ID: 1165070619

View in Genome Browser
Species Human (GRCh38)
Location 19:33253173-33253195
Sequence GGTTCCCGGAAGCCGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165070619_1165070631 20 Left 1165070619 19:33253173-33253195 CCCAGCAGCGGCTTCCGGGAACC No data
Right 1165070631 19:33253216-33253238 ACATCACAGGTTTTTCCAGCGGG No data
1165070619_1165070629 7 Left 1165070619 19:33253173-33253195 CCCAGCAGCGGCTTCCGGGAACC No data
Right 1165070629 19:33253203-33253225 CAGTCTCTGGGAAACATCACAGG No data
1165070619_1165070630 19 Left 1165070619 19:33253173-33253195 CCCAGCAGCGGCTTCCGGGAACC No data
Right 1165070630 19:33253215-33253237 AACATCACAGGTTTTTCCAGCGG No data
1165070619_1165070623 -6 Left 1165070619 19:33253173-33253195 CCCAGCAGCGGCTTCCGGGAACC No data
Right 1165070623 19:33253190-33253212 GGAACCCGGTGCCCAGTCTCTGG No data
1165070619_1165070624 -5 Left 1165070619 19:33253173-33253195 CCCAGCAGCGGCTTCCGGGAACC No data
Right 1165070624 19:33253191-33253213 GAACCCGGTGCCCAGTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165070619 Original CRISPR GGTTCCCGGAAGCCGCTGCT GGG (reversed) Intergenic
No off target data available for this crispr