ID: 1165069951

View in Genome Browser
Species Human (GRCh38)
Location 19:33249340-33249362
Sequence GCGGGTGCCCAGGAGGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165069943_1165069951 8 Left 1165069943 19:33249309-33249331 CCAGGAAAATCCTGCCGGAAGAG No data
Right 1165069951 19:33249340-33249362 GCGGGTGCCCAGGAGGCTGCGGG No data
1165069940_1165069951 18 Left 1165069940 19:33249299-33249321 CCAGCCGCTGCCAGGAAAATCCT No data
Right 1165069951 19:33249340-33249362 GCGGGTGCCCAGGAGGCTGCGGG No data
1165069947_1165069951 -6 Left 1165069947 19:33249323-33249345 CCGGAAGAGTGCACTGTGCGGGT No data
Right 1165069951 19:33249340-33249362 GCGGGTGCCCAGGAGGCTGCGGG No data
1165069944_1165069951 -2 Left 1165069944 19:33249319-33249341 CCTGCCGGAAGAGTGCACTGTGC No data
Right 1165069951 19:33249340-33249362 GCGGGTGCCCAGGAGGCTGCGGG No data
1165069941_1165069951 14 Left 1165069941 19:33249303-33249325 CCGCTGCCAGGAAAATCCTGCCG No data
Right 1165069951 19:33249340-33249362 GCGGGTGCCCAGGAGGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165069951 Original CRISPR GCGGGTGCCCAGGAGGCTGC GGG Intergenic
No off target data available for this crispr