ID: 1165069911

View in Genome Browser
Species Human (GRCh38)
Location 19:33249180-33249202
Sequence GTTGTCACACAGGCCCGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165069911_1165069922 11 Left 1165069911 19:33249180-33249202 CCCACCCGGGCCTGTGTGACAAC No data
Right 1165069922 19:33249214-33249236 CGGGGAACTGAGCCTCGGAGAGG No data
1165069911_1165069924 13 Left 1165069911 19:33249180-33249202 CCCACCCGGGCCTGTGTGACAAC No data
Right 1165069924 19:33249216-33249238 GGGAACTGAGCCTCGGAGAGGGG No data
1165069911_1165069927 29 Left 1165069911 19:33249180-33249202 CCCACCCGGGCCTGTGTGACAAC No data
Right 1165069927 19:33249232-33249254 AGAGGGGAGGTGACTCACAGAGG No data
1165069911_1165069925 16 Left 1165069911 19:33249180-33249202 CCCACCCGGGCCTGTGTGACAAC No data
Right 1165069925 19:33249219-33249241 AACTGAGCCTCGGAGAGGGGAGG No data
1165069911_1165069916 -9 Left 1165069911 19:33249180-33249202 CCCACCCGGGCCTGTGTGACAAC No data
Right 1165069916 19:33249194-33249216 TGTGACAACCATGCCACTGACGG No data
1165069911_1165069923 12 Left 1165069911 19:33249180-33249202 CCCACCCGGGCCTGTGTGACAAC No data
Right 1165069923 19:33249215-33249237 GGGGAACTGAGCCTCGGAGAGGG No data
1165069911_1165069921 6 Left 1165069911 19:33249180-33249202 CCCACCCGGGCCTGTGTGACAAC No data
Right 1165069921 19:33249209-33249231 ACTGACGGGGAACTGAGCCTCGG No data
1165069911_1165069917 -8 Left 1165069911 19:33249180-33249202 CCCACCCGGGCCTGTGTGACAAC No data
Right 1165069917 19:33249195-33249217 GTGACAACCATGCCACTGACGGG No data
1165069911_1165069918 -7 Left 1165069911 19:33249180-33249202 CCCACCCGGGCCTGTGTGACAAC No data
Right 1165069918 19:33249196-33249218 TGACAACCATGCCACTGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165069911 Original CRISPR GTTGTCACACAGGCCCGGGT GGG (reversed) Intergenic
No off target data available for this crispr