ID: 1165069907

View in Genome Browser
Species Human (GRCh38)
Location 19:33249164-33249186
Sequence GGGTGGGGTCATCAAGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165069907_1165069924 29 Left 1165069907 19:33249164-33249186 CCTTGCACTTGATGACCCCACCC No data
Right 1165069924 19:33249216-33249238 GGGAACTGAGCCTCGGAGAGGGG No data
1165069907_1165069916 7 Left 1165069907 19:33249164-33249186 CCTTGCACTTGATGACCCCACCC No data
Right 1165069916 19:33249194-33249216 TGTGACAACCATGCCACTGACGG No data
1165069907_1165069918 9 Left 1165069907 19:33249164-33249186 CCTTGCACTTGATGACCCCACCC No data
Right 1165069918 19:33249196-33249218 TGACAACCATGCCACTGACGGGG No data
1165069907_1165069921 22 Left 1165069907 19:33249164-33249186 CCTTGCACTTGATGACCCCACCC No data
Right 1165069921 19:33249209-33249231 ACTGACGGGGAACTGAGCCTCGG No data
1165069907_1165069922 27 Left 1165069907 19:33249164-33249186 CCTTGCACTTGATGACCCCACCC No data
Right 1165069922 19:33249214-33249236 CGGGGAACTGAGCCTCGGAGAGG No data
1165069907_1165069917 8 Left 1165069907 19:33249164-33249186 CCTTGCACTTGATGACCCCACCC No data
Right 1165069917 19:33249195-33249217 GTGACAACCATGCCACTGACGGG No data
1165069907_1165069923 28 Left 1165069907 19:33249164-33249186 CCTTGCACTTGATGACCCCACCC No data
Right 1165069923 19:33249215-33249237 GGGGAACTGAGCCTCGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165069907 Original CRISPR GGGTGGGGTCATCAAGTGCA AGG (reversed) Intergenic
No off target data available for this crispr