCAGAGGCAGTCAGG - Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1077905495 11:6529762-6529784 CAGAAGCAGCAATGTCAGGAGGG - Intronic
1077907627 11:6546386-6546408 CCGCAGCAGCAGGTGCAGGTTGG - Exonic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078191609 11:9095965-9095987 CAGCCGCAGGAGGGGCAGGCTGG - Intronic
1078530167 11:12130956-12130978 CTGGAGGAGCAGAGGCCGGAGGG + Intronic
1078532682 11:12149155-12149177 CAGCATCAGCAAAGGCATGTGGG + Intronic
1078550841 11:12279671-12279693 CAGCAGAGAGAGAGGCAGGAAGG - Intronic
1078707997 11:13763985-13764007 CACCATCAGCAGGGACAGGATGG - Intergenic
1079170710 11:18092639-18092661 AAGTATCAGCAAAGGCAGGAAGG + Intronic
1080394211 11:31875069-31875091 CAGTAGCAGGAGCAGCAGGAGGG - Intronic
1080621160 11:33988260-33988282 CAGCAGCAGCATTGACAAGAGGG - Intergenic
1080682245 11:34487668-34487690 CAGCAGCATCAGCAGAAGGAGGG - Intronic
1081161374 11:39754174-39754196 AAGCAGCAGCAGAGTCTGCACGG - Intergenic
1081634581 11:44712296-44712318 CTGCAGCAGCAGTGGCAGGTTGG + Intergenic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081866926 11:46365292-46365314 CATCAGGAGCAGAGTCAGAAGGG + Intronic
1082176511 11:49066254-49066276 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1082616721 11:55370477-55370499 GAACAGCAGCAGAAGCAAGAGGG + Intergenic
1082828521 11:57598287-57598309 CAGCAGCAGGAGGGTCAGCAGGG - Exonic
1082866190 11:57902051-57902073 CGACAGCTGCAGAGGGAGGAGGG - Intergenic
1082883253 11:58058754-58058776 CAGCAGCTGCAGAAGCAGATCGG - Intronic
1083275866 11:61596675-61596697 CATCAGTAGCAGGGGCAGAAAGG - Intergenic
1083378297 11:62243956-62243978 CAGCTTCTGCAGAGCCAGGAAGG + Intronic
1083605211 11:63974685-63974707 CAGCAGCAGCGGCGTCAGGACGG - Exonic
1083795994 11:65017043-65017065 CAGCAGCAGCAAAAGCCTGATGG + Intronic
1083796879 11:65021967-65021989 CAGCAGTAGCAGCAGCAGGCTGG - Exonic
1083829137 11:65219923-65219945 TGGCAGCAGCAGAGGCAGTGAGG + Intergenic
1083853964 11:65383070-65383092 CAGCAGCATCAGCGGCAGCCTGG + Intronic
1083894223 11:65612097-65612119 CAGCAGTAGGAAATGCAGGAGGG - Intronic
1084103590 11:66966090-66966112 CAGCCCAAGCACAGGCAGGAAGG - Intergenic
1084150420 11:67285593-67285615 CAGCAGGAGCCGAGGCAAGCGGG - Exonic
1084169876 11:67395965-67395987 CAGCAGCTGCAGGCCCAGGAAGG + Exonic
1084175007 11:67418479-67418501 CTCCAGCAGCACAGGCAGAAAGG - Exonic
1084185083 11:67467316-67467338 CCCCAGCAGCAGGAGCAGGAAGG + Exonic
1084264453 11:67997672-67997694 CACCAGCAGCATGGCCAGGAAGG + Exonic
1084288566 11:68147242-68147264 CAGCAGCAGCCCAGCCAGCAAGG - Intergenic
1084321403 11:68375438-68375460 CAGCACGAGCAGGGGCAGGGAGG - Intronic
1084433720 11:69126032-69126054 CAGCAGAGGCACAGGCTGGAGGG - Intergenic
1084453619 11:69254628-69254650 CAGCAGGGGCAAAGGCAGGAGGG + Intergenic
1084564385 11:69920935-69920957 CAGCAGCCACAGGTGCAGGAGGG + Intergenic
1084664578 11:70569532-70569554 CGGCACCAGCAGAGGTAAGATGG - Intronic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1084764967 11:71302241-71302263 CAGCAGCAGCAGTAGGAGCATGG + Intergenic
1084800891 11:71543182-71543204 CAGCAGCTGCAGGTGGAGGAGGG + Intronic
1085032810 11:73283010-73283032 CATAAGCTGCAGAGTCAGGACGG + Intronic
1085120423 11:73964160-73964182 CATCAGGGGCAGAGCCAGGATGG + Intronic
1085242638 11:75071436-75071458 CACCAGCAGAAGGGGGAGGAAGG + Intergenic
1085285413 11:75356844-75356866 CAACAGCTGCAAAGCCAGGAAGG + Intergenic
1085659257 11:78348159-78348181 CAGAAGCAGAAGAGGTAGAAGGG + Intronic
1086221494 11:84450434-84450456 CAGCAGGAGCAAAAGCAAGAAGG + Intronic
1086274751 11:85113143-85113165 CAGCAGCAGCAGAGTACAGAAGG + Intronic
1086332048 11:85763869-85763891 CAGCAGCATCAAAGGATGGAAGG + Intronic
1086689202 11:89769621-89769643 CAGGAGCAGCAGAAGCTGTAAGG + Intergenic
1086716656 11:90070350-90070372 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1086888259 11:92226826-92226848 CTGCAGCAGCCGCGGCGGGAGGG + Intergenic
1086957961 11:92953504-92953526 CAGGAGTGGCAGAGGCAGAAAGG + Intergenic
1087144649 11:94799803-94799825 CAGCAGCAGCAACAGCAGCAGGG + Exonic
1087385087 11:97461168-97461190 CAGCTGCAGCAGAGGAGGTATGG + Intergenic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1087702335 11:101449474-101449496 AAGAAACAGCAGAAGCAGGAAGG + Intergenic
1087946281 11:104164201-104164223 CAGCTGCAGCACAGGCTGCAGGG + Intronic
1088747997 11:112820575-112820597 GAGAAGCAGCAGATGCAGGAAGG + Intergenic
1089209267 11:116789585-116789607 CACCAGCATCAGAGCCAGCAGGG + Exonic
1089529447 11:119116841-119116863 GAGCAGGAGGGGAGGCAGGAAGG - Exonic
1089599141 11:119602818-119602840 CAGCCGCAGGAGGGGCAGGCTGG + Intergenic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1090072968 11:123560364-123560386 TAACAGCAGCAGAGGGAGGTGGG + Intronic
1090346027 11:126071512-126071534 CAACTGAAGCAGAGGAAGGAAGG + Intergenic
1090675211 11:128986053-128986075 CAGCAGCAACAGATGAAGAAAGG - Exonic
1090771002 11:129919871-129919893 TTGCAGCAGAAGAGGCAGGTGGG - Intronic
1090804518 11:130194502-130194524 CAGCAGGTGCACAGCCAGGAAGG - Intronic
1090831663 11:130424862-130424884 CAGCAGGAGCACAGGTGGGATGG + Intronic
1090911315 11:131122010-131122032 CAGAAACAGCAGGGGAAGGATGG + Intergenic
1091035820 11:132232410-132232432 CAGCTGCAGCAGCGACAGGTGGG - Intronic
1091105336 11:132913898-132913920 GAGCTGCAGCAGAGGCAGAGAGG - Intronic
1091111352 11:132971927-132971949 CAGCAGCAGTAGCAGCAGGGTGG - Intronic
1091111353 11:132971930-132971952 CGGCAGCAGCAGTAGCAGCAGGG - Intronic
1091229878 11:133981377-133981399 CAGGAGAGGGAGAGGCAGGAAGG + Intergenic
1091293232 11:134454106-134454128 CAGCAGCAGCAGCAGAAGCAGGG - Intergenic
1091333981 11:134753080-134753102 CAGCAGCAGCAGAGGCCCCACGG + Intergenic
1091594335 12:1865655-1865677 CAGCAGCAGCAGCAGCACCAGGG + Intronic
1091594338 12:1865664-1865686 CAGCAGCACCAGGGGCAGCCGGG + Intronic
1091848201 12:3673939-3673961 CAGAAGCAGCAGAGCGAGGTGGG - Intronic
1092257794 12:6936759-6936781 CAGCAGCAGCAGCAGCATCACGG + Exonic
1092260697 12:6951930-6951952 GTGCAGGAGTAGAGGCAGGAGGG - Intronic
1092418308 12:8308801-8308823 CAGCGGCAGCAGCAGCTGGAGGG + Intergenic
1092884843 12:12915941-12915963 CAGCCGCAGCAGTGGGAGGAGGG - Exonic
1093583033 12:20806156-20806178 CGGCTGCAGAAGAGACAGGAAGG + Intergenic
1095854409 12:46844447-46844469 TAGCATCAGGAGAGGCTGGAGGG + Intergenic
1096466180 12:51848661-51848683 CAGCAGCAGCGGCTCCAGGATGG - Intergenic
1096908235 12:54956264-54956286 TGGCAGCAGAAGAGACAGGAGGG - Intronic
1096979794 12:55721815-55721837 TTGCTGCAGCAGAGGCAGCAGGG - Exonic
1097053468 12:56237183-56237205 CAGCAGCAGCAGCCGCCGAAAGG - Exonic
1097064377 12:56309997-56310019 CAGCAAGAACAGAGACAGGAAGG - Exonic
1097221885 12:57455900-57455922 CAGGAGCAGCAGAGGGAGTGGGG + Intronic
1097544447 12:60981540-60981562 CAGGAGTAGCATATGCAGGAAGG + Intergenic
1097585481 12:61510695-61510717 CAGCAGCAGCAGGAGAAGAATGG + Intergenic
1098205958 12:68109896-68109918 CAGCAGCTGCATGAGCAGGAAGG - Intergenic
1099215190 12:79844794-79844816 GAGCAGAGGAAGAGGCAGGAAGG - Intronic
1099286442 12:80718139-80718161 GAGCAGCAGCAAAGGGAAGAGGG - Intronic
1100052063 12:90460924-90460946 CAGGAGCAAGAGAGGAAGGAGGG + Intergenic
1100195905 12:92244149-92244171 CTGCAGGAACAGTGGCAGGAGGG - Intergenic
1100280502 12:93113794-93113816 GAGAAACAGCAGATGCAGGAAGG - Intergenic
1100390403 12:94141806-94141828 TTACAGCAGCAGAGGCTGGAAGG + Intergenic
1100415543 12:94369884-94369906 AAGCAGCAGCAGCAGCAGCAAGG + Intronic
1100446343 12:94663852-94663874 CAGCACAAGCAGAGGCAGAGAGG - Intergenic
1101223343 12:102663075-102663097 CAGCAGTTGCAAAGGCAGAAAGG - Intergenic
1101406346 12:104432523-104432545 GAGCAGGAGAAAAGGCAGGAGGG - Intergenic
1101640006 12:106581067-106581089 CGGCAGCGGCCGGGGCAGGAAGG + Intronic
1101763318 12:107676959-107676981 CATGAGAAGCAGAGGAAGGATGG - Intergenic
1101865525 12:108517079-108517101 CGGCAGCAGCAGGGCCAGCAGGG - Exonic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102346363 12:112163614-112163636 CAGCAGCTGCAGGGGGATGATGG + Exonic
1102347204 12:112167844-112167866 CAGCAGCAGCAGCGACAGCGAGG + Exonic
1102371652 12:112386861-112386883 CGTCAGCAGCTGGGGCAGGAGGG - Intergenic
1102492425 12:113297330-113297352 CAGGAGCCGCAGTGGCAGGATGG + Exonic
1102933880 12:116881359-116881381 CAGCGGGCGCAGAGGCCGGAGGG - Exonic
1102966935 12:117135151-117135173 ATTCAGGAGCAGAGGCAGGAGGG - Intergenic
1103046964 12:117744152-117744174 TTCAAGCAGCAGAGGCAGGATGG - Intronic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1103308951 12:119989473-119989495 CAGCAGCGGCAGCGGCAACAGGG + Intergenic
1103901937 12:124307879-124307901 CAGAAGCCAGAGAGGCAGGAAGG - Intronic
1104068992 12:125328526-125328548 CAGAAGCTGAAGAGGCAGGAAGG - Intronic
1104209672 12:126676729-126676751 TAGCAGCAGCAGACCCAGTATGG - Intergenic
1104579189 12:129997297-129997319 CAGAGGTAGCAGAGGAAGGAAGG + Intergenic
1104620449 12:130307996-130308018 GAGCAGGAGCAGAGACAGGTCGG + Intergenic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1104866960 12:131961451-131961473 CAGCAGCAGCAGGTGCTGCAGGG + Exonic
1104885509 12:132104819-132104841 CAGCAGCAGCAGGTGCTGCAGGG + Exonic
1105582915 13:21717909-21717931 CTGCCAGAGCAGAGGCAGGAGGG - Intergenic
1105761327 13:23517508-23517530 CACCAGCAGCACAGGCTGGAGGG - Intergenic
1106231744 13:27826058-27826080 CACCAGCAGCAGGGTCACGATGG + Intergenic
1106250162 13:27976917-27976939 CAGCAGCAGCAACAGCAGCAAGG - Intergenic
1106462224 13:29981169-29981191 CTGCAGCTGCAGAGGCTGGATGG - Intergenic
1106670682 13:31901278-31901300 CATCAGAAGCACAGGCAGGTGGG + Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107102568 13:36609908-36609930 CTGCACCAGCAGTGGCAGTATGG - Intergenic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107467923 13:40666233-40666255 CAGCCGCAGGAGAGCCAAGAGGG + Exonic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1107789014 13:43982042-43982064 CTCCAGCAGAAGAGGCAGGCAGG + Intergenic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1108639705 13:52371706-52371728 TAACAGCAGCAGCAGCAGGATGG + Intergenic
1108689916 13:52850849-52850871 CGGCAGCAGCAGCGCCAGGCGGG - Intergenic
1109285108 13:60399347-60399369 CAGAAGCAGCACAGACAGGTGGG - Intronic
1109495633 13:63168154-63168176 CAGCAGCAGCAGCAGCATCAGGG + Intergenic
1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG + Intergenic
1110630146 13:77698077-77698099 CAGCAGCAGCAGGTGCGGGGCGG - Intronic
1110666363 13:78122163-78122185 CTGCCGCAGCAGAGGCAGATGGG - Intergenic
1110705282 13:78596909-78596931 CAGAAGCCGCGGTGGCAGGAAGG + Intergenic
1111063816 13:83063463-83063485 CAGCAGCAGCTGAGACAGGAGGG - Intergenic
1111173984 13:84567952-84567974 CAGCAGCAGCAGAGTTTGAAAGG - Intergenic
1111412629 13:87896238-87896260 CAGTGGGAGCAGAGTCAGGATGG - Intergenic
1112504908 13:99969780-99969802 CAGCAGCAGCTGGAGCAGGAAGG - Intronic
1112555227 13:100461714-100461736 GAGCAGCTGCAAAGGCAGGCAGG - Intronic
1112640839 13:101273239-101273261 CAGCAGCCGCTGAGGAATGAGGG + Intronic
1113616765 13:111685746-111685768 CAGCAGCGGCAGATCTAGGATGG + Intergenic
1113622295 13:111771017-111771039 CAGCAGCGGCAGATCTAGGATGG + Intergenic
1113640811 13:111955482-111955504 CAGGTGCAGCTGGGGCAGGAGGG + Intergenic
1113887494 13:113668487-113668509 CAGGAGGAACTGAGGCAGGACGG + Intronic
1114261896 14:21043021-21043043 CAGCAGCAGAAGCAGCAGAAGGG - Exonic
1114444039 14:22774320-22774342 CAGGTGGAGCAGAGGTAGGATGG + Intronic
1114495236 14:23127415-23127437 CTGGAGCAGGAGAGCCAGGAAGG - Intronic
1114567727 14:23644869-23644891 CATCAGCTGCAGAGGCAAGTGGG + Exonic
1114672130 14:24416965-24416987 CAGGTGCAGCAAAGGCAGGGAGG - Exonic
1114734403 14:25029124-25029146 CAGCAGCAGCAGAGTTTGAAAGG + Intronic
1114976121 14:28102143-28102165 CACCAGCTGCAGAAGCAGGATGG - Intergenic
1115058561 14:29162304-29162326 CAGCAGCAGCACCAGCAGAAGGG - Intergenic
1115270244 14:31543451-31543473 CAGCAGCACCTGACCCAGGAAGG - Intronic
1116484730 14:45433975-45433997 CGGCAGCAGCAGCAGCAGCAGGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1118705818 14:68479352-68479374 AAAAAACAGCAGAGGCAGGAAGG + Intronic
1118764353 14:68899959-68899981 CAGCAGCAGGAGATGTGGGAAGG + Intronic
1118795708 14:69141752-69141774 AAGCCCCAGCAGAGGCAGAAGGG + Intronic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119606029 14:76018198-76018220 CAGCAAAAGCAGAGCCAAGAGGG - Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119618859 14:76116723-76116745 CAGCAGCATCATGGGCAGGCTGG + Intergenic
1119756850 14:77125593-77125615 CACCAGCAGCAGGAGAAGGACGG - Intronic
1119767686 14:77200628-77200650 CAGGGGCAGCAGAGCCAGGATGG - Intronic
1120018074 14:79497192-79497214 CACCAGCAGCATAGGCAACATGG - Intronic
1120181835 14:81351599-81351621 AAGCAGCAGTAGAGGCACAAAGG + Intronic
1120715478 14:87836692-87836714 CAGCTGCAGTAGAGGTACGATGG - Intergenic
1120953004 14:90060330-90060352 CACCAGGAGCAGAGACAGAAGGG - Intergenic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1121865083 14:97355427-97355449 CAGCAGCATCCAAAGCAGGAAGG + Intergenic
1122297121 14:100711960-100711982 GATCAGCCCCAGAGGCAGGAGGG + Intergenic
1122425755 14:101604474-101604496 CGGGAGCAGGAGAGGCAAGAAGG + Intergenic
1122836085 14:104431784-104431806 CTGCAGCTCCAGAAGCAGGAGGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123155058 14:106216825-106216847 CAGCAGAAGCAGAGACACAAAGG - Intergenic
1123206509 14:106718876-106718898 CAGCAGAAGCAGAGACACAAAGG - Intergenic
1123671560 15:22664509-22664531 CAGCAGCCGCAGCGGCGCGAGGG + Intergenic
1123761285 15:23434800-23434822 GAGCATCAGCAGAGGCAGCCTGG + Intergenic
1124075086 15:26436722-26436744 CAGAAGAAGCAGAGCCAGTAAGG - Intergenic
1124077849 15:26462493-26462515 CAGCAACAGCAGTGGCAACACGG - Intergenic
1124140111 15:27069931-27069953 CAGCATGAGCAGAGACAGAATGG - Intronic
1124268009 15:28254728-28254750 GAGCATCAGCAGAGGCAGCCTGG - Intronic
1124277222 15:28336194-28336216 GAGCATCAGCAGAGGCAGCCTGG + Intergenic
1124305479 15:28575412-28575434 GAGCATCAGCAGAGGCAGCCTGG - Intergenic
1124323597 15:28737733-28737755 CAGCAGCCGCAGCGGCGCGAGGG + Intronic
1124420511 15:29517076-29517098 CAGGAGGAGGAGAGGCAGGTTGG + Intronic
1124527481 15:30470929-30470951 CAGCAGCCGCAGCGGCGCGAGGG + Intergenic
1124771172 15:32536754-32536776 CAGCAGCCGCAGCGGCGCGAGGG - Intergenic
1124929124 15:34101789-34101811 TAGCAGCAGCAGCAGCAGGACGG + Exonic
1125434326 15:39629017-39629039 CAGCAGCAGCAGCAGCCAGATGG + Intronic
1125796233 15:42406062-42406084 CAGCAGAAGCTCAGGAAGGAGGG - Intronic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126316189 15:47372528-47372550 CATTTGCAGCAGAGGCAGGAAGG - Intronic
1126356587 15:47802431-47802453 CAGCAGCAGCAGAGTCATCAGGG - Intergenic
1126506138 15:49406543-49406565 CAGCAGCAGCTTTGGCGGGAGGG + Intronic
1126800800 15:52295352-52295374 CAGGCGCAGCGGAGCCAGGAGGG + Intronic
1127165935 15:56244540-56244562 CAGCATGAGCAAAGGCACGAAGG - Intronic
1127671452 15:61198929-61198951 GAGCCTCAGCAAAGGCAGGAAGG - Intronic
1128263332 15:66248129-66248151 CAGAGGCAGAAAAGGCAGGAGGG - Intronic
1128715307 15:69903510-69903532 CAGCAGTAGCAGGGCCAGGAAGG + Intergenic
1128842323 15:70860182-70860204 CAGCCGCAGGAGGGGTAGGATGG - Intronic
1128895036 15:71365328-71365350 CATCAGCAACAGTGACAGGAAGG - Intronic
1129068429 15:72930774-72930796 CAGCAAAAGCAGTGCCAGGAGGG - Intergenic
1129163159 15:73758898-73758920 CAGCAGCCAGAGAGGCAGGAAGG - Intergenic
1129389760 15:75214668-75214690 GTGCAGCAGGAGAGACAGGAGGG - Intergenic
1129466783 15:75728563-75728585 CAGCAGCAGCAAAGCCAGAGCGG - Intergenic
1129538952 15:76335996-76336018 CAGCAGCGGCAGCAGCAGCAAGG + Intergenic
1129705800 15:77793354-77793376 CAACAGAAGCAGGGGCAGCAAGG + Intronic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1130013912 15:80173181-80173203 AAGCAGCCTCAGAGGCAGCAGGG - Intronic
1130312482 15:82767451-82767473 GAGGAGCTGGAGAGGCAGGAAGG + Intronic
1130868195 15:87949930-87949952 CAGAAGAGGCAGAGGAAGGAGGG - Intronic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1132107473 15:99073737-99073759 GAGCTGCAGCAGAGGTAGGGAGG - Intergenic
1132237758 15:100234782-100234804 CATCAGCAGCTGAGCCAGGGTGG + Intronic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1132467214 16:82893-82915 GAGCAAGAGAAGAGGCAGGATGG + Intronic
1132500545 16:282905-282927 CAGGGGCAGCAGGGGCAGCAGGG - Exonic
1132500548 16:282914-282936 CAGGGGCAGCAGGGGCAGCAGGG - Exonic
1132645497 16:997529-997551 CAGCGGCAGGAGCGGCAGGGAGG + Intergenic
1132681309 16:1143190-1143212 TAGCAGCAGCAGTGGCAGTGAGG - Intergenic
1132733568 16:1374888-1374910 AATCAGCAGGAAAGGCAGGAGGG + Intronic
1132827495 16:1912434-1912456 CAGCAGCAGGCGGGGCAGGCCGG - Intronic
1132845723 16:2000003-2000025 CAGCAGCAGTAGCAGCAAGAAGG - Exonic
1132999455 16:2841690-2841712 CCACAGCAGCAGAAGCAGGATGG + Intergenic
1133050752 16:3115959-3115981 CAGAACCAGCAGATGCAGGAAGG - Intronic
1133125010 16:3641097-3641119 CAGCTGCAGCTGTGGCAGGGTGG + Intronic
1133138458 16:3728397-3728419 CAGCAACAGCAGCAGCAGCAAGG - Exonic
1133254942 16:4511039-4511061 AACCAGCATCAGAGGAAGGAAGG + Exonic
1133268705 16:4600172-4600194 CAGCAGCAGCAGAGGTGGCAGGG - Exonic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133303317 16:4795951-4795973 CAGCAGCAGCAGGAGCAGCACGG - Exonic
1133392928 16:5423626-5423648 AGACAGCAGCACAGGCAGGATGG - Intergenic
1134273221 16:12753453-12753475 CAGCAGCAGCAGAGAACAGAAGG + Intronic
1134762321 16:16725155-16725177 AAGCAACAGCAGCAGCAGGATGG + Intergenic
1134983738 16:18634015-18634037 AAGCAACAGCAGCAGCAGGATGG - Intergenic
1135091525 16:19521899-19521921 CAGCAGCACTAGCAGCAGGAAGG + Exonic
1136270556 16:29145967-29145989 CAGACGCTGCAGAAGCAGGAAGG + Intergenic
1136285194 16:29236583-29236605 CAGCAGCGCCAGAGGCAGAAGGG + Intergenic
1136285405 16:29237554-29237576 CAGCAGCCCCAGAAGCTGGAAGG - Intergenic
1136368351 16:29820335-29820357 CAGCTGCAGCAGAAGCAGCCCGG + Exonic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1136511689 16:30741801-30741823 CAGCAGCAGCGGATGGGGGATGG - Intronic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1136777214 16:32878466-32878488 CAGAAGCAGCAGTGGCAGCTTGG - Intergenic
1136893409 16:33983047-33983069 CAGAAGCAGCAGTGGCAGCTTGG + Intergenic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137606923 16:49793224-49793246 CAGCAGGCACAGAGGAAGGAGGG + Intronic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1137673936 16:50294569-50294591 CAGCAGCAGCAGGAGCACGCAGG - Intronic
1137893441 16:52185780-52185802 CAGCAGAAGCAGTGGAAGCATGG - Intergenic
1137957124 16:52842922-52842944 CACCAACAGCAGAAGCAAGAGGG - Intergenic
1138190669 16:55011061-55011083 CAGCTGGAGCAGCTGCAGGATGG + Intergenic
1138420793 16:56897858-56897880 CAGTAGCAGCGGAGGCTGGCAGG - Intronic
1139099189 16:63744640-63744662 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139364779 16:66426901-66426923 CAGCAGCAGGCGGGGCAGGGCGG - Intergenic
1139442736 16:66976987-66977009 CAACAGCAGCAAAGGCCTGAAGG + Intergenic
1139531297 16:67543956-67543978 GGGCAGCAGCAGAGGAAGGAGGG - Intronic
1139734138 16:68972884-68972906 GAGCAGCAGCAGATGCAGAGGGG + Intronic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1140127846 16:72132747-72132769 AAGCAGCAGGAGAGGCTGGCTGG - Exonic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1140511041 16:75508748-75508770 CAGTAGCTGCCCAGGCAGGAGGG - Intergenic
1140622404 16:76751436-76751458 CAGAAGGAGAAGGGGCAGGAGGG + Intergenic
1140792982 16:78410105-78410127 CAAGAGCAACAGAGGAAGGAAGG - Intronic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141506930 16:84483970-84483992 CAGCAGCCCCAGAGGCTTGAGGG + Intronic
1141509011 16:84500676-84500698 CAGCAGCAGAAGAGCCCAGAAGG + Intronic
1141627574 16:85269321-85269343 CAGCAGCATCAGAGGCAGGCTGG + Intergenic
1141915499 16:87093896-87093918 CAGCCGCAGCAGCCGCAGGGAGG + Intronic
1141967040 16:87452671-87452693 CAGAAGCAGCCAAGGGAGGATGG + Intronic
1142074144 16:88107778-88107800 CAGACGCTGCAGAAGCAGGAAGG + Intronic
1142090730 16:88207686-88207708 CAGCAGCCCCAGAAGCTGGAAGG - Intergenic
1142160083 16:88552829-88552851 CAGGAGCTGGAGAGGCAGGAAGG + Intergenic
1142263946 16:89055007-89055029 CAGCAGCTGCAGAGGAAGGTGGG - Intergenic
1142307855 16:89295541-89295563 CAGCAGCACCAGCACCAGGAAGG - Intronic
1142396064 16:89832263-89832285 CAGCGGCAGAACAGGCAGGCTGG - Intronic
1142428466 16:90013073-90013095 CAGCACCCTCAGAGGCAGGTGGG + Intronic
1203079628 16_KI270728v1_random:1140575-1140597 CAGAAGCAGCAGTGGCAGCTTGG - Intergenic
1142564017 17:827825-827847 GGGCAGCAGCAGAGGGAAGAGGG + Intronic
1142799976 17:2338537-2338559 CAACAGCCACAGAGGCAGGCAGG - Intronic
1142808980 17:2386533-2386555 CAGCAGCAGCACACGAAGGCGGG + Exonic
1142847551 17:2689634-2689656 GAGCAGCAGCACGGGCAGGGTGG + Exonic
1142879519 17:2873510-2873532 AAGCAGCAGCAGCTGCAGAAAGG + Intronic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1143100607 17:4502748-4502770 CAGCTTGAGCAGAGGCATGAAGG - Intronic
1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG + Intergenic
1143433918 17:6908700-6908722 CAGCAACAGCAGTGGCACCATGG + Intronic
1143490808 17:7284290-7284312 CAGCAGGACCAGCTGCAGGAGGG - Exonic
1143670478 17:8392817-8392839 CAGCAGCACCCAGGGCAGGATGG + Exonic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143852263 17:9821876-9821898 CAACAGCAGCAATGGCAGGATGG - Exonic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1143964522 17:10747482-10747504 AAGCAGCAGCAGAGGGAGCGAGG - Intergenic
1144457622 17:15432075-15432097 CTGGACCAGCAGAGGTAGGATGG - Intergenic
1144562202 17:16330038-16330060 CAGAAGGAGCAAAAGCAGGAAGG + Intronic
1144675284 17:17158035-17158057 CCACAGCCTCAGAGGCAGGACGG - Intronic
1144755449 17:17677761-17677783 CCTCATGAGCAGAGGCAGGAAGG + Intergenic
1145056013 17:19704412-19704434 CAGAAGCAGCACAGGCAGGCGGG + Intronic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1145910657 17:28540284-28540306 CCGCCCCAGCAGAGGCTGGAAGG + Intronic
1145991125 17:29080102-29080124 CATCAGCAGCAGAGGCGGAGCGG + Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1146528179 17:33584746-33584768 CACAAGCAGCCTAGGCAGGAGGG - Intronic
1146946706 17:36878263-36878285 CAGCAGCCGTGGAGACAGGATGG - Intergenic
1147042233 17:37727843-37727865 CATCAGCACCTGAGCCAGGAGGG - Intronic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147326807 17:39673593-39673615 GAGCAGCAGGAGAGCCCGGAAGG + Exonic
1147375379 17:40019752-40019774 CACCAGCAGGAGAGCCGGGAAGG + Intronic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1147915297 17:43882110-43882132 CAGCAGCGGCAGAGGCCTGTCGG + Intronic
1148021692 17:44557711-44557733 CAGCAGCGGCAGCAGCAGGCGGG - Exonic
1148555305 17:48575593-48575615 AAGCAGCCCCAGAGGTAGGAAGG + Exonic
1148795675 17:50195578-50195600 CAGCACCAGCAGGGCCAGGGGGG + Exonic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149239052 17:54627120-54627142 CAGCAGCCGCAGAGTGAGGGTGG - Intergenic
1149298640 17:55284384-55284406 CAGCAGTAGCAGAGGAAGTCAGG - Intronic
1149450787 17:56748409-56748431 CAGCAGGAGGGAAGGCAGGAAGG - Intergenic
1149533935 17:57417401-57417423 CATCAGCTGCAGAGCAAGGAGGG + Intronic
1149601968 17:57898990-57899012 CAGCAGGAGCACAGGCAGAGTGG + Intronic
1149626759 17:58084928-58084950 CAACAGCAGCACAGGGAGAAAGG - Intronic
1149634694 17:58157219-58157241 CAGCAGCAGTAGCCGCAGGGTGG - Intergenic
1149896070 17:60429454-60429476 CAGCAACATCAGCGGCATGAAGG + Exonic
1150318310 17:64188335-64188357 CAGCAGCAGCAAAGGCAGTGTGG - Exonic
1150407949 17:64919109-64919131 CGGCAGCAGCCGGGGCAGGTGGG - Intronic
1150576339 17:66434025-66434047 CAGGAGCAGCAGAGCCAGGATGG + Intronic
1150747273 17:67825856-67825878 CGGCAGCAGCCGGGGCAGGTGGG + Exonic
1150887260 17:69101616-69101638 CAGCAGCAGCAAAGGAATGCTGG + Intronic
1151285753 17:73109842-73109864 CAGCAGCAGCAGCGACAGAAAGG + Intergenic
1151441467 17:74132078-74132100 GAGGAGCAGCAGAAGCGGGAAGG - Intergenic
1151568877 17:74916179-74916201 CAGCACCAGAAGAACCAGGAGGG + Exonic
1151696692 17:75721584-75721606 CAGCAGCAGCCGAGGCTGGCCGG + Exonic
1151829839 17:76543071-76543093 GAGCTGCAGCAGCGGCAAGAGGG + Exonic
1151960229 17:77401966-77401988 AAGGAGCAGCAGAGGAAGGCAGG - Intronic
1152068639 17:78124614-78124636 CACCAGCAGCAGCAGCAGGAGGG + Exonic
1152147030 17:78574593-78574615 CAGCAGCTGCAGAGCCGGGGAGG - Intronic
1152233028 17:79124525-79124547 CAGCAGCAGCAAGGGCTGGAAGG + Intronic
1152321109 17:79609396-79609418 CACCACCAGCTGGGGCAGGAAGG + Intergenic
1152437176 17:80283556-80283578 CAGCAGCAGCACACGGAGGTTGG - Intronic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1152651377 17:81495056-81495078 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1152667949 17:81582199-81582221 CTGCAGCAGCACAACCAGGAGGG + Intronic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1152671844 17:81612937-81612959 CAGCTGCAGGGGAGGGAGGAGGG - Intronic
1152698804 17:81809044-81809066 CAGCAGCAGCAACAGCAGCAGGG - Exonic
1152772555 17:82179241-82179263 CAGGAAAAGCAGAGGCACGATGG + Intronic
1152876640 17:82790206-82790228 CAGCCACAGGAGAGGCGGGAGGG - Intronic
1153013792 18:565276-565298 CAGCAGCAGCAGCAGTGGGATGG - Intergenic
1153342410 18:3989027-3989049 GTGCAGCAGTGGAGGCAGGAGGG - Intronic
1154010854 18:10572558-10572580 CAGCCACAGCAGGGGCAGTAAGG + Intergenic
1154269379 18:12906285-12906307 AGGCAGCTGCAGAGACAGGAAGG - Intronic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155043577 18:22085095-22085117 GGGCAGAAGCAAAGGCAGGAGGG + Intergenic
1155231853 18:23781816-23781838 TAGAAGCAGCAGATGTAGGAAGG - Intronic
1155399198 18:25419704-25419726 CAGAAGCAGCAGGGGCAGGATGG - Intergenic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1155708603 18:28847529-28847551 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
1155844980 18:30695021-30695043 CAGCAACAACAGTGGCAGTATGG + Intergenic
1156160295 18:34350944-34350966 CAGGAGGGGCAGAGGCAGCAGGG - Intergenic
1156270017 18:35522033-35522055 CAGCTGCTGGAGTGGCAGGAAGG + Intergenic
1157469129 18:47974670-47974692 CAGCAACAGCAGAAGCAAGAAGG + Intergenic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1157740963 18:50092431-50092453 ACGCAGCAGCAGCAGCAGGATGG - Intronic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158434380 18:57425295-57425317 CAGCAGCAGCAGAGACAAGTGGG + Intergenic
1158907329 18:62026689-62026711 TAGCAGAGGCAGAGTCAGGAAGG - Intergenic
1159059267 18:63497417-63497439 CCGCAGCAGCAGGGACAGGCAGG - Intronic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159914494 18:74176508-74176530 CTGAAGCTGCAGAGGCGGGAGGG - Intergenic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1159959551 18:74545034-74545056 CAGAAGCTGGAGGGGCAGGAAGG + Intronic
1159961105 18:74556345-74556367 CAGCAGCAGCACAGCCAGCAGGG - Exonic
1159995801 18:74962677-74962699 CAGCACCAGGAGAGGGAAGAGGG - Intronic
1160047380 18:75399719-75399741 CAGCAGCAGCAGCAGCAAAAGGG - Intergenic
1160050748 18:75431104-75431126 CAGCTGCCACAGAGGCAGGGTGG - Intergenic
1160073900 18:75653636-75653658 CAGCACCTGCAGAGCCAGGCAGG + Intergenic
1160149569 18:76388834-76388856 CAGCAACAGCCGGGGAAGGAAGG + Intronic
1160374756 18:78403179-78403201 GAGCAGCTGCAGAGTCAGGCAGG - Intergenic
1160377369 18:78423185-78423207 CAGCAGCAGCAATAGCAGGGGGG - Intergenic
1160512602 18:79460981-79461003 CAGCAGATGCAGGGCCAGGACGG + Intronic
1160689497 19:454877-454899 CAGCACTGGGAGAGGCAGGACGG - Intronic
1160865099 19:1252850-1252872 CAGCAGCAGCAGTGGCGTGGGGG + Intronic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161062089 19:2220245-2220267 CAGCAGCAGCAGAGTCCTGAGGG - Intronic
1161139973 19:2641434-2641456 CCTCAGGAGAAGAGGCAGGAGGG + Intronic
1161243935 19:3238526-3238548 CAGAAGCTGAAGAGGCAGGAAGG - Intronic
1161316410 19:3619568-3619590 GAGCTGAAGCAGAGGCAGGCTGG + Intronic
1161407659 19:4099412-4099434 CGGCTGCAGCAGAGCCAGGGAGG + Exonic
1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG + Exonic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161746105 19:6061131-6061153 TAGCAGCAGGAGCGGAAGGAAGG - Intronic
1162316938 19:9945158-9945180 CAGCAGAAAAAGAGGAAGGAAGG + Intergenic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1162933474 19:13968766-13968788 TCGCAGAAGCAGAGGTAGGAAGG - Exonic
1163235330 19:16026326-16026348 CGGCTGCAGCAGTGGCTGGAAGG - Intergenic
1163265249 19:16217006-16217028 CAGCAGCAGTAGTGGCAGTATGG + Intronic
1163350755 19:16775371-16775393 AAGCAAAAGCAGAGGCAAGAGGG + Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163612769 19:18309704-18309726 CAGCAGCAGAAGCAGCAGAAAGG - Exonic
1164539965 19:29115065-29115087 AAGAAGCAGGAGAGGAAGGAAGG - Intergenic
1164540769 19:29120044-29120066 CAGCAGGACCAGAGGCATGGAGG + Intergenic
1164801971 19:31084643-31084665 GAGAAACACCAGAGGCAGGAAGG - Intergenic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165062220 19:33210503-33210525 CAGCAGCAGCAGGCCCAGGATGG + Exonic
1165314290 19:35045303-35045325 CAGCAGCCTCAGAGGCGGGAAGG + Intronic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1165896697 19:39145736-39145758 GATCAGCAGCTGGGGCAGGAGGG + Intronic
1166105737 19:40597266-40597288 CAGCAACAGCACCAGCAGGAGGG - Exonic
1166326053 19:42051835-42051857 AGGCAGCAGGAGCGGCAGGAGGG - Intronic
1166344182 19:42155117-42155139 CAGCTGCAGCTGAGGCAGGTGGG - Intronic
1166385114 19:42376426-42376448 CAGCAGCAGGGGTGCCAGGAAGG - Exonic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1166880620 19:45927801-45927823 CAGCCGCTGCAGTCGCAGGAAGG - Intergenic
1167089550 19:47334113-47334135 CAGCGGCACCCGAGGCTGGAAGG + Intronic
1167143368 19:47667446-47667468 CAGCAGAATTAGAGACAGGAGGG - Intronic
1167285900 19:48598901-48598923 CTGCAGTAGCAGAGGCAGTGAGG + Intronic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167468395 19:49662334-49662356 CAGCGGCAGCAGCGGCATGAAGG + Intronic
1167577771 19:50325944-50325966 GCGCAGCTGCAGAGGCTGGACGG + Intronic
1167591575 19:50407035-50407057 CAGCAGCCGCAGTGGCAGGTAGG - Exonic
1167632256 19:50632426-50632448 CAGCAGCAGCAGTGGCCGCTGGG - Exonic
1167774677 19:51547092-51547114 TAGCAGCAGAAAAAGCAGGAAGG - Intergenic
1168104316 19:54157206-54157228 CAGTAACAGCAGGGGAAGGAGGG + Intronic
1168308126 19:55447110-55447132 CAGCACGTGCACAGGCAGGAAGG - Intergenic
1168400792 19:56085220-56085242 CAGCAGCAGCCGAGGAATGATGG + Intergenic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1168712892 19:58511911-58511933 GAGCAGCAGCAGCAGCAGCAAGG + Exonic
1202700031 1_KI270712v1_random:157445-157467 CTGCAACAGCCCAGGCAGGAAGG + Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925265084 2:2561441-2561463 CAGAAGCTGGAGAGGCAGAAAGG + Intergenic
925274763 2:2640986-2641008 GAGCAGAAGCAGAGGCAGAAGGG + Intergenic
925330497 2:3054785-3054807 CAGCAGCATCAGATGCATGTCGG + Intergenic
925695127 2:6568415-6568437 GGACAGCAGCAGAGGCAGGGAGG - Intergenic
925796851 2:7554868-7554890 CAGCTGAAGCACAGGCAGCATGG + Intergenic
925882410 2:8363806-8363828 CCTCATCAGCAGAGACAGGAAGG - Intergenic
925913589 2:8588644-8588666 GAGCAGCAGCATGGTCAGGATGG - Intergenic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926174322 2:10575768-10575790 CAGGAGCAGCACAGCCTGGAAGG - Intronic
926212196 2:10879296-10879318 CAGCAGCTGGAGGAGCAGGAAGG - Intergenic
926221810 2:10941349-10941371 CAGCAGCAGGAGAGACGGGCAGG + Intergenic
926230970 2:11003544-11003566 CAGAACCTGGAGAGGCAGGAAGG + Intergenic
926231583 2:11008234-11008256 GAGCTGCAGCAGAAGGAGGAAGG - Intergenic
926309218 2:11662329-11662351 CAGCAGAAGGAGCGGCAGAAGGG + Intronic
926326416 2:11788160-11788182 CAGCAGCAGCCGTGCCAGCAGGG - Intronic
926451163 2:13005935-13005957 GAGGAGGAACAGAGGCAGGAAGG - Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926590524 2:14735415-14735437 AAGCATCAGCAGAGCCAGAATGG - Intergenic
926756356 2:16239570-16239592 CAGCAGCAGCAGCAGAATGAAGG + Intergenic
926994087 2:18715099-18715121 CAGCAGCAACAGAGCCTGGAGGG - Intergenic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
927240361 2:20915465-20915487 CCCCAGCAGCAGAGGAAAGATGG - Intergenic
927339830 2:21970585-21970607 CAGAAGCAGCAGAAAAAGGATGG + Intergenic
927400342 2:22703697-22703719 CAGCAGCAGCAGTGGCAGTGGGG - Intergenic
927430321 2:23021763-23021785 CAGCTCTGGCAGAGGCAGGACGG + Intergenic
927486214 2:23490011-23490033 CAACATCAGCTGAGGCAGGCGGG - Intronic
927570989 2:24159891-24159913 CAGCAGCCACAGAGAAAGGACGG - Intronic
927937122 2:27082375-27082397 CAGCAGCAGTGGGGGCAGCAGGG + Exonic
928067014 2:28175201-28175223 CAGTAGCAGCAGGTGCAGGTAGG - Intronic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928512078 2:32011036-32011058 TAGCGGCAGCAGAGGCTGGGAGG + Intronic
928620882 2:33086446-33086468 TAGCAGCAGCAGGCCCAGGAGGG + Intronic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
928697058 2:33859985-33860007 CAGCCGCAGGAGGGGAAGGAAGG - Intergenic
928865616 2:35914307-35914329 CAGCAGCAGCAGTAGCAAGAGGG - Intergenic
929261732 2:39873439-39873461 GAGCAGCAGCAGCGGCAGCAAGG - Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929832280 2:45356752-45356774 CAGCAGTAGCCCAGGCAGGTGGG - Intergenic
929979171 2:46662938-46662960 CAGCCTCAGGAGAGCCAGGATGG + Intergenic
930092583 2:47541987-47542009 CAGCAGCAGCAGCGGCAGCAGGG + Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
930769791 2:55119920-55119942 CACCAGCCTCAGATGCAGGAGGG + Intergenic
931426794 2:62178756-62178778 CAGCAGCAGGAGAGTAAGGGAGG + Intergenic
931656704 2:64516003-64516025 GAGCAGCAGCAGACCCTGGAGGG + Intergenic
931881394 2:66574868-66574890 CAGCCGCAGCAGCAGCAGCAGGG + Intergenic
931889971 2:66661351-66661373 CAGCAGCTGCAGTGGCAGTGAGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932187778 2:69713715-69713737 CAGCAGAAGCAATGGAAGGATGG - Intronic
932463206 2:71896682-71896704 CCCCAGCAGCAGGGACAGGATGG + Intergenic
932592423 2:73075375-73075397 CAGCCCCAGTTGAGGCAGGAGGG + Exonic
933244245 2:79957388-79957410 CACCAGCAGGAGATGGAGGAGGG + Intronic
933250553 2:80024453-80024475 CAGCATGAGCAAAGGCATGAAGG + Intronic
933284169 2:80366671-80366693 CAACAGCAGCGGAGGAAGAAGGG - Intronic
933336321 2:80964195-80964217 TAGCAGCAGCAGCAGCAGCATGG + Intergenic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
934087316 2:88520678-88520700 CTGCTGCAGCAGAGCCAGGAGGG - Intergenic
934170963 2:89540920-89540942 CTGCAACAGCCCAGGCAGGAAGG + Intergenic
934281268 2:91615238-91615260 CTGCAACAGCCCAGGCAGGAAGG + Intergenic
934473477 2:94576891-94576913 CAGGAGCATCAGAGAGAGGAGGG + Intergenic
934616094 2:95772192-95772214 GAAGAGAAGCAGAGGCAGGAGGG - Intergenic
934644802 2:96052368-96052390 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934681215 2:96285234-96285256 CTGCAGCAGCATTCGCAGGATGG + Exonic
934758705 2:96841744-96841766 CAGAAGCCGGAGAGGCATGAAGG + Intronic
934838213 2:97608457-97608479 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934893727 2:98093129-98093151 CAGCAGCTGCAGAGGCAAGAGGG + Exonic
935108874 2:100073386-100073408 CAGAAGCTGGAGAGGCATGAAGG + Intronic
935207103 2:100905681-100905703 AAGCAGTGGCAGAGGCAGAAAGG - Intronic
935848116 2:107188213-107188235 CAGCAGCAGCAGTAACAGCACGG - Intergenic
936380923 2:111985265-111985287 CAGCAGCAGGAAAGGCAGCTGGG + Intronic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
936657520 2:114505513-114505535 GAGGAACAGCAGATGCAGGAAGG - Intronic
937022525 2:118671364-118671386 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
937027358 2:118710753-118710775 CAGCAGCAGCAGGGGGTGGCAGG - Intergenic
938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG + Intergenic
938259881 2:129887989-129888011 CATCAGCAGTAGAAGCAGGCAGG + Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
938581654 2:132651970-132651992 CAGCAGCAACATGGGCAGGAAGG + Intronic
938982952 2:136543977-136543999 CAGCAGTAACAGTGGCAGGCAGG + Intergenic
939199587 2:139017882-139017904 CAGCAGTGGCAGTGGCAGCATGG + Intergenic
939560037 2:143721141-143721163 CAGCAGCAGCAGTGGCACCTGGG - Intronic
939960632 2:148562060-148562082 AACCAGCAGCAAAGGCAGCATGG - Intergenic
940337751 2:152546596-152546618 CAGCAGAAGCAAAGGCTGCAGGG + Intronic
940794592 2:158063538-158063560 CAGCAGTGGCAGAGGCTGCAGGG - Intronic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
941638273 2:167960078-167960100 CAACAGCAGCAGATGCAGGAAGG + Intronic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
942303681 2:174586173-174586195 GAGCAGCAGCTGAGGCGGGGTGG + Intronic
943685474 2:190813226-190813248 CAACAGCAGGAGAGTGAGGATGG + Intergenic
943972974 2:194434506-194434528 CAGCAGCAACAGAGTCAGTTGGG + Intergenic
944471301 2:200055930-200055952 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
944655538 2:201873520-201873542 CAGCTGCAGCAGCAGCAGCATGG - Intronic
944743660 2:202635320-202635342 CAGCAGCAGCAGCAGCAACATGG + Exonic
944991987 2:205248423-205248445 CAGCAGCAGCAGAGGGTTAAGGG + Intronic
945137061 2:206640872-206640894 CAGTACAAGCAAAGGCAGGAAGG - Intergenic
945400625 2:209378015-209378037 CAGCAGCAGAAGTGGTAGGCAGG + Intergenic
945500877 2:210573357-210573379 CACCAGCAACAGAGGATGGATGG - Exonic
945521492 2:210833095-210833117 CAGTTGCAGCAGAAGCAGGTAGG + Intergenic
945668355 2:212770439-212770461 CAGAAGCAAGAGAGGCAGGGTGG - Intergenic
945910379 2:215642357-215642379 CAGCAGCAGCAAAGGCCATACGG - Intergenic
946229420 2:218282363-218282385 AAGCAGGCGCAAAGGCAGGAGGG - Intronic
946536968 2:220641193-220641215 CAGAAACAGCAGAAGCAAGAAGG + Intergenic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947043354 2:225949462-225949484 CAGCAGCAGCAGCCGTAGGTTGG - Intergenic
947399054 2:229714358-229714380 CAGCAGCAGCAGGGCCAGCGCGG + Exonic
947636634 2:231683643-231683665 CTGCAGCAGGAAGGGCAGGAGGG + Intergenic
947722584 2:232378813-232378835 CAGCAGCAGCAGCAGCATGCAGG - Exonic
947790894 2:232868436-232868458 AAGCGGCAGCAGAGGCCGGGTGG - Intronic
948350165 2:237333792-237333814 CAGCAGCAGAAGAGGCTGTCTGG - Intronic
948386123 2:237582107-237582129 AGGCAGGAGCAGAGGCAGAACGG - Intronic
948599160 2:239098386-239098408 CAGGAGCAGCAGCGAGAGGATGG - Intronic
948624041 2:239256682-239256704 CAGCAGCAGAAGGGACTGGATGG + Intronic
948835116 2:240622690-240622712 AAGCAGGAGGAGGGGCAGGAAGG + Intronic
948939080 2:241187339-241187361 CAGCACCAGCAGAGCCTGGGCGG - Intergenic
949037148 2:241821127-241821149 CAGCTGGGGCAGTGGCAGGAGGG - Intergenic
1168771890 20:420871-420893 CGGAAGCAGCAGCAGCAGGAGGG + Exonic
1168936582 20:1670988-1671010 CACCTGCAGCACAGCCAGGATGG - Intergenic
1168943921 20:1735883-1735905 CCGCAGCAGGAGAGGGAGGGAGG - Intergenic
1169112378 20:3042628-3042650 CTTCAGCAGCCAAGGCAGGATGG - Intergenic
1169393066 20:5205882-5205904 CAGCAAAGGCAGAGGCAGGGCGG + Intergenic
1170451546 20:16489099-16489121 CAGCATCACCCTAGGCAGGAGGG + Intronic
1170545592 20:17433505-17433527 CAACAGGAGCAGAGGCAGAGAGG + Intronic
1170606439 20:17878360-17878382 CAGCAGCCGTGGAGGCAGGCGGG + Intergenic
1170735244 20:19008648-19008670 CAGCAGCAAGAGAGCCAGGGAGG - Intergenic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171150444 20:22822525-22822547 CAGCAGAAACACAGGCAGGTGGG + Intergenic
1171188557 20:23141705-23141727 GAGCAGCAGCAGGTGCAGGCAGG + Intergenic
1171229502 20:23472122-23472144 CAGCAGCTGCAAAAGCAGAAGGG + Intergenic
1171419866 20:25010851-25010873 CAGCAGCACCAGAGGCTTGCTGG + Intronic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172013800 20:31861466-31861488 CAGCAGCGGCAGCGGCCGGTGGG + Exonic
1172070270 20:32251649-32251671 CTTCAGCAGCAGAGACAGGGAGG + Intergenic
1172105936 20:32517354-32517376 CAGCAGCTGGAGAGGGAGAAGGG + Intronic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172167037 20:32905874-32905896 CAACAGCAGAAGCAGCAGGAGGG - Intronic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172266819 20:33623116-33623138 CCGCTGCAGCAGGGGCAGGTTGG - Exonic
1172654795 20:36530076-36530098 CTGCCACAGCAGAAGCAGGAAGG - Intergenic
1172937318 20:38629496-38629518 CCGCAGCAGCAGAGCCTGGGGGG + Exonic
1173501857 20:43559675-43559697 CAGCAGCAGGAGAGGGTGCATGG + Intronic
1173541337 20:43854034-43854056 CAGCAGCCGCAGATGCAGGACGG - Intergenic
1174033174 20:47647337-47647359 CAGCTTCAGCAGAGGCTGCAGGG + Exonic
1174427539 20:50443230-50443252 CAGCTGCAACAGAGACAGTACGG - Intergenic
1174533598 20:51233835-51233857 CAGCAAGAGCAGAGGCCTGAGGG - Intergenic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175269445 20:57723534-57723556 CAGGAGCTGCAGAGGCAGGTGGG + Intergenic
1175546291 20:59780162-59780184 GAGCAGCAGCACAGGCAGCTGGG - Intronic
1175692965 20:61079285-61079307 CAGCGGCAGGAGGGTCAGGAGGG - Intergenic
1175709319 20:61206450-61206472 CAGCAGAAGAACAGGAAGGAAGG + Intergenic
1175857124 20:62127598-62127620 AAGCAGCGGCTGAGGCTGGAGGG - Intronic
1175866765 20:62182887-62182909 AAGCAGGAGCAACGGCAGGAGGG - Intergenic
1175984904 20:62759791-62759813 CAGCAGCAGCCCAGGCTGGGCGG + Intronic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176057323 20:63155593-63155615 CAGCAGGAGCAGGCTCAGGACGG + Intergenic
1176237506 20:64060544-64060566 CAGCCTCATCAGAGGCACGAGGG - Intronic
1176241151 20:64076543-64076565 CAGCACCAGCACAGGCAGCAGGG + Exonic
1177204374 21:17994682-17994704 CAGCAGTGGCAGTGGCAGGTGGG + Intronic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1177913828 21:27062944-27062966 CAGCTGCAGCATAAGCAGGTGGG - Intergenic
1178135264 21:29619774-29619796 AAGCAGCAACAGAAGCAGCATGG + Intronic
1178627053 21:34227140-34227162 GAGCAGCATCGGAGGCAGGAGGG + Intergenic
1178809610 21:35869350-35869372 CAGAACCTGCAGAGGCAGTAGGG - Intronic
1178914604 21:36699430-36699452 CCGAGGCAGGAGAGGCAGGAGGG + Exonic
1179008497 21:37534780-37534802 CTGCATCAGCAAAGGTAGGAAGG + Intergenic
1179174914 21:39001181-39001203 CAGCAGCAGCAGAGATGGGGTGG - Intergenic
1179238548 21:39568387-39568409 AAGCAGCTGGAGAGGCAGGAGGG - Intronic
1179299117 21:40090603-40090625 GAGAGGCAGCAGAGCCAGGAGGG - Intronic
1179317799 21:40260375-40260397 CAGCTGTGGCTGAGGCAGGAAGG - Intronic
1179433403 21:41341949-41341971 CATCAGCAGAACATGCAGGAGGG - Intronic
1179637757 21:42724303-42724325 CAGCAATAGCAGAGGCAGGCAGG + Intronic
1179725460 21:43339187-43339209 CAGCTGCAGAGGCGGCAGGAAGG - Intergenic
1180010770 21:45049852-45049874 CAGCTGCAGCAGAGCCTGGATGG - Intergenic
1180018158 21:45101011-45101033 CAGCAGCAGCAGCGCCAGTGCGG + Intronic
1180030910 21:45206960-45206982 CAGCAGCAGCAGAGAGAGCCTGG + Intronic
1180035875 21:45248940-45248962 CAGCAGGAGAGGGGGCAGGAGGG + Intergenic
1180054014 21:45347867-45347889 CTGCAGCAGCACAGGCTGGAGGG + Intergenic
1180054177 21:45348721-45348743 CTGCAGCAGCACAGGCTAGAGGG + Intergenic
1180135432 21:45859239-45859261 CAGGAACAGCTGAGCCAGGAGGG + Intronic
1180740853 22:18052400-18052422 CAGCAGCAGCAGAGGCACCGGGG + Intergenic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1181171927 22:21014832-21014854 CAGCAGCAGCAGGGCGGGGAGGG - Intronic
1181304864 22:21909997-21910019 CAGCATCAACAAAGGCAGGATGG - Intergenic
1181474806 22:23161541-23161563 TAGCAGCAGCCCAGGCTGGAGGG - Exonic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181572022 22:23772911-23772933 CAGCAGCATCGGGGGCAGGAGGG - Exonic
1181630508 22:24148741-24148763 CTGTTCCAGCAGAGGCAGGAAGG + Intronic
1181757614 22:25035676-25035698 CAGCAGCAGCAAGGGCAAAAAGG + Intronic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1182045506 22:27270992-27271014 CAGCAGCGGGGGAGGCAGGCAGG - Intergenic
1182070922 22:27463058-27463080 CAGCAGAGGCTGAGGCAGGGAGG + Intergenic
1182076591 22:27499361-27499383 CAGCAGCAGCTCAAACAGGACGG + Intergenic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182372287 22:29819720-29819742 CAGCAGCAGGAGACGGGGGAGGG - Intronic
1182445116 22:30385496-30385518 CAGCAGCAGCAGTGGCAACGGGG + Intronic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
1182944677 22:34310769-34310791 CAGCAGCTGCAGGGGCAAGTTGG - Intergenic
1183063219 22:35347858-35347880 CAGAAGGAACAGAGGAAGGATGG - Exonic
1183111770 22:35654825-35654847 AAGAAGCAGCAGATGCAGGAAGG + Intronic
1183301657 22:37061817-37061839 CATCAGCACCAGAGCCAGGCTGG + Intronic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183338053 22:37262215-37262237 CAGCAGCAGCAGATGGTGGTGGG + Intergenic
1183454386 22:37913833-37913855 GACCGACAGCAGAGGCAGGAGGG - Intronic
1183489980 22:38110981-38111003 CAGCAGCAGCAGCCCCTGGAGGG + Intergenic
1183585852 22:38752550-38752572 CAGCAGCAGCGGAGGGAGCTCGG - Exonic
1183704967 22:39470576-39470598 TGGCTGCTGCAGAGGCAGGAGGG + Intronic
1183718909 22:39550776-39550798 AAGCAGCAGGAGTGGCAGAAAGG + Intergenic
1183816016 22:40301186-40301208 CAGCAGCAGCAGAGGCAGCCAGG + Exonic
1184039694 22:41935503-41935525 CAGTAGCAGCAGAGCCCGGAAGG - Intergenic
1184089168 22:42283469-42283491 CGGCAGCAGCAGGGGCGTGAAGG - Intronic
1184107507 22:42376750-42376772 TAGAGGCAGCTGAGGCAGGAGGG + Intergenic
1184126659 22:42492103-42492125 CAGGAGGACAAGAGGCAGGACGG - Intergenic
1184356103 22:43980527-43980549 CAAGAGCAGTAGTGGCAGGAGGG + Intronic
1184378984 22:44133208-44133230 AGGCAGAAGCAGAGGCATGAGGG + Intronic
1184383359 22:44160350-44160372 CAGCAAGGGCAGAGCCAGGAGGG + Intronic
1184456104 22:44610131-44610153 CAGCTGGTGCGGAGGCAGGAGGG + Intergenic
1184494079 22:44827154-44827176 CAGCAGAAGCAGAGGCCGGAGGG + Intronic
1184559685 22:45254878-45254900 CAGCGGCAGCAGAATCAGCAGGG - Intergenic
1184759595 22:46537129-46537151 GAGCAGCAGCACGGGCAGCACGG + Exonic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
1184839941 22:47046667-47046689 CAGCAGCAGCTCTGGCAGAAAGG - Intronic
1184921800 22:47610443-47610465 CAGGAGCAGCTGAGGAAGGCAGG - Intergenic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1185058436 22:48593087-48593109 GAGCCGCAGCAGACGCGGGATGG + Intronic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1203296105 22_KI270736v1_random:44445-44467 CAGAAGCAGCACAGGCAGAGGGG - Intergenic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949595891 3:5547246-5547268 CAGCAGCAGAAGAGGAATGTTGG + Intergenic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950276795 3:11668421-11668443 CAGCAGCATCAGTGGCAGCTGGG + Intronic
950281266 3:11710048-11710070 CAGGAGCAAAAGAGGCAAGAAGG + Intronic
950540141 3:13607567-13607589 AAACAGCAGCAGTGGCAGCAAGG - Intronic
950550418 3:13662723-13662745 CAGGAGCAGCTGGGGCATGAGGG - Intergenic
950601005 3:14035470-14035492 CTGCAGAAGCAGTGGCAGAAAGG + Intronic
950653991 3:14425387-14425409 CCCAAGCAGCAGAGGCAGGGAGG + Intronic
950660100 3:14461870-14461892 CAGCAGCAGCAGGGGGAGCCAGG - Intronic
950709793 3:14805966-14805988 CAGCAGCTGAAGAGGCTGCAGGG + Intergenic
950980757 3:17302110-17302132 CAGAAGCAGGAGAGGCAAGGAGG - Intronic
952272667 3:31847989-31848011 CAGGAGCCTCGGAGGCAGGAGGG - Intronic
952644648 3:35640087-35640109 CAGCAGCAGCAGGGGCAGCGGGG + Intronic
952847009 3:37696234-37696256 AAGCACCAGCAGAGTCAGCAGGG + Intronic
952859302 3:37799555-37799577 GAGCAGCTGGAAAGGCAGGAAGG + Intronic
952942490 3:38454762-38454784 CAGCAGCAGCAGCAGCATGCGGG + Intronic
953046643 3:39298719-39298741 CAGTAGCTGCAGTGGCAGGCTGG - Intergenic
953347049 3:42184979-42185001 CAGCAGCAGGAGCTGCAGGAAGG - Intronic
953476565 3:43210490-43210512 CAGCAGCAGCCCTGGCAGGCGGG + Intergenic
953568279 3:44051569-44051591 CAGCAGCACCAGTGCCAGGGAGG - Intergenic
953916742 3:46925268-46925290 CGGCAGCAGCAGAGGCTGTCGGG - Intronic
954143374 3:48621718-48621740 CAGGAGCAGCAAAGGCAGCGAGG + Exonic
954304490 3:49718231-49718253 CGGCGGCAGCAGCGGCAGGGTGG + Exonic
954333565 3:49903559-49903581 CAACAGCAGCAGCAACAGGAAGG + Exonic
954417448 3:50400275-50400297 CAGCAGCAGCAGAGGCCCACAGG - Intronic
954420860 3:50418405-50418427 TAGCACAAGCAAAGGCAGGAAGG - Intronic
954437156 3:50502538-50502560 CAGCAGCAGCAGGCGCAGGCAGG + Intronic
954446740 3:50550871-50550893 CACCAGCAGGAGAGCCAGGATGG - Intergenic
954605102 3:51903329-51903351 CAGCCATAGCATAGGCAGGAAGG + Exonic
955098986 3:55828463-55828485 CAGGGGCAGCAGGGGCAGCAGGG + Intronic
955098989 3:55828472-55828494 CAGGGGCAGCAGGGGCAGCAGGG + Intronic
955510977 3:59679935-59679957 CAGGGGCAGCAGGGGCAGGGAGG - Intergenic
955640746 3:61081274-61081296 GGGCAGCAGGAGAGGCAGGTTGG - Intronic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
956111980 3:65878976-65878998 CAGCAGGAGCTCAGGCAGCAGGG - Intronic
956609145 3:71104395-71104417 CAGCAGCAACAGCAGCAGAAGGG - Intronic
956776373 3:72568630-72568652 GACAAGCAGCAGAGGGAGGAAGG - Intergenic
956780276 3:72597942-72597964 CAGCAGTAGCAGCAGCAGCAGGG + Intergenic
956916882 3:73881039-73881061 AAGCAGCAGTAGAAACAGGAAGG + Intergenic
957227273 3:77465948-77465970 CAGCAGGAGAAGAGGAAGCAAGG - Intronic
957723901 3:84039441-84039463 CAGCAGCAGCAGTACTAGGAAGG + Intergenic
958524248 3:95233366-95233388 CAGCAGTAGGAGAGAAAGGAAGG - Intergenic
958678599 3:97296618-97296640 CAGCAGCAGCAGTGGCAGTGAGG + Intronic
958803571 3:98783223-98783245 TAGCTGCAGCAGAGGCTGGCTGG - Intronic
959291068 3:104475038-104475060 CAGCAGCAGTGGGGGCAGTATGG - Intergenic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
960224747 3:115156641-115156663 AAGAAGTAGAAGAGGCAGGAAGG - Intergenic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
961035483 3:123638739-123638761 GAGGAGTAGGAGAGGCAGGAGGG - Intronic
961268781 3:125671823-125671845 CAGCAGCTGCAGAGGGTGCATGG + Intergenic
961319712 3:126064220-126064242 CCACAGGAGCAGAGTCAGGAGGG - Intronic
961455063 3:127019947-127019969 CATCAGCACCAGGGGCAGGCTGG - Intronic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
961655387 3:128438888-128438910 CAGCAGGGGCAGCGGCAGGTGGG + Intergenic
961895992 3:130168015-130168037 CAGCGGCAGCAGCAGCTGGAGGG + Intergenic
961988117 3:131158689-131158711 CAGCAGCAGCAGAGACAGAATGG - Intronic
962391277 3:134974876-134974898 CAGGAGCAGCTCAAGCAGGAAGG - Intronic
962475703 3:135753233-135753255 CAAGAGCAGGAGAGGCAGGACGG + Intergenic
962712738 3:138101436-138101458 CAGCCGCAGGAGGGGCAGGCTGG + Intronic
962813120 3:138975574-138975596 CAGCTCCAGAAGAGGCCGGAAGG + Intergenic
962884168 3:139608234-139608256 CGACAGCAGCAGAGACAGCATGG + Intronic
963733834 3:148996785-148996807 CAGCAGCACCAGACCCAGGGTGG + Exonic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
963913048 3:150831111-150831133 CAGCAGCTGCAAAGGAAGGAAGG - Intergenic
965199746 3:165642469-165642491 AAGAAGGAGCAGAGGCAAGAAGG - Intergenic
965351321 3:167614994-167615016 CAGAAGGAGGAAAGGCAGGATGG - Intronic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966921872 3:184617473-184617495 CAGCAGCAGCAGCAGCAAGATGG + Intronic
967102324 3:186225850-186225872 CACCAGCAGCTCAGACAGGAAGG - Intronic
967826962 3:193884746-193884768 AAGCAGCAGCAGAGTCAGCTGGG + Intergenic
968084283 3:195867574-195867596 CAGCAGAGGCACAGGCAGGGGGG + Exonic
968503850 4:963090-963112 GGGCAGCAGCAGGGGCGGGAAGG - Intronic
968546361 4:1200936-1200958 CTGCTGCAACAGAGCCAGGAGGG - Intronic
968565325 4:1309574-1309596 GAGGAGGAGCAGAGGCAGGGAGG + Intronic
968619170 4:1596023-1596045 GAGAGGCAGCAGAGGCTGGACGG - Intergenic
968803125 4:2756042-2756064 GAGCAGCTGCGAAGGCAGGAGGG - Exonic
968871891 4:3246576-3246598 CAGCAGCACCTGAGGGAGAAGGG - Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
968961953 4:3750171-3750193 CTGCAGCAGCAGGGACAGAAGGG + Intergenic
968969862 4:3788175-3788197 CAGGAGCTGGAGGGGCAGGAGGG - Intergenic
969006136 4:4021336-4021358 CAGCAGCAGCAGCAGCTGGAGGG + Intergenic
969136739 4:5035423-5035445 ACACAGCAGGAGAGGCAGGAGGG + Intergenic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
969433057 4:7167235-7167257 CAGGAGCAGCACAGTCAGCAAGG - Intergenic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
969523851 4:7694129-7694151 CTGCAGGGGCAGAGGAAGGATGG + Intronic
969639577 4:8388823-8388845 CAGCAGCAGCCCAGGCACCAGGG + Intronic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
969806812 4:9615954-9615976 CAGCAGCAGCAGCAGCTGGAGGG - Intergenic
969931938 4:10639253-10639275 CACCAGCAGGAGAGGCTGGCTGG - Intronic
970054461 4:11954762-11954784 CACCAGTAGCAGAGGGAGAAAGG - Intergenic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970403804 4:15742943-15742965 CAGCTGCAGCAGAGATGGGATGG + Intergenic
970592562 4:17572212-17572234 CAGCAGCAGCAGCAGCAAGATGG - Intergenic
970603519 4:17658845-17658867 GAGCAGCACCTGAGGGAGGAGGG - Intronic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
972270043 4:37502306-37502328 CAGCAGTGGCAGAGGCAGCATGG + Intronic
972828355 4:42786965-42786987 CTGCAGCAGCAATGGCAGAAGGG + Intergenic
972835248 4:42862573-42862595 CAGCAGCAGCAGAGTCCAGGCGG - Intergenic
972838623 4:42905216-42905238 CAACTGCAGCAGAGCCAGGCTGG - Intronic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973576251 4:52292335-52292357 CAGCAGGAGCAGAGTCACTAGGG - Intergenic
973643991 4:52931950-52931972 CAGCTGCAGCAGAGGCCCCAGGG + Intronic
973795024 4:54416386-54416408 TATCAGCAGCAGAGGCATGAGGG - Intergenic
973823559 4:54684098-54684120 ACTCAGTAGCAGAGGCAGGAAGG + Intronic
973830284 4:54752502-54752524 CAGCAGCAGCTGAAGCAGGAGGG + Intergenic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
975033022 4:69647059-69647081 CAGCAGGAACATAGGAAGGAGGG + Exonic
975109575 4:70608594-70608616 CAGCAGCAACAGTGGAAGAATGG + Intergenic
975511117 4:75194415-75194437 CAGCGGCAGCAGTGGCAGTGTGG - Intergenic
975909326 4:79248775-79248797 CAGCAGCAGTGGTGGCAGCATGG - Intronic
976088181 4:81427732-81427754 AAGCAGCAGCAGCAGCAGGCAGG + Exonic
976151303 4:82095103-82095125 CAGAAGCTGGAGAGCCAGGAGGG + Intergenic
976154095 4:82124147-82124169 CAGCAGCAGCAGAGTCGTGTGGG + Intergenic
976357572 4:84137131-84137153 GTGCAGAAGCAGAGGCAGGGTGG - Intergenic
977369821 4:96121411-96121433 CAGAAGCAACATAGGAAGGAGGG + Intergenic
977862560 4:101982079-101982101 CAGCTGCAGCAGACCCAGGGAGG - Intronic
978490066 4:109302788-109302810 CAGCAGCGGGAGCGGCAGGCCGG - Intergenic
978923758 4:114217637-114217659 CAGCAGTGGCAGTGGCAGAAGGG - Intergenic
978923777 4:114217731-114217753 CAGCAGCAGCATAGGCAGTGTGG - Intergenic
979154672 4:117369312-117369334 CAGGAGCAGGTGGGGCAGGAGGG - Intergenic
979577427 4:122310708-122310730 GAGAAGCAGCAGATGCAGGAAGG - Intronic
980282146 4:130736451-130736473 CTGCAGCAGCAGGGGAAGCATGG + Intergenic
980583913 4:134788802-134788824 CAGCAGCAGTGGTGGCAGTATGG + Intergenic
980701733 4:136441780-136441802 CAGGAGCAGCAATGGCAGCATGG + Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
980886209 4:138765581-138765603 CAGCTGCCACAGAGGCGGGAAGG + Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981076225 4:140595175-140595197 CAGCTGCAGCACAAGCAGGTAGG + Intergenic
981145024 4:141313913-141313935 CAGCTACAGCAGAGCCAGGGAGG - Intergenic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
981761483 4:148200125-148200147 TGGCAGAAGCACAGGCAGGATGG + Intronic
981796484 4:148600890-148600912 CTGCTCCAGCAGAGGCAGTAGGG + Intergenic
982113784 4:152080033-152080055 CTGCAGCAGCACAGTCAGCATGG - Intergenic
982198473 4:152937549-152937571 CAGCAGCTGCAGCCGCCGGACGG + Intronic
982277810 4:153654783-153654805 CAGCAGAAGGAAAGGCAAGATGG + Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983381186 4:166996358-166996380 CTGCAGCTGCACAGGCAGCAAGG + Intronic
983560170 4:169093016-169093038 TAGTATCACCAGAGGCAGGAAGG - Intergenic
984078182 4:175209106-175209128 AAGAAACAGCAGATGCAGGAAGG - Intergenic
984213560 4:176880171-176880193 GAGCAGCTGCTGAGGTAGGAAGG + Intergenic
984587034 4:181576623-181576645 CAGCAGAACCACAGGAAGGAAGG + Intergenic
984660398 4:182368234-182368256 CACGAGCATCAGAGGCAGGATGG + Intronic
984763572 4:183383052-183383074 CAGCAGAATCAGAGGATGGAGGG + Intergenic
984766583 4:183404748-183404770 CTGCAGGAGCCCAGGCAGGAAGG + Intergenic
984820518 4:183877660-183877682 CAGCAGCAGCAGCGGAAGTGCGG - Intronic
984833763 4:184000159-184000181 CAGTAGAAGCAGAGGCTGGGAGG - Intronic
985085586 4:186309258-186309280 CAGCAGCAGCAGAGGCGCCTGGG - Intergenic
985314830 4:188646132-188646154 GAGAAACAGCAGAGGTAGGAAGG - Intergenic
985355789 4:189117191-189117213 CAGCATCAGCTGAAGTAGGAGGG - Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985599096 5:816353-816375 CAGCAGCTGCACGGGCGGGAGGG + Intronic
986184457 5:5422837-5422859 CGGCATCAGCAGAGACAGGACGG + Exonic
986296937 5:6447072-6447094 CACCAGCAGCAGCGGCAGCAAGG + Intergenic
986438516 5:7758701-7758723 AGGCAGCAACAGAGGCATGAGGG + Intronic
986469357 5:8058900-8058922 GAGGGGCAGCAGAGGCAGCACGG + Intergenic
986703385 5:10433389-10433411 CAGAAGCAGCACAGGCTGGAAGG - Intronic
986777303 5:11028291-11028313 TAGCAGCTGCAGAAACAGGAGGG - Intronic
987209780 5:15669011-15669033 CAGCAGCAGCAGAAACAATAAGG - Intronic
987789113 5:22541244-22541266 CAGCAGCTGCATAGCCAGGTGGG - Intronic
988029040 5:25739077-25739099 CAGCAGTGGCAGTGGCAGGCAGG - Intergenic
988487341 5:31677878-31677900 CAGCAGCAGAGGAGGAAGGGGGG + Intronic
988540117 5:32100888-32100910 CAGCAGCAACACAGCCAGGAGGG + Intronic
988865048 5:35324992-35325014 CAGCAGCAGCAATGGCAGCATGG - Intergenic
990317925 5:54601625-54601647 CAGCAGCAGCACAGGAAAGTGGG + Intergenic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
991654257 5:68887278-68887300 CAGCAGCAGCAGTAGCTGCAAGG + Intergenic
991670892 5:69046512-69046534 CAGCAGCTGAAGAGTCAGCATGG - Intergenic
992009077 5:72509283-72509305 CATCAGCAGCAGAGGAAAGGAGG + Intergenic
992012329 5:72541306-72541328 CATCAGCAGCAGAGGAAAGGAGG + Intergenic
992508419 5:77410049-77410071 CATCAGCAGCAGGGGAGGGAGGG - Intronic
992783151 5:80146204-80146226 GAGCAGCAGCCGGGGAAGGAGGG - Exonic
993178451 5:84518560-84518582 CAGCAGTGGCAGAGGCAGCATGG + Intergenic
993659018 5:90607363-90607385 CAGCAGCAGCACAGGATGGAAGG - Intronic
994497794 5:100535577-100535599 CAGCAACAGCAGGAGGAGGACGG - Exonic
994643015 5:102433746-102433768 CAACAGCAGCAGCGGCAGCATGG + Intronic
994942302 5:106340331-106340353 GAGAAACGGCAGAGGCAGGAAGG + Intergenic
994946807 5:106404605-106404627 CAGTAGCAGGAGATGCAGGGAGG + Intergenic
994970565 5:106731286-106731308 CACCAGCAGCAGTGGCAGCATGG - Intergenic
995442324 5:112205779-112205801 CACCTGCAGGAGAGGCAGCAAGG + Intronic
995879652 5:116830124-116830146 CAGCAGCAGCAGATTCTGGCAGG - Intergenic
996030669 5:118700929-118700951 AAGCAGCAGCAGATCTAGGATGG - Intergenic
996217469 5:120887122-120887144 CAGCACCAGCAGAGGGTAGAAGG + Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
997183499 5:131857956-131857978 CAGCAGCAGCAGTGGTGGGCTGG - Intronic
997419705 5:133756298-133756320 CAGTAGCAGAAGATGCAGAAGGG + Intergenic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997710029 5:135996402-135996424 GAGCAGCAGCAGAGGCTGAAAGG - Intergenic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998080883 5:139274108-139274130 CAGCACCGGCAGAGGCCGGAGGG - Exonic
998147031 5:139734796-139734818 CTGGATCAGCAGAGGCAGGCAGG - Intergenic
998820606 5:146054357-146054379 CAGCAGTAGCAGCAGCAGCAAGG - Intronic
999101225 5:149027715-149027737 CCACAGCCTCAGAGGCAGGAGGG + Exonic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
999232187 5:150068248-150068270 CAGCAGCAGCAAGGCCATGATGG + Exonic
999366125 5:151024613-151024635 CAGCAGCTGGGGAGGGAGGAAGG + Intronic
999383164 5:151136000-151136022 CTGCAGAAGCAATGGCAGGAAGG + Intronic
999396875 5:151235135-151235157 AAGCAGCTGCAGAGGAGGGACGG + Intronic
999409176 5:151335431-151335453 CAGCACCAGGAAGGGCAGGAAGG + Exonic
999423734 5:151467801-151467823 CAGCACCAGGAAGGGCAGGAAGG - Exonic
999769756 5:154766574-154766596 CAGCTGCAGCAGGGGCAAGCAGG - Intronic
999868927 5:155729681-155729703 TAGAAGCAGCAGAGGCAGCCCGG - Intergenic
1000518740 5:162273688-162273710 GAGAAACAGCAGATGCAGGAAGG + Intergenic
1000734562 5:164882821-164882843 CAGAAGAAGCAAAGGAAGGAAGG - Intergenic
1001055293 5:168444530-168444552 GAGCTGGAGAAGAGGCAGGAGGG + Exonic
1001135282 5:169097699-169097721 GCGCAGCAGCAGTAGCAGGAGGG + Intronic
1001277427 5:170360817-170360839 CACCTGCAGCCGAGGAAGGAAGG + Intronic
1001380044 5:171299394-171299416 CAGATGCAGCTGAGGCAGGGAGG - Exonic
1001421531 5:171591010-171591032 CAGCACCAGCAAAGGCAAGAAGG - Intergenic
1001735423 5:173994555-173994577 CAGTGGCAGCGGAGGCAGAATGG + Intronic
1001769700 5:174284299-174284321 CAGCATAAGCAAAGGCATGAAGG + Intergenic
1001776775 5:174334758-174334780 TACATGCAGCAGAGGCAGGATGG - Intergenic
1001855332 5:175005507-175005529 CAGCAGGAGCGGAGTCAGGCAGG + Intergenic
1001960101 5:175874800-175874822 GAGGGGCAGGAGAGGCAGGAGGG + Intronic
1002292062 5:178206741-178206763 CAGAAGGAGCACAGGCTGGATGG + Exonic
1002319547 5:178366739-178366761 CAGCAGAAGCACAGGCACGGAGG - Intronic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002470580 5:179432890-179432912 CAGTCCCAGCAGAGGCTGGAGGG - Intergenic
1002517470 5:179770111-179770133 CAGGAGCTGGAGAGGCAGGGTGG - Intronic
1002929548 6:1624044-1624066 CAGCGGCAGCAGGGGCCGCAGGG + Exonic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003414930 6:5898959-5898981 CAGCAGCAGAAGGTGGAGGAAGG - Intergenic
1003529272 6:6924598-6924620 CAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003870388 6:10398307-10398329 CAGCAGTAGCAGCAGCAGGAAGG + Exonic
1004004788 6:11628649-11628671 CAGCAGCAGCAGCTACAGGAAGG - Intergenic
1004143985 6:13047683-13047705 AGTCAGCACCAGAGGCAGGAGGG - Intronic
1004205696 6:13589775-13589797 TAGCAGCAGCAGAGGGTGGGAGG + Intronic
1004275814 6:14234180-14234202 CCACAGAAGCAGAGGCAGGAAGG + Intergenic
1004725569 6:18308255-18308277 CAGCAGCGGCAGATGCAAGCTGG - Intergenic
1004732208 6:18368677-18368699 CAGCAGCAGCAGCGGCTGCGCGG - Intergenic
1004753131 6:18583916-18583938 TATCAGCAGCAGAGGCAGAGAGG + Intergenic
1004997665 6:21209758-21209780 CAGCAGCAGCAGAACCTGAAAGG + Intronic
1005019480 6:21404056-21404078 CAGCAGCAGCTGGAACAGGAGGG - Intergenic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1006102103 6:31691828-31691850 CTGCAGCAGCACAGGCATGAGGG + Exonic
1006125874 6:31837731-31837753 GAGCAGCAGCAAAGGCAGGGAGG + Intronic
1006255941 6:32832400-32832422 GGGCTGCAGCAGATGCAGGATGG - Exonic
1006382093 6:33704909-33704931 GAGCAGCAGGACAGACAGGAGGG + Intronic
1006449156 6:34096029-34096051 CAGCAGCAGGAGGGGAGGGAGGG + Intronic
1006793694 6:36719309-36719331 GAGCAGCAGCAGAGGCACCTGGG - Intronic
1006811702 6:36824425-36824447 GAGTAGCCGCACAGGCAGGAAGG - Intronic
1006852098 6:37106042-37106064 CAGCATGGGTAGAGGCAGGAAGG + Intergenic
1006887586 6:37395442-37395464 CATCAGCTGCAGAGCCAGGGCGG - Intergenic
1007323610 6:41043941-41043963 CAGCAGCAGCAGGTGCAGCAGGG - Exonic
1007339920 6:41184885-41184907 CAGCAGCAGCAGCAGCACAACGG + Intergenic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007368864 6:41413275-41413297 CAGCAGCAGCAGAACTGGGAAGG - Intergenic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1007751200 6:44073025-44073047 GAGGTGCAGCAGAGGCAGGCGGG + Intergenic
1008087799 6:47262710-47262732 CAGCAGGTGCAATGGCAGGAAGG + Intronic
1008469373 6:51866040-51866062 CAGCAGCAGCAGCAGCACCAGGG - Intronic
1008507624 6:52246399-52246421 CTGGGGCAGCAGAGCCAGGACGG + Intergenic
1008664336 6:53701243-53701265 TAGCAGAAGCAGAAGCATGAAGG - Intergenic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1009408807 6:63341491-63341513 CAGTAGCAGCAGCCCCAGGAAGG + Intergenic
1009490821 6:64288451-64288473 CAGCAGCAGCGAAGACTGGAAGG - Intronic
1010748245 6:79588527-79588549 GAGAAGCAGCAGATGCAGGAAGG - Intergenic
1010813685 6:80329615-80329637 CAGCACCAGCACAGGGAGGAGGG - Intronic
1011071778 6:83393020-83393042 CAGCACCAGTAGAGGCAGAGAGG - Intronic
1011290482 6:85772062-85772084 CAGCAGCAGCAGTGGCAGCACGG + Intergenic
1011399929 6:86949355-86949377 CAACAGCAGCAGCAGCAGCAGGG - Intronic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1012123819 6:95400869-95400891 CAACAGCAGCAGATGGAGAAGGG - Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012490659 6:99779850-99779872 CAGCAGCAGTGGAAGCAGCATGG + Intergenic
1012616424 6:101284132-101284154 CAGCAGAAGCAGTGGCAGAGAGG - Intergenic
1013037848 6:106404086-106404108 CACCAACAGCAGAGGCTGAAAGG - Intergenic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013437210 6:110122519-110122541 CAGGAGTAGCAGAGGCAGAGAGG - Intronic
1013793008 6:113857508-113857530 AAGCAGCAGCACAGGAGGGAGGG - Exonic
1013951070 6:115782546-115782568 CATCAGCACCAGCAGCAGGAGGG - Intergenic
1014199094 6:118588999-118589021 CAACAGCAGCAGCGGCAGTGAGG - Intronic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1014814083 6:125916559-125916581 GAGCAGCAGAACAGGAAGGAGGG - Intronic
1015320392 6:131866421-131866443 CAGCAACAGCAGAGGAAGGAAGG + Intronic
1015843453 6:137495756-137495778 CAGCAGCACGAGGGGCGGGAAGG + Intergenic
1016453581 6:144209263-144209285 CAGCTGCAGTGGAGGCAGCATGG + Intergenic
1016986025 6:149896574-149896596 CAGCAGCAGTATTGGCAGGGCGG - Intronic
1017056507 6:150441448-150441470 CAGCAGAGGTGGAGGCAGGAAGG - Intergenic
1017230083 6:152064273-152064295 CAGCAGCTGCGGAGGAAGGATGG + Intronic
1017664344 6:156705023-156705045 TAGCAGCAGTAGAGGAAGGAAGG - Intergenic
1017730170 6:157308632-157308654 CAGCAGAAGAGGAGGCAAGACGG + Intronic
1017898557 6:158701817-158701839 TAGCACCAGCAGAGGAAGCATGG - Intronic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018091552 6:160349956-160349978 CAACAGCAACAGCGGCAGAAAGG - Intronic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018169235 6:161131315-161131337 CTGCAGGAGCTGAGGAAGGAAGG + Exonic
1018683199 6:166281859-166281881 CCCCAGGTGCAGAGGCAGGAGGG - Intergenic
1018783663 6:167091745-167091767 AAGCAGCATCAGAGCCAGGAAGG + Intergenic
1018797976 6:167202013-167202035 CAGAAGCCGAAGAGCCAGGAAGG + Intergenic
1019178638 6:170174164-170174186 CAGAAGCAGCAGAAGCAGCTAGG - Intergenic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1019224711 6:170500398-170500420 CAGAAACAGCAGGGGCAGGGGGG - Intergenic
1019293057 7:259745-259767 CAGGAGCTGCAGACGCAGGTAGG - Exonic
1019328421 7:451018-451040 CAGACTCAGCAGAGGCAGGAAGG - Intergenic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019593948 7:1849802-1849824 CAGCGGCAGCGGAAGCAGGACGG + Exonic
1019639899 7:2097719-2097741 CAGCAGCAGCAGGGGCTGCCCGG + Intronic
1019940216 7:4283597-4283619 CAGCAGTGGCAGCCGCAGGAAGG - Intergenic
1019940553 7:4285883-4285905 CAGCAGTGGCAGCAGCAGGAAGG - Intergenic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020020673 7:4865802-4865824 TGGCAGCAGCGGAGGCAGAAAGG + Intronic
1020042105 7:5012125-5012147 CAGCAGAAGCAATGGAAGGATGG - Intronic
1020474714 7:8581916-8581938 TAGCACAAGCAGAGGCAGCAGGG - Intronic
1021067721 7:16197577-16197599 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021067882 7:16198794-16198816 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021297219 7:18922807-18922829 CATCAGCAACAGAGCCAGGGTGG - Intronic
1021630894 7:22646583-22646605 CAGCAGCAGCAAAGGCTGTTGGG + Intergenic
1022112258 7:27239091-27239113 CAGCAGCTGCCAAGGCAGAAGGG + Intergenic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1022226723 7:28371168-28371190 CAGCAGCAGAAGATTCAGGGAGG + Intronic
1022388591 7:29924440-29924462 AGACAGCAGCAGAGGCTGGAGGG - Intronic
1022475124 7:30705011-30705033 ATGCAGCAGCCCAGGCAGGAAGG + Intronic
1022525651 7:31035329-31035351 CAGCAGCAGGGGAAGAAGGAGGG + Intergenic
1022812258 7:33881380-33881402 GTGTAGCAGCAGATGCAGGAAGG + Intergenic
1022877849 7:34553167-34553189 CAGCAGCAGTGGTGGCAGTATGG - Intergenic
1023203758 7:37725852-37725874 TAGCAGTAACAGAGGCAGGAAGG - Intronic
1023607448 7:41943228-41943250 CAGCAGCAGCATGGGCTGAAGGG + Intergenic
1023743004 7:43297585-43297607 CAGGAGCAGCGGAGGCATGATGG - Intronic
1023763029 7:43484277-43484299 GAGGAGCAGGAAAGGCAGGACGG + Intronic
1023795728 7:43790301-43790323 AACCAGGAGCAGAAGCAGGAGGG - Intronic
1023993198 7:45142679-45142701 CAGCAGCAGGGGAGCCTGGAGGG + Intergenic
1024015684 7:45312141-45312163 CAGCAGTGGCAGATGCAGGCAGG + Intergenic
1024145544 7:46513003-46513025 CAGCAGCAGCAGATGCAACTGGG + Intergenic
1024212218 7:47215811-47215833 CAGCAGCTGCAGAGGCATCTGGG + Intergenic
1024983877 7:55179549-55179571 CAGGAGGACCAGAGGCTGGAGGG + Intronic
1024984448 7:55183068-55183090 CAGAAGCCAGAGAGGCAGGAAGG - Intronic
1026173993 7:67979726-67979748 CAGCAGCAGGAGAAGCATGGAGG - Intergenic
1026347987 7:69491512-69491534 CAGCAGTAGTAGTGGCAGGGTGG - Intergenic
1026396129 7:69956114-69956136 AAGCAGCAGCTGAGGCATGTTGG - Intronic
1026476486 7:70740394-70740416 CTGAAGCAGCAAAGGAAGGAAGG - Intronic
1026545174 7:71316141-71316163 GAGCAGGAGCAAAGGGAGGAAGG + Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026946746 7:74321049-74321071 CAGCAGGAGCAGGGCTAGGAGGG - Intronic
1026972943 7:74479056-74479078 CAGCAGCAGGGGATGGAGGACGG - Intronic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1029111894 7:98217019-98217041 CTGGGGCAGCAGAGCCAGGATGG - Exonic
1029155489 7:98514518-98514540 CACCAGCAGCTGAGGCAGGAAGG + Intergenic
1029405852 7:100373679-100373701 CGGCAGCAGCAAGGGCAGTAGGG - Exonic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029525229 7:101089778-101089800 CAGAAGCAGAGGAGGCAGGTGGG + Exonic
1029714398 7:102318052-102318074 CAGCTGGATCAGAGGCATGATGG + Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030549999 7:110946230-110946252 CAGAAGCATCAGAGTCAGCAGGG - Intronic
1031041856 7:116846805-116846827 GGGCAGCAGCAGGGCCAGGAAGG + Intronic
1031619815 7:123922714-123922736 GAGCAACAGCAGAGGCAGGAAGG - Intergenic
1031702780 7:124945467-124945489 CAGCAGCAACAGTGGCAGTGTGG - Intergenic
1031836224 7:126684997-126685019 TAGCAGCAGGAGAGGCTGCAGGG + Intronic
1031868051 7:127061610-127061632 AAGCATCAGCAGGGGGAGGAAGG - Intronic
1031894765 7:127336444-127336466 TAGCAGAAGCAGAGGCTGGAGGG - Intergenic
1031987017 7:128169781-128169803 CAGAAGTAGGATAGGCAGGATGG - Intergenic
1032553170 7:132804893-132804915 CGGGAGCAGCAGTGGGAGGAGGG + Intronic
1033142278 7:138838288-138838310 CACCTGCAGCATAGGCAGCAGGG - Intronic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033307822 7:140238144-140238166 GAGCAGCAGCAAAGGCTGTAAGG + Intergenic
1033395226 7:140967553-140967575 CAGCAGCAGACCTGGCAGGATGG - Intergenic
1033412584 7:141132593-141132615 CAGCAGTGGCAGTGGCAGGCTGG - Intronic
1033598135 7:142870866-142870888 CAGCAACACCTGAGGCAGCAGGG + Exonic
1033673015 7:143511272-143511294 CAGCAGCAGCAGCACCAGGCAGG + Intergenic
1034020511 7:147636962-147636984 CAGCAGGTGCAGAGGCACTAAGG + Intronic
1034166415 7:149028370-149028392 CAAGAGCAGCAGGAGCAGGAAGG + Exonic
1034260652 7:149753255-149753277 CAGGGGCAGCAGGGGCAGCAGGG + Intergenic
1034402296 7:150870780-150870802 CAGCAGCATCAAGGGCAGAAAGG - Intergenic
1034410985 7:150942129-150942151 GAGCAGGAACAGAAGCAGGAGGG - Intergenic
1034424666 7:151008199-151008221 CAGCAGCAGTGGAGATAGGAAGG + Intronic
1034440035 7:151081666-151081688 CAGCAACAGCAGGAGCAGCAGGG + Exonic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1034894616 7:154868445-154868467 CACCAGCTGATGAGGCAGGAAGG - Intronic
1035054716 7:156026898-156026920 GAGAAGCAGCAGAGACAGGCTGG + Intergenic
1035081729 7:156221921-156221943 TAACAGGAGCAGAGGCAGCATGG - Intergenic
1035127487 7:156619025-156619047 CAGCAGCAGCTGGGGAAGGAAGG + Intergenic
1035702185 8:1644429-1644451 CAGCAGCCGTAGAGGCATGGAGG - Intronic
1035945111 8:3953975-3953997 CATCACCACCAGAGGAAGGAAGG - Intronic
1036022627 8:4862910-4862932 CAGCACCAAGAGAGGCTGGAGGG + Intronic
1036579689 8:10062230-10062252 CAGCAGCAGCAGCAGCTGGCTGG + Intronic
1036796864 8:11762476-11762498 CAGCAGCCACAGCGGTAGGACGG - Exonic
1036823445 8:11957697-11957719 CAGACCCAGCAGTGGCAGGAGGG + Intergenic
1036957838 8:13209728-13209750 TAGCAGCAAGAGAGACAGGAGGG - Intronic
1037143057 8:15540507-15540529 CAGCAGCAGCAGGAGAAGGAAGG - Exonic
1037150026 8:15626066-15626088 CAGGAGCAGCAGTGGCAGTGGGG + Intronic
1037483297 8:19325080-19325102 CAGGACCAGCAGACGCCGGAGGG - Intronic
1037821593 8:22137726-22137748 CAGTGGGAGCACAGGCAGGAGGG - Intergenic
1037852799 8:22346406-22346428 CAGCATCAGAGGAGGAAGGATGG - Intronic
1037890555 8:22621811-22621833 CCCCAGCAGCAGGTGCAGGAAGG + Intronic
1038170729 8:25128960-25128982 CTGCTGCAGCAGTGGCAGGGCGG - Intergenic
1038463167 8:27733858-27733880 CAGATGCAGCAGCGGGAGGAAGG + Exonic
1039546591 8:38415118-38415140 CAGACGCAGCAGAGGCATAAGGG - Intronic
1039605198 8:38874783-38874805 CAGCTGCTGAAAAGGCAGGAAGG + Intergenic
1040388569 8:46931339-46931361 TTGCAGCTGCAGAGGCAGGCAGG - Intergenic
1040515737 8:48133301-48133323 AAGCAGCACCAGAGCCAGGCTGG + Intergenic
1041232546 8:55768395-55768417 CAGCTGCAGCAGCAGCAGCAAGG - Intronic
1041393298 8:57367049-57367071 CAGCGGGAGCAGAGGCAGTGTGG - Intergenic
1041571824 8:59345808-59345830 CAAAAGCAGCAGAGGCTGGTAGG + Intergenic
1041698840 8:60765630-60765652 CAGCAGCAGCAGCCGCACAAAGG - Intronic
1042380146 8:68104172-68104194 CACCAGCAGTAGAGGTAGGGAGG - Intronic
1042444024 8:68862548-68862570 CGGCAGCAGCAGCAGCAGGTGGG - Intergenic
1042519483 8:69696107-69696129 CAGCAGCAGTTGATTCAGGATGG + Intronic
1042874376 8:73427276-73427298 CGGCAGCAGCAGTGGGAGGAGGG + Intronic
1042939735 8:74095671-74095693 CAGCAGCAGAAGAGGTAGGAGGG - Intergenic
1042976938 8:74479840-74479862 CAGCAAGAGCAGAGGCTGTAGGG + Intronic
1043031010 8:75133500-75133522 CAGCAGCATCAGAAGCACAAGGG - Intergenic
1043131810 8:76472188-76472210 CAGCAGCAGCAGTAGCATGCAGG + Intergenic
1043485869 8:80698744-80698766 CAGCATCAGCAGAGGCAGCCCGG + Intronic
1044313883 8:90727063-90727085 CAGCAGCGGCAGCAGCAGCATGG - Intronic
1044720540 8:95141495-95141517 CAGCTGCAGCAGAGGCTGTAGGG - Intronic
1044900700 8:96941174-96941196 CAGCAGCAGCAGCAGCACCAGGG - Intronic
1045245383 8:100437727-100437749 CAGCAGCAGCAAGGCCAGGAAGG + Intergenic
1045398855 8:101790916-101790938 CAGCAGTAGCAGCAGCAGCAAGG + Intronic
1045430341 8:102107999-102108021 GACCAGGAGCAGGGGCAGGAAGG - Intronic
1045499398 8:102733431-102733453 CAGCAGCAGGAGCAGCAGCATGG + Intergenic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1045718320 8:105074908-105074930 CAGCAGCAGCAGCAGCGGGAGGG - Intronic
1047351208 8:124076357-124076379 CAGCAGGAGCAAATGCAGAAAGG - Intronic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048164787 8:132053038-132053060 CAGTACAAGCAAAGGCAGGATGG - Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048436327 8:134421908-134421930 CATGAGCAGCAGAGGCAACATGG + Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048926566 8:139277333-139277355 GAGAAGCAGCAGAGGCCAGATGG - Intergenic
1048967606 8:139625689-139625711 CAGCTGCAGCAGAGAGATGAAGG - Intronic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1049038012 8:140091689-140091711 CAGCTGCGGCAGGGGCAAGAGGG + Intronic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049184282 8:141241231-141241253 GAGCAGCAGCACAGCCAAGAAGG + Intronic
1049277170 8:141725710-141725732 GAGCAGCTGCAGAGGGAGGGAGG - Intergenic
1049300578 8:141867377-141867399 CATCATCAACAGAGGCAGGACGG - Intergenic
1049377929 8:142297908-142297930 CAGCAACAGCAGGCGCGGGACGG - Intronic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1049443537 8:142619771-142619793 CAACAGGAGAAGAGGAAGGAAGG - Intergenic
1049495101 8:142926366-142926388 CAGACTCAGCAGGGGCAGGAAGG - Intergenic
1049507952 8:143013827-143013849 CAGCGGCAGCAGGGGCTGGATGG + Intergenic
1049615200 8:143572886-143572908 CTCCAGCAGCCCAGGCAGGAGGG - Exonic
1049708843 8:144054776-144054798 CTGCCCCAGCAGAGGCAGGCGGG + Intronic
1049767137 8:144360121-144360143 CAGCAGCAGAAGACCCTGGAAGG - Exonic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1049953013 9:663729-663751 CAGCTGGAGCAGAGCCAGCACGG + Intronic
1050241995 9:3646409-3646431 GCTCAGCAGCAGAAGCAGGAAGG - Intergenic
1050424921 9:5502655-5502677 TAGAAGCAGCAGTGGCAGCATGG - Intergenic
1051266699 9:15316166-15316188 CAGCAGCAGCAGCAGCAAGTGGG - Intergenic
1051810862 9:21048125-21048147 CAGGAACAGCAGAGCCAAGAAGG - Intergenic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1052196842 9:25727681-25727703 CAGCAGGAGAAGAAGCTGGAAGG - Intergenic
1052494534 9:29211513-29211535 GAGCATCAGAAGAGGAAGGAGGG - Intergenic
1052829381 9:33202618-33202640 CGGCAGCACCAGAGGCGGGGAGG - Intergenic
1052937840 9:34108105-34108127 CAGCAAGAGCAAAGGCAGGGAGG - Intronic
1053001108 9:34577793-34577815 CACCGGCTGCAGAGGCAGGGGGG + Intronic
1053044648 9:34905220-34905242 GACCAGCTGCAGAGGCAGGGAGG + Intergenic
1053052937 9:34976709-34976731 CAACTGCTGCAGAAGCAGGAGGG - Exonic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1053366778 9:37528434-37528456 CAGCATGAGCAAAGGCAGCAGGG - Intronic
1053456114 9:38234167-38234189 CAGGAGCAGGAGACGCTGGAGGG + Intergenic
1053542847 9:38993161-38993183 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053807293 9:41816678-41816700 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1054623299 9:67370749-67370771 CAGCAGCAGCAGTGGCAGCGAGG - Intergenic
1054880711 9:70142000-70142022 GAGAAATAGCAGAGGCAGGAAGG - Intronic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1055573375 9:77639626-77639648 CAGCAGCAGCAGCGACTGGCAGG + Intronic
1055752553 9:79522831-79522853 GAGCTGCAGCCGAGGCAGGCAGG + Intergenic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1056180198 9:84075622-84075644 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
1056410756 9:86324290-86324312 CAGCAGCAGCAGAGCCTGGTGGG - Intronic
1056456533 9:86766163-86766185 CAGCAGCAGCTGCAGGAGGAGGG + Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056572594 9:87828699-87828721 CAGCAGTGGCAGAGGCAGCATGG - Intergenic
1056666746 9:88587476-88587498 AAGGAGCAGCAGAGGAAGGGTGG + Intergenic
1056786368 9:89595182-89595204 CAGCAGGAGCAGAGGCGAGCTGG + Intergenic
1056815052 9:89795114-89795136 GAGCAGGAGCAGAGCCAGGACGG - Intergenic
1056856332 9:90132704-90132726 CAGAATCAGCAGCGGAAGGAAGG - Intergenic
1056947756 9:91014170-91014192 CATCAGATGCAGAGACAGGAAGG + Intergenic
1056965628 9:91161121-91161143 TGGCAGGCGCAGAGGCAGGAAGG - Intergenic
1057581938 9:96294962-96294984 CATCAGCAGCAGATGAAGGACGG + Intronic
1057641959 9:96833062-96833084 CAGCAGCAGAAGAGAGAAGACGG - Intronic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058957707 9:109964375-109964397 AGGCAGAGGCAGAGGCAGGAAGG + Intronic
1059119772 9:111631481-111631503 CAGCAGCAGCGCCGGCAGCAGGG - Exonic
1059316252 9:113428185-113428207 CAGCAGCAGCAGATGGAAAAAGG + Exonic
1059386645 9:113969775-113969797 CAGCAACAGCAGCGGCAGCATGG - Intronic
1060521490 9:124296552-124296574 CAGGAGCAGAAGAGGCAGGCAGG + Intronic
1060970883 9:127737192-127737214 CAGCAGCAGCAGAGTGGGAAAGG - Intergenic
1061320320 9:129824047-129824069 CAGCAGCAGCAGGCCCAGCACGG + Exonic
1061378932 9:130242770-130242792 CAGCAGTAGCACACACAGGAAGG + Intergenic
1061483055 9:130906596-130906618 CAGCAGCAGGAGAGTCAGGGAGG - Intronic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062103750 9:134741591-134741613 GTACAGAAGCAGAGGCAGGAGGG + Intronic
1062119971 9:134829238-134829260 GGGCAGCAGCAGGGGCTGGAGGG + Intronic
1062144991 9:134984186-134984208 TAGAAGCAGGAGAGGCAGGAAGG + Intergenic
1062238580 9:135524187-135524209 TATCTGCAGCAGAGGCAGGAAGG + Intronic
1062320033 9:135986337-135986359 CAGCAGCAGGCGAGACTGGAGGG + Intergenic
1062349661 9:136132734-136132756 CAGGAGCCGCACAGGGAGGATGG - Intergenic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1062452624 9:136621913-136621935 CATCTGCTGCAGAGGAAGGAAGG - Intergenic
1062541639 9:137044219-137044241 CAGCAGCCGCAGTGGCAGGTGGG + Intronic
1062580194 9:137225985-137226007 CAGTGGCAGCAGTGGCAGCAGGG - Exonic
1062592285 9:137279765-137279787 CAGCAGCAGAAACGGCACGATGG - Exonic
1062634728 9:137484833-137484855 CAGCAGCACCAGAGGCCGCCTGG + Intronic
1203780002 EBV:95990-96012 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203780026 EBV:96053-96075 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203780046 EBV:96107-96129 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203780056 EBV:96134-96156 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203780076 EBV:96188-96210 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203780086 EBV:96215-96237 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203780105 EBV:96266-96288 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780124 EBV:96317-96339 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203780152 EBV:96395-96417 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780161 EBV:96419-96441 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780170 EBV:96443-96465 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780180 EBV:96470-96492 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203780190 EBV:96497-96519 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203780199 EBV:96521-96543 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780208 EBV:96545-96567 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780217 EBV:96569-96591 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203613363 Un_KI270749v1:28641-28663 CCGCATCAGCAAATGCAGGAGGG - Intergenic
1185480223 X:440743-440765 CAGCAGCAGCAGCCTGAGGAAGG - Intergenic
1185621959 X:1455469-1455491 CAGGAGCGGGAGAGGCAGGAAGG - Intergenic
1185762267 X:2697724-2697746 CAGCAGCAGAAGAGGCCGACTGG - Intronic
1185888210 X:3801843-3801865 CAGGAGCTGGAGAGGCAGGAAGG + Intergenic
1186069960 X:5808802-5808824 AAGCAGCAGGAGAGGGAGGGAGG - Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1187285332 X:17898762-17898784 CATCACACGCAGAGGCAGGAAGG - Intergenic
1187521779 X:20020616-20020638 TAGCAGCAGCTGAGGCAGGAAGG - Intronic
1187688420 X:21839707-21839729 CAGCGGCGGCAGAGGAGGGAAGG - Exonic
1187830381 X:23375059-23375081 TAGCAACACCAGAGGCTGGATGG + Intronic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188707882 X:33357715-33357737 CAGCAGCAGCAGTAGCAGTATGG - Intergenic
1188852752 X:35151347-35151369 CAGAAGCAGTTGAGGCAGCATGG - Intergenic
1189893697 X:45632245-45632267 CAGCCGCAGGAGGGGCAGGCTGG + Intergenic
1190080533 X:47353713-47353735 CAGCACCAGCAGAGACAAGTGGG - Intergenic
1190233511 X:48599610-48599632 CGTCAGCAGCAGAGGCAAGTCGG + Exonic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190390530 X:49926883-49926905 GAGCAGAAGCAGGGGCAGTAAGG + Intronic
1191220843 X:57986153-57986175 CAGCCGCAGGAGGGGCAGGCTGG - Intergenic
1191695552 X:63986079-63986101 TAGCAGCAGCAGTGGCAGTGTGG - Intergenic
1191713133 X:64174156-64174178 CAGCATCAGCAGAAGCAAGTTGG - Intergenic
1191823687 X:65340271-65340293 CAGCAGTAGTGGAGGCAGCATGG - Intergenic
1191842830 X:65525153-65525175 CTGAAGCAGCATAGGGAGGAGGG + Intronic
1191961142 X:66703271-66703293 CACCAGCAGCAGTGGTAGCAGGG - Intergenic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1192291330 X:69798657-69798679 CAGCAGAAGCAGTGCCAAGAGGG + Intronic
1192447790 X:71223569-71223591 CAGTAGCAGGAAAGGAAGGATGG - Intronic
1192982962 X:76366848-76366870 CAGTGGCAGCAGTGGCAGCATGG + Intergenic
1193162276 X:78241167-78241189 CACCAGTGGCAGAGGCAGGTGGG - Intergenic
1193436491 X:81479782-81479804 CAGCTGCAGCTGAGGCACGTGGG - Intergenic
1193736214 X:85159838-85159860 CAGCAGCAGCAGTGGCAGCATGG - Intergenic
1193883755 X:86960115-86960137 CAGCAGTTGCAGAGACAGCAAGG + Intergenic
1193894684 X:87098673-87098695 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1193970044 X:88039611-88039633 CAGCAGCAGCAGTGGTGGGAAGG - Intergenic
1194217410 X:91148060-91148082 CAGCAGCGGCAGTGGCAGCATGG + Intergenic
1194323465 X:92480932-92480954 CAGCAGCGACAGAGGCAGCATGG + Intronic
1194346719 X:92773995-92774017 CAGCAGCAGCAAAGGCAGCATGG - Intergenic
1194427710 X:93760414-93760436 CAGTAGCAACAGAGGCAGAGCGG + Intergenic
1194542884 X:95196552-95196574 CCGCAGAAGCAGCGGCAGCATGG + Intergenic
1195085235 X:101407581-101407603 AAGCAGCAGCAGAGTCGGGTGGG + Intronic
1195311639 X:103637806-103637828 CAGCATCAGCAAAGGCATGCAGG - Intergenic
1195372231 X:104188156-104188178 CAGCAGCAGCAGTGCCAGCATGG + Exonic
1195533237 X:105981991-105982013 CAGCAGCAACAGCAGCACGACGG + Intergenic
1195533247 X:105982059-105982081 CAGCAGCAGTAGAGGCACCATGG + Intergenic
1195544476 X:106100009-106100031 CTGCAGCAGCATTGGCAGCATGG + Intergenic
1195544491 X:106100104-106100126 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196804469 X:119572340-119572362 CAGCAACAGCAGAACCAGAACGG - Intergenic
1197104996 X:122703134-122703156 TAGCAGCAGCAGCAGCAGGCAGG + Intergenic
1197570759 X:128147607-128147629 CAGCAGCAGCAGTGACAGCCTGG - Intergenic
1197620937 X:128747255-128747277 CAGCAGCAGCTTAGGCTGGCAGG + Intergenic
1197762589 X:130038346-130038368 CAGGAGCTGCAGATCCAGGAGGG + Intronic
1197790512 X:130249247-130249269 CAGAAGTGGCAGAGGCAGCATGG - Intronic
1198012058 X:132567246-132567268 AAGTAGCTGCAGAGGCAGGTGGG + Intergenic
1198312953 X:135438105-135438127 GTGCTGCAGCAGTGGCAGGAGGG + Intergenic
1198471120 X:136948139-136948161 TGGCGGCAGCAGAGGCAGAAAGG + Intergenic
1198683972 X:139208372-139208394 TAAGAGCAGCAGAGACAGGATGG - Intronic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1198975023 X:142327049-142327071 GAGCAGCAGCAGTGGCAGCATGG + Intergenic
1199137110 X:144266309-144266331 GAGCAGGAGCAGTGGCAGCATGG - Intergenic
1199258428 X:145744009-145744031 CCCCAGCAGCAGTGGCAGCATGG + Intergenic
1199467242 X:148152515-148152537 TGGCAGCAGCAAAAGCAGGAAGG - Intergenic
1200102646 X:153695582-153695604 CAGAAGCAGCAGTGGCAGCTTGG + Exonic
1200211192 X:154347263-154347285 CAGCGGCAGTTCAGGCAGGATGG - Intergenic
1200553924 Y:4611852-4611874 CAGCAGCGGCAGTGGCAGCATGG + Intergenic
1200631566 Y:5594098-5594120 CAGCAGCGACAGAGGCAGCATGG + Intronic
1200655052 Y:5890639-5890661 CAGCAGCAGCAAAGGCAGCATGG - Intergenic
1201229125 Y:11845973-11845995 CAGAAGCAGCAGTGGCAGTATGG - Intergenic
1201300196 Y:12498566-12498588 CAGCAGCAGGAGCGGCAGGGAGG - Intergenic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic
1202132482 Y:21626007-21626029 CAGCAGTTGCAAAGGCAGAAAGG - Intergenic