ID: 1165069915

View in Genome Browser
Species Human (GRCh38)
Location 19:33249190-33249212
Sequence CAGTGGCATGGTTGTCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165069915_1165069923 2 Left 1165069915 19:33249190-33249212 CCTGTGTGACAACCATGCCACTG No data
Right 1165069923 19:33249215-33249237 GGGGAACTGAGCCTCGGAGAGGG No data
1165069915_1165069924 3 Left 1165069915 19:33249190-33249212 CCTGTGTGACAACCATGCCACTG No data
Right 1165069924 19:33249216-33249238 GGGAACTGAGCCTCGGAGAGGGG No data
1165069915_1165069921 -4 Left 1165069915 19:33249190-33249212 CCTGTGTGACAACCATGCCACTG No data
Right 1165069921 19:33249209-33249231 ACTGACGGGGAACTGAGCCTCGG No data
1165069915_1165069925 6 Left 1165069915 19:33249190-33249212 CCTGTGTGACAACCATGCCACTG No data
Right 1165069925 19:33249219-33249241 AACTGAGCCTCGGAGAGGGGAGG No data
1165069915_1165069928 28 Left 1165069915 19:33249190-33249212 CCTGTGTGACAACCATGCCACTG No data
Right 1165069928 19:33249241-33249263 GTGACTCACAGAGGTGACCCAGG No data
1165069915_1165069927 19 Left 1165069915 19:33249190-33249212 CCTGTGTGACAACCATGCCACTG No data
Right 1165069927 19:33249232-33249254 AGAGGGGAGGTGACTCACAGAGG No data
1165069915_1165069922 1 Left 1165069915 19:33249190-33249212 CCTGTGTGACAACCATGCCACTG No data
Right 1165069922 19:33249214-33249236 CGGGGAACTGAGCCTCGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165069915 Original CRISPR CAGTGGCATGGTTGTCACAC AGG (reversed) Intergenic
No off target data available for this crispr