ID: 1165063744

View in Genome Browser
Species Human (GRCh38)
Location 19:33217615-33217637
Sequence CGTCCTCTCAGGACCCGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165063744_1165063754 22 Left 1165063744 19:33217615-33217637 CCAGACCGGGTCCTGAGAGGACG 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1165063754 19:33217660-33217682 AGCCCGCCTCCTCCACCTGCCGG 0: 1
1: 2
2: 6
3: 55
4: 342
1165063744_1165063750 -1 Left 1165063744 19:33217615-33217637 CCAGACCGGGTCCTGAGAGGACG 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1165063750 19:33217637-33217659 GGGTCCATCTCCCTCAGAGCGGG 0: 1
1: 0
2: 1
3: 30
4: 157
1165063744_1165063749 -2 Left 1165063744 19:33217615-33217637 CCAGACCGGGTCCTGAGAGGACG 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1165063749 19:33217636-33217658 CGGGTCCATCTCCCTCAGAGCGG 0: 1
1: 0
2: 1
3: 4
4: 72
1165063744_1165063755 23 Left 1165063744 19:33217615-33217637 CCAGACCGGGTCCTGAGAGGACG 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1165063755 19:33217661-33217683 GCCCGCCTCCTCCACCTGCCGGG 0: 1
1: 0
2: 3
3: 60
4: 693

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165063744 Original CRISPR CGTCCTCTCAGGACCCGGTC TGG (reversed) Intronic
900640800 1:3687273-3687295 TGCCCTCTCAGGACCCTGGCTGG + Intronic
901777609 1:11571026-11571048 CGTCCTTCCAGGTCCGGGTCCGG - Intergenic
1073076234 10:100827172-100827194 CGACCTCTGGGGACCCGGCCGGG + Intronic
1075638683 10:124048948-124048970 CATGCTCTGTGGACCCGGTCCGG - Intronic
1085201561 11:74705232-74705254 AGCCCTCTCAAGACCTGGTCTGG - Intronic
1092786698 12:12033027-12033049 CCTCCTCTCAGGCCCCAATCAGG + Intergenic
1095965553 12:47864771-47864793 CTTCCTCTCAGGCCCCACTCTGG + Intronic
1096069073 12:48764723-48764745 GGACCTCTCAGCACCTGGTCCGG + Intergenic
1098678122 12:73316357-73316379 CCTGCTCTCAGTACCTGGTCTGG + Intergenic
1112595898 13:100806627-100806649 CAGCTTCCCAGGACCCGGTCTGG - Intergenic
1113745872 13:112744168-112744190 TGTCCTCCCAGCACCCGGTTTGG + Intronic
1118764098 14:68898710-68898732 CGTCCTCTCATGTCCTGGTCAGG - Intronic
1119709695 14:76812752-76812774 CGCCCTCTCAGGTACCGGCCAGG - Exonic
1133030022 16:3006110-3006132 CTTCCTCTCAGGGCCCAGCCCGG - Intergenic
1141667327 16:85472630-85472652 CAGCGGCTCAGGACCCGGTCTGG + Intergenic
1142194036 16:88731391-88731413 CGTCCTCTCCGGGCCCCGTGCGG - Intronic
1144076237 17:11722061-11722083 CCTCCTCACAGGACCCGGCTGGG + Intronic
1147690802 17:42313204-42313226 CCTCCTCTCAAGACCCTTTCCGG + Intergenic
1152781297 17:82228502-82228524 CTTCCTCTCCGGTCCCGGTGCGG - Intronic
1157858759 18:51123147-51123169 CGTCCACTCAGGTGCCGGTTGGG - Intergenic
1160374217 18:78398976-78398998 GTTCCTCTCAGTTCCCGGTCAGG - Intergenic
1161258167 19:3321199-3321221 CGTCATCTCAGGAATCGTTCAGG - Intergenic
1161866607 19:6837090-6837112 CATCCTCCCAGGACCCGCCCTGG - Intronic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1165063744 19:33217615-33217637 CGTCCTCTCAGGACCCGGTCTGG - Intronic
925112433 2:1347567-1347589 TGTCCTGTCAGGCCCCTGTCTGG + Intronic
927948154 2:27149715-27149737 CGTCGTCTCAGGACCTGGCTAGG + Intronic
931637284 2:64352036-64352058 GCTCCTCTCAGGACCAGGGCAGG - Intergenic
932468349 2:71938313-71938335 AGTCCTCTCTGGACCTGCTCGGG + Intergenic
937882411 2:126878284-126878306 CGTCCTCTCCAGGCCAGGTCTGG + Intergenic
941201293 2:162513526-162513548 CTTCCTTTCAGGACAAGGTCTGG + Intronic
1173851751 20:46222855-46222877 CTTCCTCCCAGGCCCCGTTCCGG + Intronic
1180193757 21:46181764-46181786 CGTCCTTTCCGGGCCCGGCCCGG + Intronic
1180798634 22:18620717-18620739 AGTCCCCTCAGGACTTGGTCTGG + Intergenic
1180876360 22:19176981-19177003 CAGCCTCTCAGGCCCCGGTTGGG + Intronic
1181269764 22:21652299-21652321 CTTCCGCCCAGGGCCCGGTCAGG - Intronic
1185289044 22:50014908-50014930 CGTCCGCCCGGGACCCGGGCTGG + Intergenic
960956317 3:123033977-123033999 GGTCCTCTCAGCACCAGGCCAGG - Intergenic
980222390 4:129935859-129935881 CGTCCTCTCAGGGTCCATTCTGG + Intergenic
994707463 5:103223641-103223663 TGTCCTCTCAGTCCCAGGTCTGG - Intergenic
998922118 5:147081283-147081305 CGTCCTCTCAGGACTCACTAGGG - Intronic
1001084054 5:168687465-168687487 AGGCCTCTCAGGACCCTGTAAGG + Intronic
1002306474 5:178286681-178286703 CTTCCTCCCAGGACCCAGTTGGG - Intronic
1003868074 6:10381510-10381532 CGTCCTCTCAGGCCCCAGATAGG - Intergenic
1006988549 6:38193557-38193579 CCTCCTCTCAGGATCTGCTCAGG - Intronic
1015093109 6:129383153-129383175 GGTCCTCTCAGCATCCTGTCCGG - Exonic
1015350411 6:132210956-132210978 CATCCTCTCAGTCCCAGGTCTGG + Intergenic
1018872834 6:167796344-167796366 CGCCCTCTCTGGATACGGTCTGG + Intronic
1019648631 7:2144370-2144392 GGGCCTCTCAGGACCCCGTGAGG - Intronic
1023790022 7:43746528-43746550 TGTCCTCACAGGACCCTGTGAGG - Intergenic
1026676203 7:72430699-72430721 CCAGCTCTAAGGACCCGGTCTGG + Intronic
1035274116 7:157737276-157737298 CGTCCACACAGGCCCCAGTCTGG - Intronic
1039891026 8:41685521-41685543 TGTCCTCTCAGGACACAGTCTGG - Intronic
1043403180 8:79903665-79903687 TCTCCTCTCAGGACCAGGACAGG - Intergenic
1049145873 8:141000939-141000961 CCTCCTCCCAGAACCCGGGCCGG + Intronic
1061635454 9:131905540-131905562 CGTCCTTCCAGGACCAGGTACGG + Intronic
1062016883 9:134295552-134295574 CGTCCTCTGGGGAACGGGTCTGG + Intergenic