ID: 1165069924

View in Genome Browser
Species Human (GRCh38)
Location 19:33249216-33249238
Sequence GGGAACTGAGCCTCGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165069910_1165069924 14 Left 1165069910 19:33249179-33249201 CCCCACCCGGGCCTGTGTGACAA No data
Right 1165069924 19:33249216-33249238 GGGAACTGAGCCTCGGAGAGGGG No data
1165069915_1165069924 3 Left 1165069915 19:33249190-33249212 CCTGTGTGACAACCATGCCACTG No data
Right 1165069924 19:33249216-33249238 GGGAACTGAGCCTCGGAGAGGGG No data
1165069913_1165069924 9 Left 1165069913 19:33249184-33249206 CCCGGGCCTGTGTGACAACCATG No data
Right 1165069924 19:33249216-33249238 GGGAACTGAGCCTCGGAGAGGGG No data
1165069914_1165069924 8 Left 1165069914 19:33249185-33249207 CCGGGCCTGTGTGACAACCATGC No data
Right 1165069924 19:33249216-33249238 GGGAACTGAGCCTCGGAGAGGGG No data
1165069912_1165069924 12 Left 1165069912 19:33249181-33249203 CCACCCGGGCCTGTGTGACAACC No data
Right 1165069924 19:33249216-33249238 GGGAACTGAGCCTCGGAGAGGGG No data
1165069907_1165069924 29 Left 1165069907 19:33249164-33249186 CCTTGCACTTGATGACCCCACCC No data
Right 1165069924 19:33249216-33249238 GGGAACTGAGCCTCGGAGAGGGG No data
1165069911_1165069924 13 Left 1165069911 19:33249180-33249202 CCCACCCGGGCCTGTGTGACAAC No data
Right 1165069924 19:33249216-33249238 GGGAACTGAGCCTCGGAGAGGGG No data
1165069919_1165069924 -9 Left 1165069919 19:33249202-33249224 CCATGCCACTGACGGGGAACTGA No data
Right 1165069924 19:33249216-33249238 GGGAACTGAGCCTCGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165069924 Original CRISPR GGGAACTGAGCCTCGGAGAG GGG Intergenic
No off target data available for this crispr